Starting /dee2/code/volunteer_pipeline.sh SRR7172715 current disk space = 3059141791744 free memory = 1180185832 SRR7172715 SRAfilesize 7a4defc503bdb7423dd2e2d13dc941e0 SRR7172715.sra SRR7172715.sra file validated SRR7172715 is paired end SRR7172715 is conventional basespace SRR7172715 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172715_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 24.5555 28.0 18.0 33.0 18.0 33.0 2 30.69175 31.0 29.0 33.0 27.0 33.0 3 30.85975 33.0 29.0 33.0 27.0 33.0 4 32.547 33.0 33.0 33.0 32.0 34.0 5 32.91025 33.0 33.0 33.0 32.0 34.0 6 36.88125 38.0 37.0 38.0 35.0 38.0 7 37.341 38.0 38.0 38.0 36.0 38.0 8 37.36975 38.0 38.0 38.0 36.0 38.0 9 37.53825 38.0 38.0 38.0 37.0 38.0 10-14 37.608599999999996 38.0 38.0 38.0 37.8 38.0 15-19 37.6044 38.0 38.0 38.0 38.0 38.0 20-24 37.652249999999995 38.0 38.0 38.0 38.0 38.0 25-29 37.64345 38.0 38.0 38.0 38.0 38.0 30-34 37.587 38.0 38.0 38.0 38.0 38.0 35-39 37.590050000000005 38.0 38.0 38.0 38.0 38.0 40-44 37.527049999999996 38.0 38.0 38.0 37.8 38.0 45-49 37.49515 38.0 38.0 38.0 37.0 38.0 50-54 37.50775 38.0 38.0 38.0 37.0 38.0 55-59 37.415350000000004 38.0 38.0 38.0 37.0 38.0 60-64 37.434349999999995 38.0 38.0 38.0 37.0 38.0 65-69 37.33505 38.0 38.0 38.0 37.0 38.0 70-74 37.29815000000001 38.0 38.0 38.0 37.0 38.0 75-79 37.30485 38.0 38.0 38.0 36.6 38.0 80-84 37.20305 38.0 38.0 38.0 36.0 38.0 85-89 37.15245 38.0 38.0 38.0 36.0 38.0 90-94 36.9991 38.0 38.0 38.0 36.0 38.0 95-99 36.96759999999999 38.0 38.0 38.0 35.8 38.0 100-104 36.94275 38.0 38.0 38.0 35.8 38.0 105-109 36.745549999999994 38.0 38.0 38.0 35.0 38.0 110-114 36.5911 38.0 38.0 38.0 34.4 38.0 115-119 36.445100000000004 38.0 38.0 38.0 34.0 38.0 120-124 36.39135 38.0 38.0 38.0 34.0 38.0 125-129 36.16495 38.0 37.6 38.0 33.8 38.0 130-134 35.89325000000001 38.0 37.0 38.0 32.8 38.0 135-139 35.67545 38.0 36.2 38.0 32.2 38.0 140-144 35.427800000000005 38.0 36.0 38.0 31.0 38.0 145-149 34.8981 38.0 35.6 38.0 29.8 38.0 150-151 31.7785 36.5 31.5 38.0 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 1.0 10 1.0 11 0.0 12 0.0 13 0.0 14 0.0 15 1.0 16 0.0 17 1.0 18 0.0 19 4.0 20 2.0 21 3.0 22 4.0 23 7.0 24 4.0 25 9.0 26 12.0 27 12.0 28 16.0 29 14.0 30 26.0 31 31.0 32 41.0 33 59.0 34 128.0 35 232.0 36 650.0 37 2741.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.940298507462686 13.192963752665246 14.2590618336887 35.60767590618337 2 20.810405202601302 20.135067533766886 35.51775887943972 23.536768384192097 3 20.125 26.75 25.25 27.875 4 21.95 35.025 22.0 21.025 5 20.8 37.3 23.599999999999998 18.3 6 18.3 37.175000000000004 24.2 20.325 7 13.900000000000002 21.349999999999998 44.975 19.775000000000002 8 18.099999999999998 21.375 29.175 31.35 9 18.099999999999998 23.549999999999997 31.6 26.75 10-14 19.935 28.970000000000002 27.01 24.085 15-19 19.88 28.23 28.060000000000002 23.830000000000002 20-24 19.855 28.02 27.944999999999997 24.18 25-29 19.98 28.715000000000003 28.02 23.285 30-34 19.345000000000002 28.54 28.27 23.845 35-39 20.495 27.875 28.29 23.34 40-44 20.255000000000003 28.549999999999997 27.400000000000002 23.794999999999998 45-49 20.03 28.505000000000003 27.900000000000002 23.565 50-54 20.19 27.965 27.634999999999998 24.21 55-59 20.215 28.15 27.925 23.71 60-64 20.005 28.07 27.860000000000003 24.065 65-69 20.165 27.694999999999997 28.15 23.990000000000002 70-74 20.505000000000003 28.18 27.889999999999997 23.425 75-79 20.549999999999997 28.494999999999997 27.495000000000005 23.46 80-84 20.5 27.894999999999996 27.950000000000003 23.655 85-89 20.605 28.18 28.205000000000002 23.01 90-94 20.755000000000003 28.32 27.76 23.165 95-99 19.99 28.265 27.98 23.765 100-104 20.57 28.139999999999997 27.810000000000002 23.48 105-109 20.705000000000002 28.24 27.49 23.565 110-114 20.915 27.96 27.615000000000002 23.51 115-119 20.455000000000002 28.075 27.529999999999998 23.94 120-124 20.65 27.245 28.050000000000004 24.055 125-129 20.935000000000002 27.665 27.650000000000002 23.75 130-134 20.97 27.139999999999997 27.93 23.96 135-139 21.14 28.110000000000003 27.845 22.905 140-144 21.19 27.855 27.445000000000004 23.51 145-149 20.805 28.54 26.784999999999997 23.87 150-151 21.212500000000002 28.5875 27.500000000000004 22.7 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.5 22 2.0 23 1.5 24 1.0 25 2.5 26 6.5 27 7.5 28 9.5 29 11.5 30 11.0 31 20.0 32 31.5 33 44.5 34 50.0 35 60.0 36 88.5 37 111.0 38 137.5 39 157.0 40 185.5 41 231.5 42 254.0 43 270.0 44 273.5 45 279.0 46 278.5 47 257.0 48 239.0 49 207.0 50 169.5 51 147.5 52 127.5 53 91.5 54 61.5 55 44.5 56 31.0 57 28.0 58 24.0 59 13.5 60 9.0 61 6.0 62 4.0 63 4.0 64 2.0 65 1.5 66 1.5 67 1.5 68 1.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 6.2 2 0.05 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.8 #Duplication Level Percentage of deduplicated Percentage of total 1 99.79959919839679 99.6 2 0.2004008016032064 0.4 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0125 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.037500000000000006 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.175 0.0 0.0 0.0 0.0 96-97 0.25 0.0 0.0 0.0 0.0 98-99 0.2875 0.0 0.0 0.0 0.0 100-101 0.3 0.0 0.0 0.0 0.0 102-103 0.3125 0.0 0.0 0.0 0.0 104-105 0.3375 0.0 0.0 0.0 0.0 106-107 0.42500000000000004 0.0 0.0 0.0 0.0 108-109 0.5125 0.0 0.0 0.0 0.0 110-111 0.6 0.0 0.0 0.0 0.0 112-113 0.6625 0.0 0.0 0.0 0.0 114-115 0.775 0.0 0.0 0.0 0.0 116-117 0.925 0.0 0.0 0.0 0.0 118-119 1.0875 0.0 0.0 0.0 0.0 120-121 1.2625 0.0 0.0 0.0 0.0 122-123 1.3625 0.0 0.0 0.0 0.0 124-125 1.475 0.0 0.0 0.0 0.0 126-127 1.775 0.0 0.0 0.0 0.0 128-129 2.1500000000000004 0.0 0.0 0.0 0.0 130-131 2.2750000000000004 0.0 0.0 0.0 0.0 132-133 2.4 0.0 0.0 0.0 0.0 134-135 2.6500000000000004 0.0 0.0 0.0 0.0 136-137 2.9875 0.0 0.0 0.0 0.0 138-139 3.325 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTTTTT 35 1.2008716E-4 24.844284 10-14 >>END_MODULE SRR7172715 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172715_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.15225 33.0 33.0 34.0 33.0 34.0 2 33.21025 34.0 33.0 34.0 33.0 34.0 3 33.29025 34.0 33.0 34.0 33.0 34.0 4 33.28975 34.0 33.0 34.0 33.0 34.0 5 33.26525 34.0 33.0 34.0 33.0 34.0 6 37.46725 38.0 38.0 38.0 38.0 38.0 7 37.50525 38.0 38.0 38.0 38.0 38.0 8 37.453 38.0 38.0 38.0 38.0 38.0 9 37.44425 38.0 38.0 38.0 38.0 38.0 10-14 37.4543 38.0 38.0 38.0 38.0 38.0 15-19 37.45980000000001 38.0 38.0 38.0 38.0 38.0 20-24 37.418 38.0 38.0 38.0 37.8 38.0 25-29 37.41305 38.0 38.0 38.0 38.0 38.0 30-34 37.32985 38.0 38.0 38.0 37.4 38.0 35-39 37.3144 38.0 38.0 38.0 37.4 38.0 40-44 37.29415 38.0 38.0 38.0 37.4 38.0 45-49 37.22045 38.0 38.0 38.0 37.0 38.0 50-54 37.207 38.0 38.0 38.0 37.0 38.0 55-59 37.15214999999999 38.0 38.0 38.0 37.0 38.0 60-64 37.12134999999999 38.0 38.0 38.0 37.0 38.0 65-69 37.07275 38.0 38.0 38.0 36.8 38.0 70-74 37.01995 38.0 38.0 38.0 36.0 38.0 75-79 36.9922 38.0 38.0 38.0 36.2 38.0 80-84 36.903099999999995 38.0 38.0 38.0 36.0 38.0 85-89 36.78975 38.0 38.0 38.0 36.0 38.0 90-94 36.70980000000001 38.0 38.0 38.0 35.6 38.0 95-99 36.526799999999994 38.0 38.0 38.0 34.8 38.0 100-104 36.525850000000005 38.0 38.0 38.0 35.0 38.0 105-109 36.28385 38.0 38.0 38.0 34.0 38.0 110-114 36.253550000000004 38.0 38.0 38.0 34.0 38.0 115-119 36.09575 38.0 38.0 38.0 33.8 38.0 120-124 35.784 38.0 37.4 38.0 32.2 38.0 125-129 35.6481 38.0 37.0 38.0 32.4 38.0 130-134 35.43845 38.0 36.6 38.0 31.4 38.0 135-139 34.8846 38.0 36.0 38.0 28.2 38.0 140-144 34.4956 38.0 35.6 38.0 26.4 38.0 145-149 33.8212 38.0 35.0 38.0 22.0 38.0 150-151 30.460124999999998 36.5 29.0 38.0 8.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 6.0 3 2.0 4 2.0 5 0.0 6 2.0 7 1.0 8 2.0 9 2.0 10 1.0 11 3.0 12 1.0 13 3.0 14 3.0 15 1.0 16 0.0 17 4.0 18 7.0 19 3.0 20 3.0 21 5.0 22 3.0 23 12.0 24 9.0 25 13.0 26 12.0 27 15.0 28 21.0 29 26.0 30 27.0 31 39.0 32 58.0 33 73.0 34 115.0 35 216.0 36 534.0 37 2776.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.65 16.45 17.1 28.799999999999997 2 25.224999999999998 22.05 34.125 18.6 3 20.5 27.125 31.424999999999997 20.95 4 24.75 34.2 21.95 19.1 5 22.975 36.4 22.1 18.525 6 18.275 37.974999999999994 23.7 20.05 7 18.525 17.875 42.3 21.3 8 22.125 23.275000000000002 26.35 28.249999999999996 9 22.900000000000002 24.0 27.474999999999998 25.624999999999996 10-14 22.869999999999997 29.360000000000003 26.145000000000003 21.625 15-19 23.34 27.495000000000005 28.095 21.07 20-24 23.294999999999998 28.18 27.544999999999998 20.979999999999997 25-29 22.965 28.185 27.82 21.029999999999998 30-34 23.13 28.144999999999996 27.284999999999997 21.44 35-39 22.900000000000002 28.555000000000003 27.229999999999997 21.315 40-44 22.655 28.299999999999997 27.965 21.08 45-49 23.395 27.689999999999998 28.044999999999998 20.87 50-54 22.955000000000002 28.26 27.68 21.105 55-59 22.71 27.47 28.275 21.545 60-64 22.915 28.54 27.650000000000002 20.895 65-69 22.955000000000002 28.215 27.229999999999997 21.6 70-74 23.0 27.62 27.925 21.455 75-79 23.145 27.675 27.72 21.46 80-84 23.380000000000003 27.88 27.495000000000005 21.245 85-89 23.599999999999998 27.415 28.084999999999997 20.9 90-94 23.455000000000002 27.810000000000002 27.68 21.055 95-99 24.0 27.975 27.200000000000003 20.825 100-104 24.12 27.79 27.71 20.380000000000003 105-109 23.21 28.610000000000003 27.279999999999998 20.9 110-114 23.825 27.925 27.405 20.845 115-119 23.395 28.205000000000002 27.455000000000002 20.945 120-124 24.01 27.32 27.805000000000003 20.865000000000002 125-129 23.925 28.83 27.089999999999996 20.155 130-134 24.4 28.294999999999998 27.1 20.205000000000002 135-139 24.135 28.355000000000004 27.105 20.405 140-144 24.59 28.189999999999998 27.18 20.04 145-149 24.85 27.595 27.52 20.035 150-151 25.45 28.3875 26.1 20.0625 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.5 22 1.0 23 1.0 24 1.0 25 0.5 26 1.5 27 3.0 28 3.0 29 5.5 30 9.0 31 16.5 32 26.5 33 29.0 34 28.5 35 39.0 36 68.0 37 100.0 38 120.0 39 141.5 40 190.0 41 232.0 42 277.0 43 304.5 44 297.0 45 289.5 46 268.5 47 265.0 48 269.0 49 231.0 50 176.5 51 145.5 52 113.5 53 80.0 54 61.0 55 52.0 56 42.5 57 33.0 58 24.0 59 13.5 60 10.0 61 7.5 62 6.5 63 4.5 64 1.5 65 2.0 66 2.0 67 1.5 68 1.0 69 0.5 70 0.0 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.825 #Duplication Level Percentage of deduplicated Percentage of total 1 99.82469321312296 99.65 2 0.1753067868770348 0.35000000000000003 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0125 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.037500000000000006 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.175 0.0 0.0 0.0 0.0 96-97 0.25 0.0 0.0 0.0 0.0 98-99 0.2875 0.0 0.0 0.0 0.0 100-101 0.3 0.0 0.0 0.0 0.0 102-103 0.3125 0.0 0.0 0.0 0.0 104-105 0.3375 0.0 0.0 0.0 0.0 106-107 0.42500000000000004 0.0 0.0 0.0 0.0 108-109 0.5125 0.0 0.0 0.0 0.0 110-111 0.6 0.0 0.0 0.0 0.0 112-113 0.6625 0.0 0.0 0.0 0.0 114-115 0.7625 0.0 0.0 0.0 0.0 116-117 0.8999999999999999 0.0 0.0 0.0 0.0 118-119 1.0625 0.0 0.0 0.0 0.0 120-121 1.2375 0.0 0.0 0.0 0.0 122-123 1.3375 0.0 0.0 0.0 0.0 124-125 1.4500000000000002 0.0 0.0 0.0 0.0 126-127 1.775 0.0 0.0 0.0 0.0 128-129 2.1625 0.0 0.0 0.0 0.0 130-131 2.3125 0.0 0.0 0.0 0.0 132-133 2.45 0.0 0.0 0.0 0.0 134-135 2.7249999999999996 0.0 0.0 0.0 0.0 136-137 3.0625 0.0 0.0 0.0 0.0 138-139 3.4000000000000004 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 710506 spots for SRR7172715.sra Written 710506 spots for SRR7172715.sra Read 710506 spots for SRR7172715.sra Written 710506 spots for SRR7172715.sra Read 710506 spots for SRR7172715.sra Written 710506 spots for SRR7172715.sra Read 710506 spots for SRR7172715.sra Written 710506 spots for SRR7172715.sra Read 710506 spots for SRR7172715.sra Written 710506 spots for SRR7172715.sra Read 710506 spots for SRR7172715.sra Written 710506 spots for SRR7172715.sra Read 710506 spots for SRR7172715.sra Written 710506 spots for SRR7172715.sra Read 710506 spots for SRR7172715.sra Written 710506 spots for SRR7172715.sra Read 710506 spots for SRR7172715.sra Written 710506 spots for SRR7172715.sra Read 710506 spots for SRR7172715.sra Read 710506 spots for SRR7172715.sra Written 710506 spots for SRR7172715.sra Written 710506 spots for SRR7172715.sra Read 710506 spots for SRR7172715.sra Written 710506 spots for SRR7172715.sra Read 710506 spots for SRR7172715.sra Written 710506 spots for SRR7172715.sra Read 710506 spots for SRR7172715.sra Written 710506 spots for SRR7172715.sra Read 710506 spots for SRR7172715.sra Written 710506 spots for SRR7172715.sra Read 710506 spots for SRR7172715.sra Written 710506 spots for SRR7172715.sra Read 710506 spots for SRR7172715.sra Written 710506 spots for SRR7172715.sra Read 710506 spots for SRR7172715.sra Written 710506 spots for SRR7172715.sra Read 710515 spots for SRR7172715.sra Written 710515 spots for SRR7172715.sra Read 710506 spots for SRR7172715.sra Written 710506 spots for SRR7172715.sra SRR ids: ['SRR7172715.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_521_8fzs SRR7172715.sra spots: 14210129 blocks: [[1, 710506], [710507, 1421012], [1421013, 2131518], [2131519, 2842024], [2842025, 3552530], [3552531, 4263036], [4263037, 4973542], [4973543, 5684048], [5684049, 6394554], [6394555, 7105060], [7105061, 7815566], [7815567, 8526072], [8526073, 9236578], [9236579, 9947084], [9947085, 10657590], [10657591, 11368096], [11368097, 12078602], [12078603, 12789108], [12789109, 13499614], [13499615, 14210129]] SRR7172715 file size 4793646 SRR7172715 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172715 SRR7172715_1.fastq SRR7172715_2.fastq Input file: SRR7172715_1.fastq Paired file: SRR7172715_2.fastq trimmed: SRR7172715-trimmed-pair1.fastq, SRR7172715-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 15:09:14 2025 >> started Mon Feb 10 15:09:34 2025 >> done (20.517s) 14210129 read pairs processed; of these: 10907 ( 0.08%) short read pairs filtered out after trimming by size control 7847 ( 0.06%) empty read pairs filtered out after trimming by size control 14191375 (99.87%) read pairs available; of these: 6249262 (44.04%) trimmed read pairs available after processing 7942113 (55.96%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 1 0.00% 20 3 0.00% 21 2 0.00% 22 2 0.00% 23 3 0.00% 24 0 0.00% 25 0 0.00% 26 2 0.00% 27 1 0.00% 28 3 0.00% 29 5 0.00% 30 2 0.00% 31 1 0.00% 32 4 0.00% 33 4 0.00% 34 3 0.00% 35 2 0.00% 36 3 0.00% 37 2 0.00% 38 1 0.00% 39 2 0.00% 40 3 0.00% 41 4 0.00% 42 3 0.00% 43 3 0.00% 44 5 0.00% 45 11 0.00% 46 7 0.00% 47 7 0.00% 48 5 0.00% 49 13 0.00% 50 13 0.00% 51 6 0.00% 52 9 0.00% 53 13 0.00% 54 11 0.00% 55 20 0.00% 56 20 0.00% 57 23 0.00% 58 30 0.00% 59 30 0.00% 60 29 0.00% 61 29 0.00% 62 49 0.00% 63 40 0.00% 64 72 0.00% 65 80 0.00% 66 72 0.00% 67 88 0.00% 68 85 0.00% 69 99 0.00% 70 89 0.00% 71 122 0.00% 72 162 0.00% 73 162 0.00% 74 198 0.00% 75 195 0.00% 76 284 0.00% 77 337 0.00% 78 333 0.00% 79 403 0.00% 80 473 0.00% 81 526 0.00% 82 601 0.00% 83 743 0.01% 84 1272 0.01% 85 1608 0.01% 86 1753 0.01% 87 1978 0.01% 88 2055 0.01% 89 2264 0.02% 90 2375 0.02% 91 2480 0.02% 92 2688 0.02% 93 2847 0.02% 94 3094 0.02% 95 3311 0.02% 96 3502 0.02% 97 3820 0.03% 98 4174 0.03% 99 4550 0.03% 100 4804 0.03% 101 5338 0.04% 102 5737 0.04% 103 6116 0.04% 104 6357 0.04% 105 7007 0.05% 106 7718 0.05% 107 8159 0.06% 108 8596 0.06% 109 9120 0.06% 110 9704 0.07% 111 10417 0.07% 112 11193 0.08% 113 12016 0.08% 114 12765 0.09% 115 13619 0.10% 116 14459 0.10% 117 15030 0.11% 118 16032 0.11% 119 16937 0.12% 120 17951 0.13% 121 18872 0.13% 122 19965 0.14% 123 21218 0.15% 124 21981 0.15% 125 23764 0.17% 126 24934 0.18% 127 26304 0.19% 128 27386 0.19% 129 29216 0.21% 130 31023 0.22% 131 32713 0.23% 132 34444 0.24% 133 36820 0.26% 134 39282 0.28% 135 41827 0.29% 136 44756 0.32% 137 48026 0.34% 138 51879 0.37% 139 55693 0.39% 140 61144 0.43% 141 67363 0.47% 142 75243 0.53% 143 84185 0.59% 144 98828 0.70% 145 118639 0.84% 146 150558 1.06% 147 209168 1.47% 148 330753 2.33% 149 684320 4.82% 150 3470559 24.46% 151 7942113 55.96% 14191375 reads passed initial QC criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=2.29 fanout-score-rank=25 prefix-density=0.20 prefix-fanout=2.1 sequence=AGTTCATCTCAGA criterion=fanout-score sequence-density=0.09 sequence-density-rank=18 fanout-score=143.17 fanout-score-rank=1 prefix-density=0.58 prefix-fanout=22.0 sequence=CCACCACCATGGGCTTGGTGGG criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=4.71 fanout-score-rank=24 prefix-density=0.34 prefix-fanout=3.4 sequence=TGCAAGTGCGGCAGTG criterion=fanout-score sequence-density=0.08 sequence-density-rank=26 fanout-score=43.60 fanout-score-rank=1 prefix-density=0.32 prefix-fanout=11.2 sequence=GAGGTTGAGTACAGGTGCTTTGTTGG SRR7172715 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 15:10:40 Started mapping on | Feb 10 15:10:40 Finished on | Feb 10 15:12:02 Mapping speed, Million of reads per hour | 623.04 Number of input reads | 14191375 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 12812694 Uniquely mapped reads % | 90.29% Average mapped length | 292.21 Number of splices: Total | 13132308 Number of splices: Annotated (sjdb) | 12917145 Number of splices: GT/AG | 12924198 Number of splices: GC/AG | 166987 Number of splices: AT/AC | 9250 Number of splices: Non-canonical | 31873 Mismatch rate per base, % | 0.32% Deletion rate per base | 0.03% Deletion average length | 2.67 Insertion rate per base | 0.02% Insertion average length | 2.61 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 318441 % of reads mapped to multiple loci | 2.24% Number of reads mapped to too many loci | 38174 % of reads mapped to too many loci | 0.27% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 7.16% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1069078 1069078 1069078 N_multimapping 318441 318441 318441 N_noFeature 273714 12700580 320445 N_ambiguous 165633 1366 99344 UnstrandedReadsAssigned:12373347 PositiveStrandReadsAssigned:110748 NegativeStrandReadsAssigned:12392905 Dataset is classified negative stranded MeadianReadLen=147 20thPercentileLength=146 echo kmer=141 SRR7172715 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172715-trimmed-pair1.fastq SRR7172715-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,191,375 reads, 12,864,972 reads pseudoaligned [quant] estimated average fragment length: 250.082 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,255 rounds 52401 SRR7172715.ke.tsv 34699 SRR7172715.se.tsv 87100 total ==> SRR7172715.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1768.92 894 39.0556 Potri.005G024800.1.v4.1 1035 785.918 151 14.8475 Potri.004G059700.1.v4.1 961 711.982 19 2.06223 Potri.007G009000.2.v4.1 1416 1166.92 0 0 Potri.003G141000.2.v4.1 2943 2693.92 449.162 12.8846 Potri.016G087400.1.v4.1 270 76.3149 1046 1059.19 Potri.015G069301.1.v4.1 564 320.793 0 0 Potri.010G195200.1.v4.1 1773 1523.92 281 14.2494 Potri.012G127500.1.v4.1 977 727.959 4117 437.046 ==> SRR7172715.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 24 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 407 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 4 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 110 SRR7172715 completed mapping pipeline successfully