Starting /dee2/code/volunteer_pipeline.sh SRR7172714 current disk space = 3059219652608 free memory = 1128019192 SRR7172714 SRAfilesize 7a29c6bd667da474e22856f1d02b4256 SRR7172714.sra SRR7172714.sra file validated SRR7172714 is paired end SRR7172714 is conventional basespace SRR7172714 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172714_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 23.162 18.0 18.0 31.0 18.0 32.0 2 30.18825 31.0 29.0 33.0 27.0 33.0 3 31.0945 32.0 32.0 33.0 27.0 33.0 4 31.5455 33.0 32.0 33.0 30.0 33.0 5 32.4215 33.0 33.0 33.0 32.0 34.0 6 37.18625 38.0 38.0 38.0 36.0 38.0 7 37.41225 38.0 38.0 38.0 37.0 38.0 8 37.53125 38.0 38.0 38.0 38.0 38.0 9 37.59525 38.0 38.0 38.0 38.0 38.0 10-14 37.62495 38.0 38.0 38.0 38.0 38.0 15-19 37.6221 38.0 38.0 38.0 38.0 38.0 20-24 37.5815 38.0 38.0 38.0 38.0 38.0 25-29 37.62755 38.0 38.0 38.0 38.0 38.0 30-34 37.58265 38.0 38.0 38.0 38.0 38.0 35-39 37.56525 38.0 38.0 38.0 38.0 38.0 40-44 37.5173 38.0 38.0 38.0 38.0 38.0 45-49 37.5271 38.0 38.0 38.0 38.0 38.0 50-54 37.451 38.0 38.0 38.0 37.6 38.0 55-59 37.3164 38.0 38.0 38.0 37.0 38.0 60-64 37.3508 38.0 38.0 38.0 37.0 38.0 65-69 37.268350000000005 38.0 38.0 38.0 36.6 38.0 70-74 37.2529 38.0 38.0 38.0 36.6 38.0 75-79 37.1134 38.0 38.0 38.0 36.0 38.0 80-84 37.011199999999995 38.0 38.0 38.0 35.6 38.0 85-89 36.92065 38.0 38.0 38.0 35.8 38.0 90-94 36.97375000000001 38.0 38.0 38.0 36.0 38.0 95-99 36.977799999999995 38.0 38.0 38.0 35.8 38.0 100-104 36.7921 38.0 38.0 38.0 35.0 38.0 105-109 36.454499999999996 38.0 38.0 38.0 34.0 38.0 110-114 36.3495 38.0 38.0 38.0 34.0 38.0 115-119 36.39385 38.0 38.0 38.0 33.8 38.0 120-124 36.264700000000005 38.0 37.4 38.0 33.6 38.0 125-129 35.8583 38.0 37.0 38.0 31.8 38.0 130-134 35.37155 38.0 36.0 38.0 29.8 38.0 135-139 35.1513 38.0 35.8 38.0 28.4 38.0 140-144 35.004200000000004 38.0 35.0 38.0 28.2 38.0 145-149 34.61625 38.0 35.0 38.0 28.0 38.0 150-151 30.690875000000002 36.5 29.0 38.0 12.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 2.0 15 0.0 16 1.0 17 0.0 18 0.0 19 1.0 20 1.0 21 4.0 22 4.0 23 6.0 24 6.0 25 4.0 26 7.0 27 16.0 28 16.0 29 24.0 30 23.0 31 64.0 32 72.0 33 83.0 34 163.0 35 280.0 36 716.0 37 2506.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 31.216111541440743 15.904983217144334 11.877097856958429 41.0018073844565 2 19.30879038317055 18.782870022539445 38.417230152767345 23.491109441522664 3 19.475 23.075000000000003 25.8 31.65 4 21.375 32.025 22.575 24.025 5 19.975 35.075 25.6 19.35 6 18.25 34.175 26.775 20.8 7 13.950000000000001 21.875 44.675 19.5 8 17.175 22.725 31.924999999999997 28.175 9 17.575 23.0 32.875 26.55 10-14 19.29 29.805 26.974999999999998 23.93 15-19 19.425 28.395 28.1 24.08 20-24 19.615 28.494999999999997 27.755000000000003 24.135 25-29 20.349999999999998 27.810000000000002 28.194999999999997 23.645 30-34 20.105 28.175 27.715 24.005000000000003 35-39 19.63 28.244999999999997 27.955000000000002 24.169999999999998 40-44 19.88 28.165000000000003 27.860000000000003 24.095 45-49 19.67 28.225 27.785 24.32 50-54 20.465 28.21 27.54 23.785 55-59 20.294999999999998 28.025 28.065 23.615 60-64 20.1 27.474999999999998 28.294999999999998 24.13 65-69 20.535 28.285 27.339999999999996 23.84 70-74 20.365 27.889999999999997 28.185 23.56 75-79 20.465 28.095 27.71 23.73 80-84 19.97 28.34 27.66 24.03 85-89 20.155 28.68 27.084999999999997 24.08 90-94 20.115 27.834999999999997 28.03 24.02 95-99 20.815 27.57 27.544999999999998 24.07 100-104 19.845 28.610000000000003 27.755000000000003 23.79 105-109 20.815 27.735 28.03 23.419999999999998 110-114 20.4 27.900000000000002 28.1 23.599999999999998 115-119 20.200000000000003 27.665 28.235 23.9 120-124 21.145 27.810000000000002 27.675 23.369999999999997 125-129 20.905 28.194999999999997 27.045 23.855 130-134 20.89 27.565 27.485 24.060000000000002 135-139 21.09 27.529999999999998 27.55 23.830000000000002 140-144 21.34 27.655 27.310000000000002 23.695 145-149 20.73 28.33 27.04 23.9 150-151 20.275000000000002 27.3 27.55 24.875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 0.0 22 0.5 23 1.0 24 2.0 25 3.0 26 6.0 27 6.0 28 3.5 29 12.5 30 19.5 31 20.0 32 25.5 33 43.0 34 52.5 35 56.0 36 85.5 37 108.0 38 130.5 39 168.0 40 190.0 41 213.0 42 241.5 43 267.5 44 297.0 45 292.0 46 255.0 47 242.5 48 245.5 49 230.0 50 178.5 51 128.5 52 107.0 53 89.5 54 69.0 55 54.5 56 42.0 57 29.0 58 21.0 59 17.5 60 13.0 61 9.0 62 8.0 63 4.5 64 2.5 65 0.5 66 0.5 67 3.0 68 2.5 69 1.0 70 1.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.175 2 0.17500000000000002 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.5227329816629 99.05000000000001 2 0.4772670183371013 0.95 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.0625 0.0 0.0 0.0 0.0 96-97 0.1 0.0 0.0 0.0 0.0 98-99 0.125 0.0 0.0 0.0 0.0 100-101 0.175 0.0 0.0 0.0 0.0 102-103 0.2625 0.0 0.0 0.0 0.0 104-105 0.3125 0.0 0.0 0.0 0.0 106-107 0.3875 0.0 0.0 0.0 0.0 108-109 0.4375 0.0 0.0 0.0 0.0 110-111 0.525 0.0 0.0 0.0 0.0 112-113 0.5625 0.0 0.0 0.0 0.0 114-115 0.8999999999999999 0.0 0.0 0.0 0.0 116-117 1.075 0.0 0.0 0.0 0.0 118-119 1.3375 0.0 0.0 0.0 0.0 120-121 1.525 0.0 0.0 0.0 0.0 122-123 1.75 0.0 0.0 0.0 0.0 124-125 2.0375 0.0 0.0 0.0 0.0 126-127 2.2875 0.0 0.0 0.0 0.0 128-129 2.5125 0.0 0.0 0.0 0.0 130-131 2.75 0.0 0.0 0.0 0.0 132-133 3.1 0.0 0.0 0.0 0.0 134-135 3.6 0.0 0.0 0.0 0.0 136-137 3.95 0.0 0.0 0.0 0.0 138-139 4.35 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7172714 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172714_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.0865 34.0 33.0 34.0 33.0 34.0 2 33.1265 34.0 33.0 34.0 33.0 34.0 3 33.132 34.0 33.0 34.0 33.0 34.0 4 33.1205 34.0 33.0 34.0 33.0 34.0 5 33.0535 34.0 33.0 34.0 33.0 34.0 6 37.23025 38.0 38.0 38.0 37.0 38.0 7 37.19675 38.0 38.0 38.0 37.0 38.0 8 37.297 38.0 38.0 38.0 38.0 38.0 9 37.28625 38.0 38.0 38.0 38.0 38.0 10-14 37.2437 38.0 38.0 38.0 38.0 38.0 15-19 37.23145 38.0 38.0 38.0 37.6 38.0 20-24 37.195949999999996 38.0 38.0 38.0 37.4 38.0 25-29 37.02865 38.0 38.0 38.0 37.0 38.0 30-34 36.314049999999995 38.0 38.0 38.0 36.2 38.0 35-39 36.65295 38.0 38.0 38.0 36.0 38.0 40-44 37.077749999999995 38.0 38.0 38.0 37.0 38.0 45-49 37.0871 38.0 38.0 38.0 37.0 38.0 50-54 37.07469999999999 38.0 38.0 38.0 37.0 38.0 55-59 36.9385 38.0 38.0 38.0 36.2 38.0 60-64 36.77165 38.0 38.0 38.0 36.0 38.0 65-69 36.5947 38.0 38.0 38.0 35.0 38.0 70-74 36.6503 38.0 38.0 38.0 35.4 38.0 75-79 36.61835 38.0 38.0 38.0 35.6 38.0 80-84 36.69615 38.0 38.0 38.0 35.6 38.0 85-89 36.5692 38.0 38.0 38.0 34.8 38.0 90-94 36.54505 38.0 38.0 38.0 35.0 38.0 95-99 36.416599999999995 38.0 38.0 38.0 34.2 38.0 100-104 36.30535 38.0 38.0 38.0 34.0 38.0 105-109 36.2265 38.0 38.0 38.0 34.0 38.0 110-114 36.05045 38.0 38.0 38.0 33.8 38.0 115-119 35.8481 38.0 37.4 38.0 32.8 38.0 120-124 35.628049999999995 38.0 37.0 38.0 31.0 38.0 125-129 35.348 38.0 36.4 38.0 30.4 38.0 130-134 34.9874 38.0 36.0 38.0 28.0 38.0 135-139 34.632450000000006 38.0 35.2 38.0 27.8 38.0 140-144 34.3455 38.0 34.8 38.0 26.8 38.0 145-149 33.327749999999995 38.0 33.0 38.0 19.2 38.0 150-151 28.830375 35.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 10.0 3 4.0 4 6.0 5 1.0 6 2.0 7 0.0 8 2.0 9 1.0 10 0.0 11 1.0 12 0.0 13 3.0 14 1.0 15 5.0 16 0.0 17 3.0 18 4.0 19 2.0 20 8.0 21 5.0 22 9.0 23 10.0 24 8.0 25 15.0 26 14.0 27 27.0 28 21.0 29 36.0 30 45.0 31 55.0 32 72.0 33 73.0 34 153.0 35 286.0 36 601.0 37 2517.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.25 16.025 17.549999999999997 32.175 2 22.525000000000002 24.075 36.7 16.7 3 21.4 27.525 30.275000000000002 20.8 4 25.1 33.900000000000006 21.6 19.400000000000002 5 24.65 35.325 21.925 18.099999999999998 6 18.875 37.425000000000004 24.975 18.725 7 18.099999999999998 17.075000000000003 42.975 21.85 8 21.349999999999998 22.05 29.625 26.974999999999998 9 22.400000000000002 24.175 28.925 24.5 10-14 23.23 28.615000000000002 26.365 21.790000000000003 15-19 23.585 27.845 27.575 20.995 20-24 23.75 28.415000000000003 26.919999999999998 20.915 25-29 23.235618913763677 28.440919586386908 27.572532878225076 20.750928621624336 30-34 23.173790632198617 28.59994880982851 27.504479140005117 20.72178141796775 35-39 23.41155690133737 28.160484481453445 27.625536209941963 20.802422407267223 40-44 23.52 28.055000000000003 27.115000000000002 21.310000000000002 45-49 23.145 28.76 27.134999999999998 20.96 50-54 23.244999999999997 28.754999999999995 27.175 20.825 55-59 23.674999999999997 28.26 27.195000000000004 20.87 60-64 23.855 28.4 27.065 20.68 65-69 23.525 28.73 26.775 20.97 70-74 23.24 28.389999999999997 27.515 20.855 75-79 23.75 27.889999999999997 27.27 21.09 80-84 23.794999999999998 27.785 27.634999999999998 20.785 85-89 23.865 27.97 27.565 20.599999999999998 90-94 23.68 28.74 27.41 20.169999999999998 95-99 23.685000000000002 27.875 27.744999999999997 20.695 100-104 23.86 27.750000000000004 27.26 21.13 105-109 23.995 27.675 27.735 20.595 110-114 23.69 27.834999999999997 27.755000000000003 20.72 115-119 24.135 27.705000000000002 27.925 20.235 120-124 24.21 28.375 27.415 20.0 125-129 24.19 29.099999999999998 26.51 20.200000000000003 130-134 24.565 27.82 27.41 20.205000000000002 135-139 23.93 28.715000000000003 27.560000000000002 19.794999999999998 140-144 24.565 28.23 27.235 19.97 145-149 25.115 27.735 27.189999999999998 19.96 150-151 24.375 27.5625 28.1375 19.925 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 0.5 22 0.5 23 0.5 24 0.0 25 2.5 26 3.0 27 1.5 28 2.5 29 6.0 30 9.5 31 13.5 32 19.0 33 28.0 34 33.0 35 50.0 36 79.0 37 99.5 38 127.0 39 166.5 40 207.5 41 231.5 42 258.5 43 283.5 44 300.0 45 296.5 46 263.5 47 247.5 48 241.5 49 211.0 50 171.0 51 149.0 52 131.0 53 99.5 54 79.5 55 60.5 56 33.5 57 25.5 58 20.0 59 11.5 60 9.0 61 5.5 62 2.5 63 4.0 64 3.0 65 2.0 66 3.0 67 1.5 68 0.5 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.38999999999999996 30-34 2.325 35-39 0.9249999999999999 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.375 #Duplication Level Percentage of deduplicated Percentage of total 1 99.42138364779875 98.8 2 0.5283018867924528 1.05 3 0.05031446540880503 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.0625 0.0 0.0 0.0 0.0 96-97 0.1 0.0 0.0 0.0 0.0 98-99 0.15 0.0 0.0 0.0 0.0 100-101 0.2 0.0 0.0 0.0 0.0 102-103 0.2625 0.0 0.0 0.0 0.0 104-105 0.3125 0.0 0.0 0.0 0.0 106-107 0.375 0.0 0.0 0.0 0.0 108-109 0.4125 0.0 0.0 0.0 0.0 110-111 0.5 0.0 0.0 0.0 0.0 112-113 0.5375000000000001 0.0 0.0 0.0 0.0 114-115 0.875 0.0 0.0 0.0 0.0 116-117 1.05 0.0 0.0 0.0 0.0 118-119 1.3125 0.0 0.0 0.0 0.0 120-121 1.525 0.0 0.0 0.0 0.0 122-123 1.75 0.0 0.0 0.0 0.0 124-125 2.0125 0.0 0.0 0.0 0.0 126-127 2.275 0.0 0.0 0.0 0.0 128-129 2.55 0.0 0.0 0.0 0.0 130-131 2.8 0.0 0.0 0.0 0.0 132-133 3.15 0.0 0.0 0.0 0.0 134-135 3.675 0.0 0.0 0.0 0.0 136-137 4.0375 0.0 0.0 0.0 0.0 138-139 4.45 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 885838 spots for SRR7172714.sra Written 885838 spots for SRR7172714.sra Read 885838 spots for SRR7172714.sra Written 885838 spots for SRR7172714.sra Read 885838 spots for SRR7172714.sra Written 885838 spots for SRR7172714.sra Read 885838 spots for SRR7172714.sra Written 885838 spots for SRR7172714.sra Read 885838 spots for SRR7172714.sra Written 885838 spots for SRR7172714.sra Read 885838 spots for SRR7172714.sra Written 885838 spots for SRR7172714.sra Read 885838 spots for SRR7172714.sra Written 885838 spots for SRR7172714.sra Read 885838 spots for SRR7172714.sra Written 885838 spots for SRR7172714.sra Read 885838 spots for SRR7172714.sra Written 885838 spots for SRR7172714.sra Read 885838 spots for SRR7172714.sra Written 885838 spots for SRR7172714.sra Read 885838 spots for SRR7172714.sra Written 885838 spots for SRR7172714.sra Read 885838 spots for SRR7172714.sra Written 885838 spots for SRR7172714.sra Read 885838 spots for SRR7172714.sra Written 885838 spots for SRR7172714.sra Read 885838 spots for SRR7172714.sra Written 885838 spots for SRR7172714.sra Read 885838 spots for SRR7172714.sra Written 885838 spots for SRR7172714.sra Read 885838 spots for SRR7172714.sra Written 885838 spots for SRR7172714.sra Read 885838 spots for SRR7172714.sra Written 885838 spots for SRR7172714.sra Read 885838 spots for SRR7172714.sra Written 885838 spots for SRR7172714.sra Read 885838 spots for SRR7172714.sra Written 885838 spots for SRR7172714.sra Read 885838 spots for SRR7172714.sra Written 885838 spots for SRR7172714.sra SRR ids: ['SRR7172714.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_qc405d8r SRR7172714.sra spots: 17716760 blocks: [[1, 885838], [885839, 1771676], [1771677, 2657514], [2657515, 3543352], [3543353, 4429190], [4429191, 5315028], [5315029, 6200866], [6200867, 7086704], [7086705, 7972542], [7972543, 8858380], [8858381, 9744218], [9744219, 10630056], [10630057, 11515894], [11515895, 12401732], [12401733, 13287570], [13287571, 14173408], [14173409, 15059246], [15059247, 15945084], [15945085, 16830922], [16830923, 17716760]] SRR7172714 file size 5981928 SRR7172714 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172714 SRR7172714_1.fastq SRR7172714_2.fastq Input file: SRR7172714_1.fastq Paired file: SRR7172714_2.fastq trimmed: SRR7172714-trimmed-pair1.fastq, SRR7172714-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 15:11:40 2025 >> started Mon Feb 10 15:11:59 2025 >> done (18.910s) 17716760 read pairs processed; of these: 17433 ( 0.10%) short read pairs filtered out after trimming by size control 12830 ( 0.07%) empty read pairs filtered out after trimming by size control 17686497 (99.83%) read pairs available; of these: 7007375 (39.62%) trimmed read pairs available after processing 10679122 (60.38%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 1 0.00% 20 0 0.00% 21 1 0.00% 22 2 0.00% 23 2 0.00% 24 1 0.00% 25 3 0.00% 26 1 0.00% 27 4 0.00% 28 0 0.00% 29 2 0.00% 30 3 0.00% 31 5 0.00% 32 1 0.00% 33 4 0.00% 34 2 0.00% 35 4 0.00% 36 2 0.00% 37 0 0.00% 38 3 0.00% 39 5 0.00% 40 4 0.00% 41 4 0.00% 42 5 0.00% 43 2 0.00% 44 5 0.00% 45 10 0.00% 46 4 0.00% 47 8 0.00% 48 10 0.00% 49 7 0.00% 50 9 0.00% 51 13 0.00% 52 20 0.00% 53 15 0.00% 54 22 0.00% 55 10 0.00% 56 28 0.00% 57 27 0.00% 58 43 0.00% 59 43 0.00% 60 36 0.00% 61 53 0.00% 62 55 0.00% 63 87 0.00% 64 72 0.00% 65 83 0.00% 66 88 0.00% 67 112 0.00% 68 133 0.00% 69 152 0.00% 70 194 0.00% 71 198 0.00% 72 210 0.00% 73 261 0.00% 74 290 0.00% 75 357 0.00% 76 395 0.00% 77 455 0.00% 78 488 0.00% 79 543 0.00% 80 668 0.00% 81 758 0.00% 82 891 0.01% 83 1046 0.01% 84 1987 0.01% 85 2705 0.02% 86 2859 0.02% 87 3206 0.02% 88 3281 0.02% 89 3377 0.02% 90 3424 0.02% 91 3598 0.02% 92 3976 0.02% 93 4233 0.02% 94 4537 0.03% 95 4977 0.03% 96 5294 0.03% 97 5691 0.03% 98 6094 0.03% 99 6609 0.04% 100 7272 0.04% 101 7598 0.04% 102 8184 0.05% 103 8845 0.05% 104 9538 0.05% 105 10187 0.06% 106 10882 0.06% 107 11716 0.07% 108 12228 0.07% 109 13129 0.07% 110 14233 0.08% 111 14811 0.08% 112 15982 0.09% 113 16912 0.10% 114 18246 0.10% 115 19412 0.11% 116 20523 0.12% 117 21131 0.12% 118 22130 0.13% 119 22996 0.13% 120 24327 0.14% 121 25772 0.15% 122 26930 0.15% 123 28482 0.16% 124 29712 0.17% 125 31572 0.18% 126 33337 0.19% 127 34936 0.20% 128 36223 0.20% 129 38166 0.22% 130 39990 0.23% 131 41978 0.24% 132 44408 0.25% 133 47227 0.27% 134 49703 0.28% 135 52892 0.30% 136 56289 0.32% 137 59221 0.33% 138 63253 0.36% 139 68400 0.39% 140 74000 0.42% 141 80286 0.45% 142 87917 0.50% 143 97219 0.55% 144 111627 0.63% 145 133135 0.75% 146 164920 0.93% 147 222946 1.26% 148 351189 1.99% 149 664649 3.76% 150 3826905 21.64% 151 10679122 60.38% 17686497 reads passed initial QC criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=7.93 fanout-score-rank=17 prefix-density=0.29 prefix-fanout=4.1 sequence=TCCTTGTCCTGGATCTT criterion=fanout-score sequence-density=0.06 sequence-density-rank=28 fanout-score=424.44 fanout-score-rank=1 prefix-density=0.74 prefix-fanout=32.3 sequence=TCTTCTTCTTCCT criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=3.08 fanout-score-rank=36 prefix-density=0.18 prefix-fanout=2.6 sequence=TACAACATCCAGAAGGAGTCCACCCTCCACTTGGT criterion=fanout-score sequence-density=0.06 sequence-density-rank=29 fanout-score=274.82 fanout-score-rank=1 prefix-density=0.85 prefix-fanout=19.8 sequence=AGAAGAAGAGAGG SRR7172714 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 15:12:59 Started mapping on | Feb 10 15:13:00 Finished on | Feb 10 15:15:08 Mapping speed, Million of reads per hour | 497.43 Number of input reads | 17686497 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 16678886 Uniquely mapped reads % | 94.30% Average mapped length | 296.47 Number of splices: Total | 17321830 Number of splices: Annotated (sjdb) | 17069612 Number of splices: GT/AG | 17061715 Number of splices: GC/AG | 211492 Number of splices: AT/AC | 11596 Number of splices: Non-canonical | 37027 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.58 Insertion rate per base | 0.02% Insertion average length | 2.58 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 410075 % of reads mapped to multiple loci | 2.32% Number of reads mapped to too many loci | 52413 % of reads mapped to too many loci | 0.30% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.01% % of reads unmapped: other | 0.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 613238 613238 613238 N_multimapping 410075 410075 410075 N_noFeature 295507 16556512 340745 N_ambiguous 149722 863 72055 UnstrandedReadsAssigned:16233657 PositiveStrandReadsAssigned:121511 NegativeStrandReadsAssigned:16266086 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7172714 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172714-trimmed-pair1.fastq SRR7172714-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,686,497 reads, 16,141,347 reads pseudoaligned [quant] estimated average fragment length: 242.367 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,158 rounds 52401 SRR7172714.ke.tsv 34699 SRR7172714.se.tsv 87100 total ==> SRR7172714.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1776.63 1334 45.0527 Potri.005G024800.1.v4.1 1035 793.633 391 29.561 Potri.004G059700.1.v4.1 961 719.656 20 1.66751 Potri.007G009000.2.v4.1 1416 1174.63 0 0 Potri.003G141000.2.v4.1 2943 2701.63 639.157 14.1953 Potri.016G087400.1.v4.1 270 75.672 1587 1258.36 Potri.015G069301.1.v4.1 564 326.224 0 0 Potri.010G195200.1.v4.1 1773 1531.63 333.701 13.0727 Potri.012G127500.1.v4.1 977 735.65 3431 279.841 ==> SRR7172714.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 24 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 351 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 65 SRR7172714 completed mapping pipeline successfully