Starting /dee2/code/volunteer_pipeline.sh SRR7172713 current disk space = 3059068788736 free memory = 1192147488 SRR7172713 SRAfilesize e0cd0bfac89823a7545ecd9a248daaf6 SRR7172713.sra SRR7172713.sra file validated SRR7172713 is paired end SRR7172713 is conventional basespace SRR7172713 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172713_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 22.0615 18.0 18.0 30.0 18.0 32.0 2 29.44675 30.0 27.0 33.0 27.0 33.0 3 30.62625 32.0 31.0 33.0 25.0 33.0 4 31.447 33.0 32.0 33.0 28.0 33.0 5 31.7905 33.0 32.0 33.0 30.0 34.0 6 36.8395 38.0 37.0 38.0 34.0 38.0 7 37.2955 38.0 38.0 38.0 36.0 38.0 8 37.494 38.0 38.0 38.0 37.0 38.0 9 37.48575 38.0 38.0 38.0 37.0 38.0 10-14 37.61175 38.0 38.0 38.0 38.0 38.0 15-19 37.57765 38.0 38.0 38.0 38.0 38.0 20-24 37.57965 38.0 38.0 38.0 38.0 38.0 25-29 37.62735 38.0 38.0 38.0 38.0 38.0 30-34 37.5724 38.0 38.0 38.0 38.0 38.0 35-39 37.56565 38.0 38.0 38.0 38.0 38.0 40-44 37.5327 38.0 38.0 38.0 38.0 38.0 45-49 37.4903 38.0 38.0 38.0 38.0 38.0 50-54 37.457300000000004 38.0 38.0 38.0 37.2 38.0 55-59 37.3915 38.0 38.0 38.0 37.0 38.0 60-64 37.357299999999995 38.0 38.0 38.0 37.0 38.0 65-69 37.28195 38.0 38.0 38.0 36.6 38.0 70-74 37.263799999999996 38.0 38.0 38.0 36.6 38.0 75-79 37.1534 38.0 38.0 38.0 36.2 38.0 80-84 36.97985 38.0 38.0 38.0 36.0 38.0 85-89 36.949650000000005 38.0 38.0 38.0 35.6 38.0 90-94 37.043049999999994 38.0 38.0 38.0 36.0 38.0 95-99 37.01115 38.0 38.0 38.0 35.8 38.0 100-104 36.82645 38.0 38.0 38.0 35.2 38.0 105-109 36.56965 38.0 38.0 38.0 34.2 38.0 110-114 36.3233 38.0 38.0 38.0 34.0 38.0 115-119 36.38515 38.0 38.0 38.0 34.0 38.0 120-124 36.2587 38.0 38.0 38.0 33.8 38.0 125-129 35.9689 38.0 37.0 38.0 33.0 38.0 130-134 35.3158 38.0 35.8 38.0 29.4 38.0 135-139 35.143350000000005 38.0 35.8 38.0 29.0 38.0 140-144 35.0372 38.0 35.4 38.0 29.0 38.0 145-149 34.6188 38.0 35.0 38.0 28.2 38.0 150-151 30.843 36.5 29.0 38.0 13.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 4.0 20 2.0 21 5.0 22 6.0 23 3.0 24 9.0 25 6.0 26 15.0 27 14.0 28 20.0 29 17.0 30 32.0 31 45.0 32 56.0 33 93.0 34 165.0 35 282.0 36 689.0 37 2537.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 28.780487804878046 17.68934531450578 11.938382541720154 41.59178433889602 2 19.343522926584818 19.067902781257832 37.785016286644954 23.803558005512404 3 18.35 23.35 24.45 33.85 4 21.775 33.375 20.150000000000002 24.7 5 20.724999999999998 35.875 23.75 19.650000000000002 6 17.875 35.55 25.624999999999996 20.95 7 13.125 24.349999999999998 42.85 19.675 8 17.849999999999998 22.875 32.2 27.075 9 18.275 23.25 33.025 25.45 10-14 19.335 29.67 27.250000000000004 23.745 15-19 19.81 28.435 27.87 23.885 20-24 19.580000000000002 28.83 27.944999999999997 23.645 25-29 19.925 28.744999999999997 27.615000000000002 23.715 30-34 19.725 28.99 27.1 24.185000000000002 35-39 19.865 28.65 27.6 23.885 40-44 19.98 28.915000000000003 27.22 23.885 45-49 19.945 28.37 27.534999999999997 24.15 50-54 19.79 28.349999999999998 27.700000000000003 24.16 55-59 20.119999999999997 28.845 27.334999999999997 23.7 60-64 20.095 28.000000000000004 27.794999999999998 24.11 65-69 20.27 28.17 27.46 24.099999999999998 70-74 19.98 28.360000000000003 27.665 23.995 75-79 20.73 28.050000000000004 27.634999999999998 23.585 80-84 20.27 27.54 27.295 24.895 85-89 20.34 27.97 27.474999999999998 24.215 90-94 20.44 28.285 27.37 23.905 95-99 20.72 27.29 27.675 24.315 100-104 20.635 27.915 27.42 24.03 105-109 20.24 27.88 27.889999999999997 23.990000000000002 110-114 21.5 27.76 27.275 23.465 115-119 20.465 27.83 27.615000000000002 24.09 120-124 20.69 27.900000000000002 27.11 24.3 125-129 20.69 27.889999999999997 27.224999999999998 24.195 130-134 21.525 27.935 26.640000000000004 23.9 135-139 20.560000000000002 27.755000000000003 27.16 24.525 140-144 20.855 27.49 27.515 24.14 145-149 21.63 27.889999999999997 26.939999999999998 23.54 150-151 21.3 27.275 26.487500000000004 24.9375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.5 22 2.0 23 1.5 24 2.0 25 5.5 26 6.5 27 6.5 28 7.0 29 10.5 30 19.0 31 28.0 32 31.5 33 33.0 34 44.5 35 66.0 36 87.0 37 119.5 38 146.5 39 162.5 40 190.5 41 223.0 42 253.5 43 264.5 44 258.0 45 250.5 46 250.5 47 249.5 48 235.5 49 206.0 50 178.5 51 148.5 52 116.5 53 91.5 54 66.0 55 54.5 56 46.0 57 32.0 58 22.5 59 16.5 60 16.0 61 11.5 62 6.5 63 7.0 64 4.5 65 4.5 66 4.0 67 3.0 68 3.0 69 1.5 70 0.0 71 0.0 72 0.0 73 1.0 74 2.0 75 1.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.625 2 0.22499999999999998 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.47500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.47222920331743 98.95 2 0.5277707966825836 1.05 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.0875 0.0 0.0 0.0 0.0 92-93 0.1375 0.0 0.0 0.0 0.0 94-95 0.2 0.0 0.0 0.0 0.0 96-97 0.2625 0.0 0.0 0.0 0.0 98-99 0.4 0.0 0.0 0.0 0.0 100-101 0.4625 0.0 0.0 0.0 0.0 102-103 0.5874999999999999 0.0 0.0 0.0 0.0 104-105 0.675 0.0 0.0 0.0 0.0 106-107 0.825 0.0 0.0 0.0 0.0 108-109 1.025 0.0 0.0 0.0 0.0 110-111 1.225 0.0 0.0 0.0 0.0 112-113 1.4249999999999998 0.0 0.0 0.0 0.0 114-115 1.5375 0.0 0.0 0.0 0.0 116-117 1.7125 0.0 0.0 0.0 0.0 118-119 2.0375 0.0 0.0 0.0 0.0 120-121 2.25 0.0 0.0 0.0 0.0 122-123 2.4749999999999996 0.0 0.0 0.0 0.0 124-125 2.8 0.0 0.0 0.0 0.0 126-127 3.075 0.0 0.0 0.0 0.0 128-129 3.2750000000000004 0.0 0.0 0.0 0.0 130-131 3.6625 0.0 0.0 0.0 0.0 132-133 3.9625000000000004 0.0 0.0 0.0 0.0 134-135 4.275 0.0 0.0 0.0 0.0 136-137 4.8125 0.0 0.0 0.0 0.0 138-139 5.2875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACTCAGG 10 0.0068343505 144.975 6 TGAAATT 10 0.0068343505 144.975 8 >>END_MODULE SRR7172713 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172713_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.113 34.0 33.0 34.0 32.0 34.0 2 33.17675 34.0 33.0 34.0 33.0 34.0 3 33.19825 34.0 33.0 34.0 33.0 34.0 4 33.1485 34.0 33.0 34.0 33.0 34.0 5 33.0765 34.0 33.0 34.0 33.0 34.0 6 37.18925 38.0 38.0 38.0 37.0 38.0 7 37.21925 38.0 38.0 38.0 37.0 38.0 8 37.3 38.0 38.0 38.0 38.0 38.0 9 37.249 38.0 38.0 38.0 38.0 38.0 10-14 37.23685 38.0 38.0 38.0 37.2 38.0 15-19 37.2368 38.0 38.0 38.0 37.2 38.0 20-24 37.21195 38.0 38.0 38.0 37.4 38.0 25-29 37.02735 38.0 38.0 38.0 37.0 38.0 30-34 36.418000000000006 38.0 38.0 38.0 36.6 38.0 35-39 36.63175 38.0 38.0 38.0 36.2 38.0 40-44 37.0696 38.0 38.0 38.0 37.0 38.0 45-49 37.07385 38.0 38.0 38.0 37.0 38.0 50-54 37.0037 38.0 38.0 38.0 37.0 38.0 55-59 36.9446 38.0 38.0 38.0 36.4 38.0 60-64 36.739850000000004 38.0 38.0 38.0 36.0 38.0 65-69 36.5736 38.0 38.0 38.0 35.4 38.0 70-74 36.69655 38.0 38.0 38.0 35.4 38.0 75-79 36.6689 38.0 38.0 38.0 35.4 38.0 80-84 36.68745 38.0 38.0 38.0 35.6 38.0 85-89 36.573750000000004 38.0 38.0 38.0 35.2 38.0 90-94 36.472449999999995 38.0 38.0 38.0 34.6 38.0 95-99 36.4281 38.0 38.0 38.0 34.4 38.0 100-104 36.28185 38.0 38.0 38.0 34.2 38.0 105-109 36.1644 38.0 38.0 38.0 34.0 38.0 110-114 35.896699999999996 38.0 38.0 38.0 33.2 38.0 115-119 35.852250000000005 38.0 37.6 38.0 33.0 38.0 120-124 35.67190000000001 38.0 37.0 38.0 31.6 38.0 125-129 35.2947 38.0 36.4 38.0 29.6 38.0 130-134 34.92785 38.0 36.0 38.0 28.0 38.0 135-139 34.6262 38.0 34.8 38.0 27.8 38.0 140-144 34.27105 38.0 34.8 38.0 25.4 38.0 145-149 33.21035 38.0 33.0 38.0 17.8 38.0 150-151 28.486250000000002 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 10.0 3 4.0 4 2.0 5 2.0 6 5.0 7 2.0 8 0.0 9 1.0 10 2.0 11 1.0 12 1.0 13 6.0 14 3.0 15 1.0 16 4.0 17 4.0 18 1.0 19 4.0 20 2.0 21 5.0 22 8.0 23 8.0 24 11.0 25 13.0 26 18.0 27 26.0 28 23.0 29 29.0 30 40.0 31 53.0 32 81.0 33 90.0 34 164.0 35 289.0 36 555.0 37 2532.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.699999999999996 15.475 17.974999999999998 30.85 2 23.175 22.425 36.6 17.8 3 21.6 25.575 31.45 21.375 4 25.95 32.275 22.3 19.475 5 25.75 35.675000000000004 22.275 16.3 6 18.875 38.375 23.599999999999998 19.15 7 17.974999999999998 18.125 42.75 21.15 8 22.15 22.5 26.85 28.499999999999996 9 23.425 23.075000000000003 29.525000000000002 23.974999999999998 10-14 23.84 28.365000000000002 26.96 20.835 15-19 23.28 27.689999999999998 27.41 21.62 20-24 24.165 27.88 26.63 21.325 25-29 23.73519373619755 27.971290905440675 27.328849628588635 20.964665729773138 30-34 23.692668741390747 27.64144686495587 27.855721646854754 20.810162746798632 35-39 23.08390480032271 28.247277127874142 27.80859217426382 20.86022589753933 40-44 23.79 27.82 27.195000000000004 21.195 45-49 23.815 28.044999999999998 27.400000000000002 20.74 50-54 23.94 27.98 27.43 20.65 55-59 23.724999999999998 28.025 27.450000000000003 20.8 60-64 24.035 27.46 27.400000000000002 21.105 65-69 24.03 28.57 27.0 20.4 70-74 24.415 27.92 27.05 20.615 75-79 23.77 27.615000000000002 27.74 20.875 80-84 24.115000000000002 27.29 27.425 21.17 85-89 24.29 27.935 26.96 20.815 90-94 24.18 27.87 27.07 20.880000000000003 95-99 24.0 28.384999999999998 27.08 20.535 100-104 24.47 27.16 27.694999999999997 20.674999999999997 105-109 24.13 28.07 26.979999999999997 20.82 110-114 24.215 27.92 27.305 20.560000000000002 115-119 24.43 28.000000000000004 27.200000000000003 20.369999999999997 120-124 24.884999999999998 27.389999999999997 27.73 19.994999999999997 125-129 24.555 28.345 27.224999999999998 19.875 130-134 24.905 28.415000000000003 26.834999999999997 19.845 135-139 25.44 27.32 27.189999999999998 20.05 140-144 25.069999999999997 27.750000000000004 27.35 19.830000000000002 145-149 25.47 27.015 27.689999999999998 19.825 150-151 26.687499999999996 27.6 26.6625 19.05 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 1.0 19 1.0 20 0.5 21 0.5 22 0.5 23 0.5 24 0.5 25 1.5 26 3.5 27 3.5 28 5.0 29 6.5 30 8.0 31 9.0 32 13.0 33 22.5 34 33.5 35 43.0 36 62.0 37 93.0 38 117.0 39 150.0 40 197.0 41 226.5 42 252.0 43 287.5 44 305.0 45 303.0 46 281.0 47 255.0 48 234.0 49 216.0 50 183.0 51 138.5 52 117.5 53 100.0 54 85.5 55 60.5 56 36.5 57 30.5 58 20.5 59 21.0 60 20.5 61 12.5 62 8.0 63 7.5 64 6.0 65 4.5 66 4.0 67 2.0 68 3.0 69 3.0 70 1.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.38 30-34 1.9949999999999999 35-39 0.84 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.3 #Duplication Level Percentage of deduplicated Percentage of total 1 99.32024169184291 98.625 2 0.6545820745216516 1.3 3 0.025176233635448138 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.0875 0.0 0.0 0.0 0.0 92-93 0.1375 0.0 0.0 0.0 0.0 94-95 0.2 0.0 0.0 0.0 0.0 96-97 0.2625 0.0 0.0 0.0 0.0 98-99 0.4 0.0 0.0 0.0 0.0 100-101 0.4625 0.0 0.0 0.0 0.0 102-103 0.5874999999999999 0.0 0.0 0.0 0.0 104-105 0.65 0.0 0.0 0.0 0.0 106-107 0.8 0.0 0.0 0.0 0.0 108-109 0.9874999999999999 0.0 0.0 0.0 0.0 110-111 1.175 0.0 0.0 0.0 0.0 112-113 1.4 0.0 0.0 0.0 0.0 114-115 1.5125 0.0 0.0 0.0 0.0 116-117 1.6875 0.0 0.0 0.0 0.0 118-119 2.0375 0.0 0.0 0.0 0.0 120-121 2.25 0.0 0.0 0.0 0.0 122-123 2.5 0.0 0.0 0.0 0.0 124-125 2.825 0.0 0.0 0.0 0.0 126-127 3.0999999999999996 0.0 0.0 0.0 0.0 128-129 3.3 0.0 0.0 0.0 0.0 130-131 3.6625 0.0 0.0 0.0 0.0 132-133 3.95 0.0 0.0 0.0 0.0 134-135 4.2625 0.0 0.0 0.0 0.0 136-137 4.8125 0.0 0.0 0.0 0.0 138-139 5.3125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 841886 spots for SRR7172713.sra Written 841886 spots for SRR7172713.sra Read 841886 spots for SRR7172713.sra Written 841886 spots for SRR7172713.sra Read 841886 spots for SRR7172713.sra Written 841886 spots for SRR7172713.sra Read 841886 spots for SRR7172713.sra Written 841886 spots for SRR7172713.sra Read 841886 spots for SRR7172713.sra Written 841886 spots for SRR7172713.sra Read 841886 spots for SRR7172713.sra Written 841886 spots for SRR7172713.sra Read 841886 spots for SRR7172713.sra Written 841886 spots for SRR7172713.sra Read 841886 spots for SRR7172713.sra Written 841886 spots for SRR7172713.sra Read 841886 spots for SRR7172713.sra Written 841886 spots for SRR7172713.sra Read 841886 spots for SRR7172713.sra Written 841886 spots for SRR7172713.sra Read 841886 spots for SRR7172713.sra Written 841886 spots for SRR7172713.sra Read 841886 spots for SRR7172713.sra Written 841886 spots for SRR7172713.sra Read 841893 spots for SRR7172713.sra Written 841893 spots for SRR7172713.sra Read 841886 spots for SRR7172713.sra Written 841886 spots for SRR7172713.sra Read 841886 spots for SRR7172713.sra Written 841886 spots for SRR7172713.sra Read 841886 spots for SRR7172713.sra Written 841886 spots for SRR7172713.sra Read 841886 spots for SRR7172713.sra Written 841886 spots for SRR7172713.sra Read 841886 spots for SRR7172713.sra Written 841886 spots for SRR7172713.sra Read 841886 spots for SRR7172713.sra Written 841886 spots for SRR7172713.sra Read 841886 spots for SRR7172713.sra Written 841886 spots for SRR7172713.sra SRR ids: ['SRR7172713.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_3ncg9709 SRR7172713.sra spots: 16837727 blocks: [[1, 841886], [841887, 1683772], [1683773, 2525658], [2525659, 3367544], [3367545, 4209430], [4209431, 5051316], [5051317, 5893202], [5893203, 6735088], [6735089, 7576974], [7576975, 8418860], [8418861, 9260746], [9260747, 10102632], [10102633, 10944518], [10944519, 11786404], [11786405, 12628290], [12628291, 13470176], [13470177, 14312062], [14312063, 15153948], [15153949, 15995834], [15995835, 16837727]] SRR7172713 file size 5684052 SRR7172713 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172713 SRR7172713_1.fastq SRR7172713_2.fastq Input file: SRR7172713_1.fastq Paired file: SRR7172713_2.fastq trimmed: SRR7172713-trimmed-pair1.fastq, SRR7172713-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 14:41:46 2025 >> started Mon Feb 10 14:42:04 2025 >> done (17.438s) 16837727 read pairs processed; of these: 19222 ( 0.11%) short read pairs filtered out after trimming by size control 13673 ( 0.08%) empty read pairs filtered out after trimming by size control 16804832 (99.80%) read pairs available; of these: 6818807 (40.58%) trimmed read pairs available after processing 9986025 (59.42%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 2 0.00% 20 2 0.00% 21 3 0.00% 22 0 0.00% 23 0 0.00% 24 3 0.00% 25 4 0.00% 26 2 0.00% 27 4 0.00% 28 6 0.00% 29 2 0.00% 30 2 0.00% 31 1 0.00% 32 5 0.00% 33 3 0.00% 34 1 0.00% 35 5 0.00% 36 4 0.00% 37 3 0.00% 38 4 0.00% 39 3 0.00% 40 6 0.00% 41 1 0.00% 42 4 0.00% 43 5 0.00% 44 8 0.00% 45 5 0.00% 46 8 0.00% 47 9 0.00% 48 14 0.00% 49 12 0.00% 50 19 0.00% 51 23 0.00% 52 19 0.00% 53 26 0.00% 54 24 0.00% 55 43 0.00% 56 40 0.00% 57 38 0.00% 58 44 0.00% 59 47 0.00% 60 59 0.00% 61 67 0.00% 62 57 0.00% 63 97 0.00% 64 94 0.00% 65 106 0.00% 66 131 0.00% 67 162 0.00% 68 168 0.00% 69 209 0.00% 70 224 0.00% 71 266 0.00% 72 334 0.00% 73 357 0.00% 74 397 0.00% 75 429 0.00% 76 586 0.00% 77 630 0.00% 78 717 0.00% 79 759 0.00% 80 920 0.01% 81 1064 0.01% 82 1267 0.01% 83 1419 0.01% 84 2487 0.01% 85 3269 0.02% 86 3435 0.02% 87 3614 0.02% 88 3700 0.02% 89 3938 0.02% 90 4244 0.03% 91 4470 0.03% 92 4873 0.03% 93 5380 0.03% 94 5671 0.03% 95 6112 0.04% 96 6580 0.04% 97 7222 0.04% 98 7684 0.05% 99 8185 0.05% 100 8756 0.05% 101 9407 0.06% 102 10314 0.06% 103 11053 0.07% 104 11859 0.07% 105 12717 0.08% 106 13590 0.08% 107 14413 0.09% 108 15376 0.09% 109 16547 0.10% 110 17258 0.10% 111 18576 0.11% 112 19586 0.12% 113 20525 0.12% 114 21926 0.13% 115 23271 0.14% 116 24470 0.15% 117 25589 0.15% 118 26587 0.16% 119 28066 0.17% 120 29098 0.17% 121 30791 0.18% 122 32039 0.19% 123 33811 0.20% 124 35881 0.21% 125 37331 0.22% 126 39338 0.23% 127 41067 0.24% 128 43286 0.26% 129 44587 0.27% 130 46441 0.28% 131 48146 0.29% 132 51108 0.30% 133 53710 0.32% 134 57037 0.34% 135 59672 0.36% 136 61879 0.37% 137 65910 0.39% 138 69419 0.41% 139 73843 0.44% 140 78615 0.47% 141 85501 0.51% 142 91816 0.55% 143 100146 0.60% 144 113216 0.67% 145 131215 0.78% 146 159435 0.95% 147 211043 1.26% 148 325798 1.94% 149 602486 3.59% 150 3523418 20.97% 151 9986025 59.42% 16804832 reads passed initial QC criterion=sequence-density sequence-density=0.27 sequence-density-rank=1 fanout-score=2.94 fanout-score-rank=31 prefix-density=0.41 prefix-fanout=1.9 sequence=CACTTGCAGCCATTCTCAGCACC criterion=fanout-score sequence-density=0.11 sequence-density-rank=11 fanout-score=48.46 fanout-score-rank=1 prefix-density=0.48 prefix-fanout=10.7 sequence=CCTTCCTTGTCCTGGATCTT criterion=sequence-density sequence-density=0.36 sequence-density-rank=1 fanout-score=2.59 fanout-score-rank=28 prefix-density=0.38 prefix-fanout=2.5 sequence=ATGTACCCTGACTTAGGTTTCTCAGA criterion=fanout-score sequence-density=0.09 sequence-density-rank=22 fanout-score=35.99 fanout-score-rank=1 prefix-density=0.34 prefix-fanout=9.2 sequence=AAGGCCAAGATCCAGGACAAGGA SRR7172713 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 14:42:48 Started mapping on | Feb 10 14:42:48 Finished on | Feb 10 14:45:06 Mapping speed, Million of reads per hour | 438.39 Number of input reads | 16804832 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 15491656 Uniquely mapped reads % | 92.19% Average mapped length | 295.59 Number of splices: Total | 15566242 Number of splices: Annotated (sjdb) | 15300420 Number of splices: GT/AG | 15328588 Number of splices: GC/AG | 189298 Number of splices: AT/AC | 11425 Number of splices: Non-canonical | 36931 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.62 Insertion rate per base | 0.02% Insertion average length | 2.55 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 413149 % of reads mapped to multiple loci | 2.46% Number of reads mapped to too many loci | 314938 % of reads mapped to too many loci | 1.87% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.13% % of reads unmapped: other | 0.36% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 916400 916400 916400 N_multimapping 413149 413149 413149 N_noFeature 347336 15358820 395809 N_ambiguous 156967 1340 71586 UnstrandedReadsAssigned:14987353 PositiveStrandReadsAssigned:131496 NegativeStrandReadsAssigned:15024261 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7172713 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172713-trimmed-pair1.fastq SRR7172713-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,804,832 reads, 15,101,845 reads pseudoaligned [quant] estimated average fragment length: 230.754 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,240 rounds 52401 SRR7172713.ke.tsv 34699 SRR7172713.se.tsv 87100 total ==> SRR7172713.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1788.25 1633 53.2409 Potri.005G024800.1.v4.1 1035 805.246 302 21.8658 Potri.004G059700.1.v4.1 961 731.26 36 2.87023 Potri.007G009000.2.v4.1 1416 1186.25 0 0 Potri.003G141000.2.v4.1 2943 2713.25 631 13.559 Potri.016G087400.1.v4.1 270 78.9404 1306 964.561 Potri.015G069301.1.v4.1 564 336.29 0 0 Potri.010G195200.1.v4.1 1773 1543.25 495.611 18.7237 Potri.012G127500.1.v4.1 977 747.251 6402 499.5 ==> SRR7172713.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 10 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 497 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 6 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 453 SRR7172713 completed mapping pipeline successfully