Starting /dee2/code/volunteer_pipeline.sh SRR7172711 current disk space = 3059057520640 free memory = 1413907768 SRR7172711 SRAfilesize 91dfa7b4866221246d5fbbbf0d47d67d SRR7172711.sra SRR7172711.sra file validated SRR7172711 is paired end SRR7172711 is conventional basespace SRR7172711 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172711_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 26.64025 31.0 18.0 33.0 18.0 33.0 2 30.85425 33.0 30.0 33.0 27.0 33.0 3 31.99 33.0 32.0 33.0 28.0 34.0 4 32.58 33.0 33.0 33.0 32.0 34.0 5 32.89725 33.0 33.0 34.0 32.0 34.0 6 37.257 38.0 38.0 38.0 36.0 38.0 7 37.446 38.0 38.0 38.0 37.0 38.0 8 37.651 38.0 38.0 38.0 38.0 38.0 9 37.71675 38.0 38.0 38.0 38.0 38.0 10-14 37.67405 38.0 38.0 38.0 38.0 38.0 15-19 37.6331 38.0 38.0 38.0 38.0 38.0 20-24 37.62405 38.0 38.0 38.0 38.0 38.0 25-29 37.6838 38.0 38.0 38.0 38.0 38.0 30-34 37.6253 38.0 38.0 38.0 38.0 38.0 35-39 37.5837 38.0 38.0 38.0 38.0 38.0 40-44 37.55544999999999 38.0 38.0 38.0 38.0 38.0 45-49 37.521550000000005 38.0 38.0 38.0 38.0 38.0 50-54 37.498400000000004 38.0 38.0 38.0 38.0 38.0 55-59 37.40024999999999 38.0 38.0 38.0 37.0 38.0 60-64 37.363800000000005 38.0 38.0 38.0 37.0 38.0 65-69 37.326 38.0 38.0 38.0 37.0 38.0 70-74 37.28395 38.0 38.0 38.0 37.0 38.0 75-79 37.213350000000005 38.0 38.0 38.0 37.0 38.0 80-84 37.14175 38.0 38.0 38.0 36.6 38.0 85-89 37.003 38.0 38.0 38.0 36.0 38.0 90-94 37.07395 38.0 38.0 38.0 36.0 38.0 95-99 37.076750000000004 38.0 38.0 38.0 36.0 38.0 100-104 36.913799999999995 38.0 38.0 38.0 35.8 38.0 105-109 36.69355 38.0 38.0 38.0 34.8 38.0 110-114 36.587300000000006 38.0 38.0 38.0 34.4 38.0 115-119 36.56400000000001 38.0 38.0 38.0 34.4 38.0 120-124 36.46435 38.0 38.0 38.0 34.0 38.0 125-129 36.10425000000001 38.0 37.8 38.0 33.6 38.0 130-134 35.8291 38.0 36.8 38.0 32.2 38.0 135-139 35.496050000000004 38.0 36.0 38.0 31.0 38.0 140-144 35.4557 38.0 36.0 38.0 31.4 38.0 145-149 35.2647 38.0 36.0 38.0 31.0 38.0 150-151 32.213 36.5 32.5 38.0 16.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 5 1.0 6 0.0 7 0.0 8 1.0 9 0.0 10 0.0 11 1.0 12 0.0 13 0.0 14 1.0 15 0.0 16 2.0 17 0.0 18 0.0 19 3.0 20 1.0 21 2.0 22 0.0 23 4.0 24 2.0 25 7.0 26 13.0 27 15.0 28 22.0 29 23.0 30 29.0 31 37.0 32 59.0 33 73.0 34 110.0 35 206.0 36 556.0 37 2832.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.32642619595804 11.92120746994116 12.893323100537222 38.859043233563575 2 19.698492462311556 19.045226130653266 38.768844221105525 22.48743718592965 3 19.625 25.25 26.55 28.575 4 22.650000000000002 33.650000000000006 21.85 21.85 5 20.775 36.65 24.275 18.3 6 17.2 36.725 25.650000000000002 20.424999999999997 7 13.275 22.675 44.95 19.1 8 18.275 21.675 31.175000000000004 28.875 9 18.75 23.075000000000003 31.324999999999996 26.85 10-14 19.54 29.189999999999998 27.26 24.01 15-19 19.965 27.925 28.185 23.925 20-24 20.26 28.365000000000002 27.76 23.615 25-29 19.845 28.34 28.12 23.695 30-34 19.615 29.07 27.810000000000002 23.505000000000003 35-39 20.22 28.084999999999997 28.244999999999997 23.45 40-44 19.495 28.665000000000003 28.075 23.765 45-49 20.25 28.005000000000003 27.905 23.84 50-54 20.16 28.105000000000004 27.839999999999996 23.895 55-59 20.385 28.52 27.54 23.555 60-64 19.935 28.000000000000004 27.950000000000003 24.115000000000002 65-69 20.185 28.13 27.905 23.78 70-74 19.935 27.725 28.595 23.745 75-79 20.195 27.534999999999997 28.09 24.18 80-84 20.32 27.944999999999997 27.694999999999997 24.04 85-89 20.775 28.23 27.779999999999998 23.215 90-94 20.68 28.410000000000004 27.46 23.45 95-99 20.474999999999998 27.950000000000003 27.845 23.73 100-104 20.72 28.33 27.355 23.595 105-109 20.445 27.49 28.689999999999998 23.375 110-114 20.615 28.139999999999997 27.744999999999997 23.5 115-119 20.805 27.555000000000003 27.950000000000003 23.69 120-124 20.805 28.255000000000003 27.62 23.32 125-129 20.705000000000002 28.505000000000003 27.58 23.21 130-134 20.575 28.410000000000004 27.57 23.445 135-139 20.76 27.615000000000002 27.82 23.805 140-144 21.205 27.26 27.52 24.015 145-149 20.9 28.439999999999998 27.084999999999997 23.575 150-151 21.099999999999998 27.3875 27.250000000000004 24.2625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 1.0 19 1.0 20 1.0 21 1.0 22 0.5 23 1.0 24 1.5 25 2.5 26 2.5 27 5.0 28 9.0 29 11.0 30 12.5 31 20.0 32 28.5 33 39.5 34 51.5 35 67.5 36 83.5 37 107.5 38 128.0 39 148.0 40 186.0 41 231.5 42 277.0 43 297.0 44 296.0 45 303.0 46 276.0 47 239.0 48 232.5 49 210.0 50 164.0 51 120.0 52 105.5 53 87.5 54 56.5 55 46.5 56 40.0 57 23.0 58 15.5 59 14.0 60 13.5 61 12.5 62 8.5 63 5.0 64 3.5 65 3.0 66 3.0 67 1.0 68 1.5 69 2.0 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.275 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.5227329816629 99.05000000000001 2 0.4772670183371013 0.95 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0125 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.0875 0.0 0.0 0.0 0.0 96-97 0.1 0.0 0.0 0.0 0.0 98-99 0.125 0.0 0.0 0.0 0.0 100-101 0.15 0.0 0.0 0.0 0.0 102-103 0.2125 0.0 0.0 0.0 0.0 104-105 0.375 0.0 0.0 0.0 0.0 106-107 0.5 0.0 0.0 0.0 0.0 108-109 0.6125 0.0 0.0 0.0 0.0 110-111 0.75 0.0 0.0 0.0 0.0 112-113 0.975 0.0 0.0 0.0 0.0 114-115 1.1749999999999998 0.0 0.0 0.0 0.0 116-117 1.3375 0.0 0.0 0.0 0.0 118-119 1.5499999999999998 0.0 0.0 0.0 0.0 120-121 1.7875 0.0 0.0 0.0 0.0 122-123 2.0125 0.0 0.0 0.0 0.0 124-125 2.3375 0.0 0.0 0.0 0.0 126-127 2.8 0.0 0.0 0.0 0.0 128-129 3.3 0.0 0.0 0.0 0.0 130-131 3.55 0.0 0.0 0.0 0.0 132-133 3.875 0.0 0.0 0.0 0.0 134-135 4.175000000000001 0.0 0.0 0.0 0.0 136-137 4.4 0.0 0.0 0.0 0.0 138-139 4.8125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CACTTTT 10 0.006832588 144.9875 9 TCGTTCT 10 0.006832588 144.9875 9 >>END_MODULE SRR7172711 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172711_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.14575 34.0 33.0 34.0 33.0 34.0 2 33.288 34.0 33.0 34.0 33.0 34.0 3 33.24375 34.0 33.0 34.0 33.0 34.0 4 33.2525 34.0 33.0 34.0 33.0 34.0 5 33.268 34.0 33.0 34.0 33.0 34.0 6 37.3635 38.0 38.0 38.0 38.0 38.0 7 37.38975 38.0 38.0 38.0 38.0 38.0 8 37.36375 38.0 38.0 38.0 38.0 38.0 9 37.30575 38.0 38.0 38.0 38.0 38.0 10-14 37.3275 38.0 38.0 38.0 38.0 38.0 15-19 37.33435000000001 38.0 38.0 38.0 38.0 38.0 20-24 37.31635 38.0 38.0 38.0 38.0 38.0 25-29 37.0723 38.0 38.0 38.0 37.6 38.0 30-34 36.4 38.0 38.0 38.0 36.6 38.0 35-39 36.740449999999996 38.0 38.0 38.0 36.8 38.0 40-44 37.14755 38.0 38.0 38.0 37.0 38.0 45-49 37.2399 38.0 38.0 38.0 37.4 38.0 50-54 37.193349999999995 38.0 38.0 38.0 37.4 38.0 55-59 37.12905 38.0 38.0 38.0 37.0 38.0 60-64 36.93015 38.0 38.0 38.0 36.2 38.0 65-69 36.82875 38.0 38.0 38.0 36.0 38.0 70-74 36.91975000000001 38.0 38.0 38.0 36.0 38.0 75-79 36.86659999999999 38.0 38.0 38.0 36.0 38.0 80-84 36.837849999999996 38.0 38.0 38.0 36.0 38.0 85-89 36.718849999999996 38.0 38.0 38.0 35.8 38.0 90-94 36.66185 38.0 38.0 38.0 35.6 38.0 95-99 36.6468 38.0 38.0 38.0 35.4 38.0 100-104 36.55745 38.0 38.0 38.0 35.0 38.0 105-109 36.49235 38.0 38.0 38.0 34.8 38.0 110-114 36.2724 38.0 38.0 38.0 34.2 38.0 115-119 36.1478 38.0 38.0 38.0 34.0 38.0 120-124 35.9485 38.0 38.0 38.0 33.4 38.0 125-129 35.663450000000005 38.0 37.0 38.0 31.8 38.0 130-134 35.43475 38.0 36.2 38.0 31.0 38.0 135-139 35.16655000000001 38.0 36.0 38.0 29.6 38.0 140-144 34.7522 38.0 36.0 38.0 28.8 38.0 145-149 34.171949999999995 38.0 35.4 38.0 26.6 38.0 150-151 29.833374999999997 35.5 27.0 38.0 8.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 7.0 3 5.0 4 2.0 5 1.0 6 1.0 7 0.0 8 0.0 9 1.0 10 2.0 11 3.0 12 1.0 13 0.0 14 4.0 15 0.0 16 3.0 17 4.0 18 6.0 19 5.0 20 3.0 21 3.0 22 7.0 23 5.0 24 9.0 25 12.0 26 14.0 27 21.0 28 12.0 29 32.0 30 33.0 31 60.0 32 70.0 33 81.0 34 132.0 35 216.0 36 481.0 37 2764.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.0 15.0 17.0 31.0 2 22.8 24.5 35.949999999999996 16.75 3 20.875 26.85 31.225 21.05 4 24.9 32.800000000000004 21.825 20.474999999999998 5 25.0 36.425000000000004 21.15 17.424999999999997 6 18.0 39.550000000000004 23.875 18.575 7 19.45 16.25 42.35 21.95 8 21.05 22.25 28.275 28.425 9 22.8 24.025 28.675 24.5 10-14 23.325000000000003 29.285 25.885 21.505 15-19 23.25 28.125 28.050000000000004 20.575 20-24 22.485 27.965 28.4 21.15 25-29 23.161653757167286 28.784830499949702 27.205512523890956 20.848003218992055 30-34 22.92797869070792 27.947956152033605 27.466448109824814 21.657617047433664 35-39 23.105715730905413 28.715225088517954 27.34951947395043 20.829539706626203 40-44 22.705000000000002 28.175 27.805000000000003 21.315 45-49 23.3 28.03 27.54 21.13 50-54 23.24 28.52 27.27 20.97 55-59 23.585 28.610000000000003 27.025 20.78 60-64 23.62 27.85 27.61 20.919999999999998 65-69 23.625 28.825 27.525 20.025000000000002 70-74 23.655 28.689999999999998 27.500000000000004 20.155 75-79 23.54 27.87 27.76 20.830000000000002 80-84 23.974999999999998 27.47 27.74 20.815 85-89 23.419999999999998 27.944999999999997 28.115000000000002 20.52 90-94 23.575 27.66 28.165000000000003 20.599999999999998 95-99 23.97 27.800000000000004 27.544999999999998 20.685000000000002 100-104 24.224999999999998 27.744999999999997 27.6 20.43 105-109 23.78 28.17 27.705000000000002 20.345 110-114 23.695 28.62 27.395000000000003 20.29 115-119 24.19 28.08 27.395000000000003 20.335 120-124 23.84 28.235 27.855 20.07 125-129 23.87 28.13 27.465 20.535 130-134 24.62 28.305000000000003 26.83 20.244999999999997 135-139 24.610000000000003 28.335 26.855 20.200000000000003 140-144 24.545 28.175 27.139999999999997 20.14 145-149 25.424999999999997 27.834999999999997 27.455000000000002 19.285 150-151 25.4375 28.537499999999998 26.35 19.675 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 1.0 21 1.5 22 0.5 23 1.5 24 1.5 25 1.0 26 1.0 27 2.0 28 4.0 29 7.0 30 10.0 31 12.5 32 21.0 33 28.5 34 39.5 35 55.5 36 72.5 37 100.5 38 128.5 39 161.0 40 205.0 41 251.5 42 288.0 43 297.0 44 293.5 45 302.0 46 280.5 47 249.0 48 229.0 49 197.5 50 161.0 51 134.5 52 111.0 53 79.5 54 62.0 55 47.5 56 37.0 57 25.0 58 18.0 59 18.0 60 13.5 61 9.5 62 11.0 63 9.5 64 3.0 65 2.0 66 3.0 67 2.0 68 1.5 69 2.5 70 1.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.59 30-34 2.39 35-39 1.15 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.45 #Duplication Level Percentage of deduplicated Percentage of total 1 99.47209653092006 98.925 2 0.5027652086475616 1.0 3 0.025138260432378077 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0125 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.0875 0.0 0.0 0.0 0.0 96-97 0.1 0.0 0.0 0.0 0.0 98-99 0.125 0.0 0.0 0.0 0.0 100-101 0.15 0.0 0.0 0.0 0.0 102-103 0.2125 0.0 0.0 0.0 0.0 104-105 0.375 0.0 0.0 0.0 0.0 106-107 0.5 0.0 0.0 0.0 0.0 108-109 0.6125 0.0 0.0 0.0 0.0 110-111 0.75 0.0 0.0 0.0 0.0 112-113 0.9875 0.0 0.0 0.0 0.0 114-115 1.1749999999999998 0.0 0.0 0.0 0.0 116-117 1.3375 0.0 0.0 0.0 0.0 118-119 1.5625 0.0 0.0 0.0 0.0 120-121 1.8125 0.0 0.0 0.0 0.0 122-123 2.05 0.0 0.0 0.0 0.0 124-125 2.3875 0.0 0.0 0.0 0.0 126-127 2.8375000000000004 0.0 0.0 0.0 0.0 128-129 3.325 0.0 0.0 0.0 0.0 130-131 3.575 0.0 0.0 0.0 0.0 132-133 3.925 0.0 0.0 0.0 0.0 134-135 4.199999999999999 0.0 0.0 0.0 0.0 136-137 4.4125 0.0 0.0 0.0 0.0 138-139 4.8125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCAAGGT 10 0.00686971 144.72499 2 AAGAATA 10 0.00686971 144.72499 3 AAAAAAA 40 0.0075174426 18.181532 20-24 >>END_MODULE Read 783684 spots for SRR7172711.sra Written 783684 spots for SRR7172711.sra Read 783684 spots for SRR7172711.sra Written 783684 spots for SRR7172711.sra Read 783684 spots for SRR7172711.sra Written 783684 spots for SRR7172711.sra Read 783684 spots for SRR7172711.sra Written 783684 spots for SRR7172711.sra Read 783684 spots for SRR7172711.sra Written 783684 spots for SRR7172711.sra Read 783684 spots for SRR7172711.sra Written 783684 spots for SRR7172711.sra Read 783684 spots for SRR7172711.sra Written 783684 spots for SRR7172711.sra Read 783684 spots for SRR7172711.sra Written 783684 spots for SRR7172711.sra Read 783684 spots for SRR7172711.sra Written 783684 spots for SRR7172711.sra Read 783684 spots for SRR7172711.sra Written 783684 spots for SRR7172711.sra Read 783684 spots for SRR7172711.sra Written 783684 spots for SRR7172711.sra Read 783684 spots for SRR7172711.sra Written 783684 spots for SRR7172711.sra Read 783684 spots for SRR7172711.sra Written 783684 spots for SRR7172711.sra Read 783684 spots for SRR7172711.sra Written 783684 spots for SRR7172711.sra Read 783684 spots for SRR7172711.sra Written 783684 spots for SRR7172711.sra Read 783684 spots for SRR7172711.sra Written 783684 spots for SRR7172711.sra Read 783684 spots for SRR7172711.sra Written 783684 spots for SRR7172711.sra Read 783685 spots for SRR7172711.sra Written 783685 spots for SRR7172711.sra Read 783684 spots for SRR7172711.sra Written 783684 spots for SRR7172711.sra Read 783684 spots for SRR7172711.sra Written 783684 spots for SRR7172711.sra SRR ids: ['SRR7172711.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_bii2y6o9 SRR7172711.sra spots: 15673681 blocks: [[1, 783684], [783685, 1567368], [1567369, 2351052], [2351053, 3134736], [3134737, 3918420], [3918421, 4702104], [4702105, 5485788], [5485789, 6269472], [6269473, 7053156], [7053157, 7836840], [7836841, 8620524], [8620525, 9404208], [9404209, 10187892], [10187893, 10971576], [10971577, 11755260], [11755261, 12538944], [12538945, 13322628], [13322629, 14106312], [14106313, 14889996], [14889997, 15673681]] SRR7172711 file size 5289595 SRR7172711 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172711 SRR7172711_1.fastq SRR7172711_2.fastq Input file: SRR7172711_1.fastq Paired file: SRR7172711_2.fastq trimmed: SRR7172711-trimmed-pair1.fastq, SRR7172711-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 14:30:54 2025 >> started Mon Feb 10 14:31:26 2025 >> done (31.312s) 15673681 read pairs processed; of these: 14380 ( 0.09%) short read pairs filtered out after trimming by size control 9185 ( 0.06%) empty read pairs filtered out after trimming by size control 15650116 (99.85%) read pairs available; of these: 6345006 (40.54%) trimmed read pairs available after processing 9305110 (59.46%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 0 0.00% 20 2 0.00% 21 2 0.00% 22 3 0.00% 23 2 0.00% 24 1 0.00% 25 2 0.00% 26 0 0.00% 27 4 0.00% 28 2 0.00% 29 2 0.00% 30 4 0.00% 31 1 0.00% 32 1 0.00% 33 3 0.00% 34 2 0.00% 35 2 0.00% 36 2 0.00% 37 2 0.00% 38 3 0.00% 39 2 0.00% 40 2 0.00% 41 8 0.00% 42 3 0.00% 43 3 0.00% 44 6 0.00% 45 5 0.00% 46 4 0.00% 47 5 0.00% 48 8 0.00% 49 6 0.00% 50 8 0.00% 51 4 0.00% 52 13 0.00% 53 17 0.00% 54 22 0.00% 55 26 0.00% 56 24 0.00% 57 23 0.00% 58 31 0.00% 59 25 0.00% 60 30 0.00% 61 48 0.00% 62 43 0.00% 63 39 0.00% 64 55 0.00% 65 62 0.00% 66 65 0.00% 67 86 0.00% 68 91 0.00% 69 102 0.00% 70 121 0.00% 71 124 0.00% 72 161 0.00% 73 157 0.00% 74 210 0.00% 75 217 0.00% 76 261 0.00% 77 293 0.00% 78 313 0.00% 79 336 0.00% 80 414 0.00% 81 490 0.00% 82 556 0.00% 83 667 0.00% 84 1508 0.01% 85 2038 0.01% 86 2084 0.01% 87 2180 0.01% 88 2345 0.01% 89 2332 0.01% 90 2372 0.02% 91 2455 0.02% 92 2626 0.02% 93 2759 0.02% 94 3041 0.02% 95 3249 0.02% 96 3533 0.02% 97 3938 0.03% 98 4167 0.03% 99 4531 0.03% 100 4847 0.03% 101 5436 0.03% 102 5859 0.04% 103 6519 0.04% 104 6875 0.04% 105 7554 0.05% 106 8506 0.05% 107 9310 0.06% 108 9765 0.06% 109 10805 0.07% 110 11426 0.07% 111 12173 0.08% 112 13509 0.09% 113 14486 0.09% 114 15423 0.10% 115 16713 0.11% 116 17678 0.11% 117 19029 0.12% 118 20513 0.13% 119 21331 0.14% 120 22325 0.14% 121 24098 0.15% 122 25424 0.16% 123 26961 0.17% 124 28439 0.18% 125 30021 0.19% 126 32163 0.21% 127 33443 0.21% 128 34844 0.22% 129 37182 0.24% 130 38872 0.25% 131 40726 0.26% 132 42734 0.27% 133 45357 0.29% 134 47889 0.31% 135 50198 0.32% 136 52656 0.34% 137 55806 0.36% 138 59128 0.38% 139 62755 0.40% 140 66692 0.43% 141 71933 0.46% 142 78725 0.50% 143 86235 0.55% 144 97734 0.62% 145 112771 0.72% 146 138383 0.88% 147 180983 1.16% 148 270272 1.73% 149 651629 4.16% 150 3510484 22.43% 151 9305110 59.46% 15650116 reads passed initial QC criterion=sequence-density sequence-density=0.29 sequence-density-rank=1 fanout-score=2.88 fanout-score-rank=22 prefix-density=0.37 prefix-fanout=2.2 sequence=CATCTCAGACCTCTC criterion=fanout-score sequence-density=0.09 sequence-density-rank=21 fanout-score=376.72 fanout-score-rank=1 prefix-density=0.95 prefix-fanout=35.3 sequence=CTTCTTCTTCCT criterion=sequence-density sequence-density=0.44 sequence-density-rank=1 fanout-score=4.42 fanout-score-rank=14 prefix-density=0.60 prefix-fanout=3.2 sequence=CTGCAAATGTGG criterion=fanout-score sequence-density=0.09 sequence-density-rank=22 fanout-score=123.06 fanout-score-rank=1 prefix-density=0.46 prefix-fanout=23.5 sequence=TGATGAGGATGA SRR7172711 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 14:32:29 Started mapping on | Feb 10 14:32:29 Finished on | Feb 10 14:35:22 Mapping speed, Million of reads per hour | 325.67 Number of input reads | 15650116 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 14718589 Uniquely mapped reads % | 94.05% Average mapped length | 296.50 Number of splices: Total | 15216714 Number of splices: Annotated (sjdb) | 14953707 Number of splices: GT/AG | 14974100 Number of splices: GC/AG | 193242 Number of splices: AT/AC | 10920 Number of splices: Non-canonical | 38452 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.03% Deletion average length | 2.47 Insertion rate per base | 0.02% Insertion average length | 2.58 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 412490 % of reads mapped to multiple loci | 2.64% Number of reads mapped to too many loci | 43580 % of reads mapped to too many loci | 0.28% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.97% % of reads unmapped: other | 0.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 533129 533129 533129 N_multimapping 412490 412490 412490 N_noFeature 318587 14588613 369440 N_ambiguous 147806 870 68134 UnstrandedReadsAssigned:14252196 PositiveStrandReadsAssigned:129106 NegativeStrandReadsAssigned:14281015 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7172711 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172711-trimmed-pair1.fastq SRR7172711-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,650,116 reads, 14,187,222 reads pseudoaligned [quant] estimated average fragment length: 237.033 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,043 rounds 52401 SRR7172711.ke.tsv 34699 SRR7172711.se.tsv 87100 total ==> SRR7172711.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1781.97 1371 49.3132 Potri.005G024800.1.v4.1 1035 798.967 284 22.7832 Potri.004G059700.1.v4.1 961 724.986 88 7.77998 Potri.007G009000.2.v4.1 1416 1179.97 0 0 Potri.003G141000.2.v4.1 2943 2706.97 510 12.0757 Potri.016G087400.1.v4.1 270 76.8459 1286.59 1073.11 Potri.015G069301.1.v4.1 564 330.574 0 0 Potri.010G195200.1.v4.1 1773 1536.97 461 19.2248 Potri.012G127500.1.v4.1 977 740.974 3691 319.276 ==> SRR7172711.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 22 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 392 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 4 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 140 SRR7172711 completed mapping pipeline successfully