Starting /dee2/code/volunteer_pipeline.sh SRR7172712 current disk space = 3059075227648 free memory = 1529874304 SRR7172712 SRAfilesize c56376faa5290483ff1a6b878b5e37b0 SRR7172712.sra SRR7172712.sra file validated SRR7172712 is paired end SRR7172712 is conventional basespace SRR7172712 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172712_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 26.8635 31.0 18.0 33.0 18.0 34.0 2 31.652 33.0 31.0 33.0 28.0 34.0 3 31.84475 33.0 31.0 33.0 28.0 34.0 4 32.72425 33.0 33.0 34.0 32.0 34.0 5 33.241 34.0 33.0 34.0 33.0 34.0 6 37.18825 38.0 37.0 38.0 36.0 38.0 7 37.52325 38.0 38.0 38.0 37.0 38.0 8 37.61 38.0 38.0 38.0 38.0 38.0 9 37.641 38.0 38.0 38.0 38.0 38.0 10-14 37.67425 38.0 38.0 38.0 38.0 38.0 15-19 37.662850000000006 38.0 38.0 38.0 38.0 38.0 20-24 37.6709 38.0 38.0 38.0 38.0 38.0 25-29 37.646649999999994 38.0 38.0 38.0 38.0 38.0 30-34 37.56505 38.0 38.0 38.0 38.0 38.0 35-39 37.548649999999995 38.0 38.0 38.0 38.0 38.0 40-44 37.5148 38.0 38.0 38.0 38.0 38.0 45-49 37.49485 38.0 38.0 38.0 38.0 38.0 50-54 37.5129 38.0 38.0 38.0 37.8 38.0 55-59 37.431 38.0 38.0 38.0 37.4 38.0 60-64 37.4427 38.0 38.0 38.0 37.2 38.0 65-69 37.318799999999996 38.0 38.0 38.0 37.0 38.0 70-74 37.33545 38.0 38.0 38.0 37.0 38.0 75-79 37.29215 38.0 38.0 38.0 37.0 38.0 80-84 37.20055000000001 38.0 38.0 38.0 36.4 38.0 85-89 37.1191 38.0 38.0 38.0 36.2 38.0 90-94 37.04135 38.0 38.0 38.0 36.0 38.0 95-99 36.95210000000001 38.0 38.0 38.0 36.0 38.0 100-104 36.9211 38.0 38.0 38.0 35.8 38.0 105-109 36.731700000000004 38.0 38.0 38.0 35.0 38.0 110-114 36.65509999999999 38.0 38.0 38.0 34.8 38.0 115-119 36.52135 38.0 38.0 38.0 34.2 38.0 120-124 36.38835 38.0 38.0 38.0 34.0 38.0 125-129 36.23385 38.0 38.0 38.0 34.0 38.0 130-134 36.017250000000004 38.0 37.4 38.0 33.2 38.0 135-139 35.76925 38.0 36.8 38.0 32.6 38.0 140-144 35.4399 38.0 36.0 38.0 31.2 38.0 145-149 34.90385 38.0 35.8 38.0 29.6 38.0 150-151 32.040375 36.5 32.0 38.0 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 1.0 8 0.0 9 0.0 10 0.0 11 0.0 12 1.0 13 1.0 14 1.0 15 2.0 16 1.0 17 1.0 18 2.0 19 0.0 20 2.0 21 5.0 22 6.0 23 3.0 24 9.0 25 4.0 26 11.0 27 19.0 28 15.0 29 19.0 30 17.0 31 38.0 32 45.0 33 62.0 34 113.0 35 173.0 36 521.0 37 2927.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.74190960149773 13.051618079700456 13.934207007221183 38.27226531158064 2 20.761332331580267 19.784623090408214 37.590783871775606 21.863260706235913 3 19.825 26.700000000000003 24.575 28.9 4 23.200000000000003 34.1 22.3 20.4 5 22.3 35.85 23.599999999999998 18.25 6 17.625 34.599999999999994 25.45 22.325 7 13.900000000000002 21.575 45.1 19.425 8 18.525 22.45 29.475 29.549999999999997 9 18.125 22.625 33.275 25.974999999999998 10-14 20.32 28.59 26.840000000000003 24.25 15-19 20.135 28.01 27.74 24.115000000000002 20-24 20.244999999999997 28.060000000000002 28.035 23.66 25-29 20.01 28.199999999999996 27.889999999999997 23.9 30-34 20.005 28.425 27.595 23.974999999999998 35-39 20.01 28.01 27.575 24.404999999999998 40-44 20.064999999999998 28.13 27.915 23.89 45-49 20.635 27.584999999999997 27.6 24.18 50-54 20.305 27.96 27.150000000000002 24.585 55-59 20.345 28.33 27.405 23.919999999999998 60-64 20.41 27.944999999999997 27.565 24.08 65-69 20.555 27.32 28.044999999999998 24.08 70-74 21.15 27.500000000000004 27.689999999999998 23.66 75-79 20.68 28.29 27.12 23.91 80-84 20.549999999999997 27.055 28.115000000000002 24.279999999999998 85-89 20.855 27.655 27.415 24.075 90-94 21.23 27.295 27.589999999999996 23.885 95-99 20.735 27.675 28.105000000000004 23.485 100-104 21.275 27.82 27.685 23.22 105-109 21.125 27.985 27.35 23.54 110-114 21.46 27.900000000000002 27.33 23.31 115-119 20.86 28.345 26.700000000000003 24.095 120-124 22.015 27.66 27.139999999999997 23.185 125-129 21.105 27.6 27.529999999999998 23.765 130-134 21.72 27.735 26.884999999999998 23.66 135-139 21.705 28.26 26.075 23.96 140-144 21.815 28.444999999999997 25.724999999999998 24.015 145-149 22.015 28.38 26.085 23.52 150-151 21.4375 28.15 25.775 24.637500000000003 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.5 16 0.5 17 0.0 18 0.0 19 0.5 20 1.5 21 1.0 22 0.5 23 1.0 24 1.5 25 1.5 26 3.5 27 7.0 28 8.5 29 9.0 30 13.0 31 20.5 32 29.5 33 33.5 34 48.0 35 65.5 36 87.5 37 108.5 38 125.0 39 150.0 40 171.0 41 220.5 42 246.5 43 242.5 44 283.5 45 286.0 46 255.0 47 259.0 48 235.5 49 201.0 50 170.0 51 140.0 52 116.0 53 83.5 54 73.0 55 64.0 56 49.5 57 41.0 58 32.5 59 27.5 60 21.0 61 13.5 62 9.5 63 10.5 64 8.0 65 6.5 66 6.0 67 3.5 68 1.5 69 1.0 70 1.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 6.525 2 0.17500000000000002 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.84977466199298 99.7 2 0.15022533800701052 0.3 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.037500000000000006 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.0875 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.175 0.0 0.0 0.0 0.0 94-95 0.21250000000000002 0.0 0.0 0.0 0.0 96-97 0.2625 0.0 0.0 0.0 0.0 98-99 0.4375 0.0 0.0 0.0 0.0 100-101 0.6125 0.0 0.0 0.0 0.0 102-103 0.8 0.0 0.0 0.0 0.0 104-105 1.0 0.0 0.0 0.0 0.0 106-107 1.2 0.0 0.0 0.0 0.0 108-109 1.4375 0.0 0.0 0.0 0.0 110-111 1.6 0.0 0.0 0.0 0.0 112-113 1.8625 0.0 0.0 0.0 0.0 114-115 2.2 0.0 0.0 0.0 0.0 116-117 2.6375 0.0 0.0 0.0 0.0 118-119 3.0125 0.0 0.0 0.0 0.0 120-121 3.4 0.0 0.0 0.0 0.0 122-123 3.7125 0.0 0.0 0.0 0.0 124-125 4.15 0.0 0.0 0.0 0.0 126-127 4.825 0.0 0.0 0.0 0.0 128-129 5.300000000000001 0.0 0.0 0.0 0.0 130-131 6.025 0.0 0.0 0.0 0.0 132-133 6.775 0.0 0.0 0.0 0.0 134-135 7.475 0.0 0.0 0.0 0.0 136-137 8.337499999999999 0.0 0.0 0.0 0.0 138-139 9.2375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7172712 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172712_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.2605 34.0 33.0 34.0 33.0 34.0 2 33.33225 34.0 33.0 34.0 33.0 34.0 3 33.396 34.0 33.0 34.0 33.0 34.0 4 33.39025 34.0 33.0 34.0 33.0 34.0 5 33.376 34.0 33.0 34.0 33.0 34.0 6 37.54675 38.0 38.0 38.0 38.0 38.0 7 37.61775 38.0 38.0 38.0 38.0 38.0 8 37.591 38.0 38.0 38.0 38.0 38.0 9 37.55075 38.0 38.0 38.0 38.0 38.0 10-14 37.551300000000005 38.0 38.0 38.0 38.0 38.0 15-19 37.5565 38.0 38.0 38.0 38.0 38.0 20-24 37.55555 38.0 38.0 38.0 38.0 38.0 25-29 37.51935 38.0 38.0 38.0 38.0 38.0 30-34 37.468450000000004 38.0 38.0 38.0 38.0 38.0 35-39 37.495799999999996 38.0 38.0 38.0 38.0 38.0 40-44 37.448 38.0 38.0 38.0 37.6 38.0 45-49 37.36854999999999 38.0 38.0 38.0 37.2 38.0 50-54 37.37345 38.0 38.0 38.0 37.0 38.0 55-59 37.3429 38.0 38.0 38.0 37.0 38.0 60-64 37.3026 38.0 38.0 38.0 37.0 38.0 65-69 37.261849999999995 38.0 38.0 38.0 37.0 38.0 70-74 37.24804999999999 38.0 38.0 38.0 37.0 38.0 75-79 37.2175 38.0 38.0 38.0 36.8 38.0 80-84 37.1313 38.0 38.0 38.0 36.2 38.0 85-89 37.040800000000004 38.0 38.0 38.0 36.0 38.0 90-94 36.90715 38.0 38.0 38.0 35.8 38.0 95-99 36.79395 38.0 38.0 38.0 35.4 38.0 100-104 36.752950000000006 38.0 38.0 38.0 35.0 38.0 105-109 36.56035000000001 38.0 38.0 38.0 34.4 38.0 110-114 36.47795 38.0 38.0 38.0 34.0 38.0 115-119 36.30605 38.0 38.0 38.0 34.0 38.0 120-124 36.18135 38.0 38.0 38.0 33.6 38.0 125-129 35.9172 38.0 37.6 38.0 33.2 38.0 130-134 35.63925 38.0 37.0 38.0 32.4 38.0 135-139 35.2316 38.0 36.0 38.0 31.0 38.0 140-144 34.9244 38.0 36.0 38.0 29.2 38.0 145-149 34.19435 38.0 35.0 38.0 25.8 38.0 150-151 30.776625000000003 36.5 29.0 38.0 11.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 2.0 4 1.0 5 0.0 6 0.0 7 0.0 8 0.0 9 1.0 10 1.0 11 0.0 12 1.0 13 1.0 14 0.0 15 2.0 16 4.0 17 1.0 18 0.0 19 7.0 20 5.0 21 3.0 22 7.0 23 5.0 24 7.0 25 7.0 26 14.0 27 21.0 28 16.0 29 26.0 30 28.0 31 42.0 32 44.0 33 67.0 34 109.0 35 203.0 36 529.0 37 2845.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.1 14.499999999999998 16.725 30.675 2 25.35 21.725 34.5 18.425 3 21.425 26.375 30.575000000000003 21.625 4 25.6 33.650000000000006 21.275 19.475 5 24.425 36.775000000000006 20.200000000000003 18.6 6 20.0 38.05 22.650000000000002 19.3 7 19.7 16.775000000000002 41.15 22.375 8 20.825 22.6 27.200000000000003 29.375 9 22.650000000000002 24.224999999999998 28.125 25.0 10-14 23.52 28.860000000000003 25.72 21.9 15-19 22.75 27.445000000000004 27.495000000000005 22.31 20-24 22.830000000000002 28.349999999999998 26.935 21.884999999999998 25-29 23.235 27.775 27.744999999999997 21.245 30-34 23.119999999999997 27.97 27.555000000000003 21.355 35-39 23.135 28.17 27.845 20.849999999999998 40-44 23.66 27.800000000000004 27.73 20.810000000000002 45-49 22.845 27.615000000000002 28.16 21.38 50-54 23.71 27.73 27.375 21.185000000000002 55-59 23.494999999999997 28.050000000000004 27.095000000000002 21.36 60-64 23.945 27.62 27.165 21.27 65-69 23.815 28.18 27.175 20.830000000000002 70-74 23.74 27.944999999999997 26.919999999999998 21.395 75-79 23.57 27.96 27.115000000000002 21.355 80-84 23.815 27.955000000000002 27.139999999999997 21.09 85-89 23.77 28.15 27.05 21.029999999999998 90-94 23.955000000000002 27.68 27.565 20.8 95-99 24.154999999999998 27.175 27.92 20.75 100-104 23.9 27.55 27.435 21.115000000000002 105-109 24.325 28.050000000000004 26.724999999999998 20.9 110-114 24.154999999999998 28.28 26.525 21.04 115-119 24.404999999999998 28.185 27.195000000000004 20.215 120-124 25.064999999999998 27.905 26.96 20.07 125-129 24.51 28.57 26.669999999999998 20.25 130-134 24.895 28.435 26.484999999999996 20.185 135-139 25.924999999999997 27.565 27.075 19.435 140-144 25.555 27.965 26.355 20.125 145-149 25.740000000000002 28.405 25.814999999999998 20.04 150-151 25.75 27.762500000000003 26.4625 20.025000000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.5 22 1.0 23 1.5 24 2.0 25 2.0 26 2.0 27 1.5 28 3.0 29 7.5 30 9.5 31 12.5 32 16.5 33 27.0 34 39.0 35 46.0 36 64.0 37 86.0 38 114.5 39 155.5 40 196.5 41 238.0 42 255.0 43 254.0 44 266.5 45 274.0 46 268.0 47 268.0 48 252.0 49 210.0 50 175.5 51 147.5 52 119.5 53 102.5 54 82.5 55 58.0 56 44.5 57 45.0 58 39.5 59 26.0 60 23.0 61 18.0 62 11.0 63 7.0 64 6.0 65 5.5 66 4.0 67 2.5 68 2.5 69 2.0 70 0.5 71 0.5 72 1.0 73 0.5 74 0.0 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.84977466199298 99.7 2 0.15022533800701052 0.3 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.037500000000000006 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.0875 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.175 0.0 0.0 0.0 0.0 94-95 0.21250000000000002 0.0 0.0 0.0 0.0 96-97 0.2625 0.0 0.0 0.0 0.0 98-99 0.4375 0.0 0.0 0.0 0.0 100-101 0.6125 0.0 0.0 0.0 0.0 102-103 0.8 0.0 0.0 0.0 0.0 104-105 1.0 0.0 0.0 0.0 0.0 106-107 1.2 0.0 0.0 0.0 0.0 108-109 1.45 0.0 0.0 0.0 0.0 110-111 1.6 0.0 0.0 0.0 0.0 112-113 1.8625 0.0 0.0 0.0 0.0 114-115 2.1875 0.0 0.0 0.0 0.0 116-117 2.6125 0.0 0.0 0.0 0.0 118-119 3.0 0.0 0.0 0.0 0.0 120-121 3.375 0.0 0.0 0.0 0.0 122-123 3.6875 0.0 0.0 0.0 0.0 124-125 4.1125 0.0 0.0 0.0 0.0 126-127 4.775 0.0 0.0 0.0 0.0 128-129 5.225 0.0 0.0 0.0 0.0 130-131 5.9375 0.0 0.0 0.0 0.0 132-133 6.65 0.0 0.0 0.0 0.0 134-135 7.3875 0.0 0.0 0.0 0.0 136-137 8.287500000000001 0.0 0.0 0.0 0.0 138-139 9.225 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 788038 spots for SRR7172712.sra Written 788038 spots for SRR7172712.sra Read 788029 spots for SRR7172712.sra Written 788029 spots for SRR7172712.sra Read 788029 spots for SRR7172712.sra Written 788029 spots for SRR7172712.sra Read 788029 spots for SRR7172712.sra Written 788029 spots for SRR7172712.sra Read 788029 spots for SRR7172712.sra Written 788029 spots for SRR7172712.sra Read 788029 spots for SRR7172712.sra Written 788029 spots for SRR7172712.sra Read 788029 spots for SRR7172712.sra Written 788029 spots for SRR7172712.sra Read 788029 spots for SRR7172712.sra Written 788029 spots for SRR7172712.sra Read 788029 spots for SRR7172712.sra Written 788029 spots for SRR7172712.sra Read 788029 spots for SRR7172712.sra Written 788029 spots for SRR7172712.sra Read 788029 spots for SRR7172712.sra Written 788029 spots for SRR7172712.sra Read 788029 spots for SRR7172712.sra Written 788029 spots for SRR7172712.sra Read 788029 spots for SRR7172712.sra Written 788029 spots for SRR7172712.sra Read 788029 spots for SRR7172712.sra Written 788029 spots for SRR7172712.sra Read 788029 spots for SRR7172712.sra Written 788029 spots for SRR7172712.sra Read 788029 spots for SRR7172712.sra Written 788029 spots for SRR7172712.sra Read 788029 spots for SRR7172712.sra Written 788029 spots for SRR7172712.sra Read 788029 spots for SRR7172712.sra Written 788029 spots for SRR7172712.sra Read 788029 spots for SRR7172712.sra Written 788029 spots for SRR7172712.sra Read 788029 spots for SRR7172712.sra Written 788029 spots for SRR7172712.sra SRR ids: ['SRR7172712.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_1683n84o SRR7172712.sra spots: 15760589 blocks: [[1, 788029], [788030, 1576058], [1576059, 2364087], [2364088, 3152116], [3152117, 3940145], [3940146, 4728174], [4728175, 5516203], [5516204, 6304232], [6304233, 7092261], [7092262, 7880290], [7880291, 8668319], [8668320, 9456348], [9456349, 10244377], [10244378, 11032406], [11032407, 11820435], [11820436, 12608464], [12608465, 13396493], [13396494, 14184522], [14184523, 14972551], [14972552, 15760589]] SRR7172712 file size 5319046 SRR7172712 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172712 SRR7172712_1.fastq SRR7172712_2.fastq Input file: SRR7172712_1.fastq Paired file: SRR7172712_2.fastq trimmed: SRR7172712-trimmed-pair1.fastq, SRR7172712-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 15:28:43 2025 >> started Mon Feb 10 15:29:08 2025 >> done (24.231s) 15760589 read pairs processed; of these: 7032 ( 0.04%) short read pairs filtered out after trimming by size control 4538 ( 0.03%) empty read pairs filtered out after trimming by size control 15749019 (99.93%) read pairs available; of these: 7430898 (47.18%) trimmed read pairs available after processing 8318121 (52.82%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 4 0.00% 20 2 0.00% 21 4 0.00% 22 2 0.00% 23 7 0.00% 24 7 0.00% 25 0 0.00% 26 6 0.00% 27 1 0.00% 28 6 0.00% 29 4 0.00% 30 3 0.00% 31 1 0.00% 32 3 0.00% 33 3 0.00% 34 0 0.00% 35 2 0.00% 36 3 0.00% 37 3 0.00% 38 8 0.00% 39 6 0.00% 40 1 0.00% 41 2 0.00% 42 1 0.00% 43 7 0.00% 44 4 0.00% 45 1 0.00% 46 10 0.00% 47 7 0.00% 48 15 0.00% 49 8 0.00% 50 8 0.00% 51 17 0.00% 52 30 0.00% 53 15 0.00% 54 27 0.00% 55 31 0.00% 56 31 0.00% 57 41 0.00% 58 60 0.00% 59 46 0.00% 60 81 0.00% 61 70 0.00% 62 90 0.00% 63 128 0.00% 64 113 0.00% 65 149 0.00% 66 168 0.00% 67 231 0.00% 68 268 0.00% 69 288 0.00% 70 356 0.00% 71 416 0.00% 72 482 0.00% 73 569 0.00% 74 665 0.00% 75 719 0.00% 76 820 0.01% 77 1009 0.01% 78 1091 0.01% 79 1270 0.01% 80 1530 0.01% 81 1755 0.01% 82 2091 0.01% 83 2369 0.02% 84 3035 0.02% 85 3624 0.02% 86 4066 0.03% 87 4624 0.03% 88 4930 0.03% 89 5655 0.04% 90 6018 0.04% 91 6792 0.04% 92 7294 0.05% 93 8100 0.05% 94 8783 0.06% 95 9537 0.06% 96 10440 0.07% 97 11191 0.07% 98 12028 0.08% 99 13041 0.08% 100 14194 0.09% 101 15057 0.10% 102 16306 0.10% 103 17696 0.11% 104 18862 0.12% 105 20407 0.13% 106 21595 0.14% 107 22730 0.14% 108 23779 0.15% 109 25120 0.16% 110 26399 0.17% 111 28219 0.18% 112 29446 0.19% 113 31667 0.20% 114 33203 0.21% 115 35068 0.22% 116 36181 0.23% 117 38121 0.24% 118 39653 0.25% 119 41422 0.26% 120 42986 0.27% 121 44537 0.28% 122 46100 0.29% 123 48190 0.31% 124 50404 0.32% 125 51578 0.33% 126 53804 0.34% 127 56150 0.36% 128 57662 0.37% 129 60256 0.38% 130 62370 0.40% 131 63731 0.40% 132 66785 0.42% 133 68892 0.44% 134 71353 0.45% 135 74819 0.48% 136 77520 0.49% 137 80989 0.51% 138 84172 0.53% 139 89118 0.57% 140 92600 0.59% 141 98378 0.62% 142 105975 0.67% 143 113838 0.72% 144 125222 0.80% 145 142872 0.91% 146 170491 1.08% 147 220883 1.40% 148 329670 2.09% 149 652758 4.14% 150 3455345 21.94% 151 8318121 52.82% 15749019 reads passed initial QC criterion=sequence-density sequence-density=0.29 sequence-density-rank=1 fanout-score=4.23 fanout-score-rank=16 prefix-density=0.34 prefix-fanout=3.7 sequence=CCACATTTGCAGCCA criterion=fanout-score sequence-density=0.06 sequence-density-rank=23 fanout-score=14.82 fanout-score-rank=1 prefix-density=0.14 prefix-fanout=6.6 sequence=AAGCACCATTATACAAACATGAGCTGACCAACTGATAGATTAACTACTGCTTTGTTGGAACCATG criterion=sequence-density sequence-density=0.39 sequence-density-rank=1 fanout-score=2.63 fanout-score-rank=21 prefix-density=0.41 prefix-fanout=2.5 sequence=ATGTACCCTGACTT criterion=fanout-score sequence-density=0.13 sequence-density-rank=17 fanout-score=21.93 fanout-score-rank=1 prefix-density=0.32 prefix-fanout=8.5 sequence=AAGGCCAAGATCCAGGACAAGGA SRR7172712 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 15:30:11 Started mapping on | Feb 10 15:30:11 Finished on | Feb 10 15:33:20 Mapping speed, Million of reads per hour | 299.98 Number of input reads | 15749019 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 13792787 Uniquely mapped reads % | 87.58% Average mapped length | 292.70 Number of splices: Total | 14042417 Number of splices: Annotated (sjdb) | 13793465 Number of splices: GT/AG | 13817635 Number of splices: GC/AG | 177963 Number of splices: AT/AC | 11158 Number of splices: Non-canonical | 35661 Mismatch rate per base, % | 0.30% Deletion rate per base | 0.03% Deletion average length | 2.68 Insertion rate per base | 0.02% Insertion average length | 2.55 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 358296 % of reads mapped to multiple loci | 2.28% Number of reads mapped to too many loci | 47040 % of reads mapped to too many loci | 0.30% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 9.77% % of reads unmapped: other | 0.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1606704 1606704 1606704 N_multimapping 358296 358296 358296 N_noFeature 326755 13676163 371344 N_ambiguous 133728 535 61441 UnstrandedReadsAssigned:13332304 PositiveStrandReadsAssigned:116089 NegativeStrandReadsAssigned:13360002 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7172712 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172712-trimmed-pair1.fastq SRR7172712-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,749,019 reads, 13,340,268 reads pseudoaligned [quant] estimated average fragment length: 218.387 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,076 rounds 52401 SRR7172712.ke.tsv 34699 SRR7172712.se.tsv 87100 total ==> SRR7172712.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1800.61 1143 47.6323 Potri.005G024800.1.v4.1 1035 817.613 146 13.3993 Potri.004G059700.1.v4.1 961 743.619 22 2.21997 Potri.007G009000.2.v4.1 1416 1198.61 0 0 Potri.003G141000.2.v4.1 2943 2725.61 590.195 16.2483 Potri.016G087400.1.v4.1 270 89.3447 1223.65 1027.69 Potri.015G069301.1.v4.1 564 349.517 0 0 Potri.010G195200.1.v4.1 1773 1555.61 314.882 15.1887 Potri.012G127500.1.v4.1 977 759.613 3229 318.971 ==> SRR7172712.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 29 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 392 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 4 Potri.001G452600.v4.1 331 SRR7172712 completed mapping pipeline successfully