Starting /dee2/code/volunteer_pipeline.sh SRR7172716 current disk space = 3058698989568 free memory = 1579844364 SRR7172716 SRAfilesize 7a65914335128e3b8efbff16fcdde1e2 SRR7172716.sra SRR7172716.sra file validated SRR7172716 is paired end SRR7172716 is conventional basespace SRR7172716 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172716_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 24.62075 25.0 18.0 32.0 18.0 33.0 2 30.675 31.0 29.0 33.0 27.0 33.0 3 31.13325 33.0 32.0 33.0 27.0 33.0 4 32.24875 33.0 32.0 33.0 32.0 34.0 5 32.74825 33.0 33.0 34.0 32.0 34.0 6 37.1565 38.0 38.0 38.0 36.0 38.0 7 37.45825 38.0 38.0 38.0 37.0 38.0 8 37.56925 38.0 38.0 38.0 38.0 38.0 9 37.522 38.0 38.0 38.0 38.0 38.0 10-14 37.59695 38.0 38.0 38.0 38.0 38.0 15-19 37.580200000000005 38.0 38.0 38.0 38.0 38.0 20-24 37.54425 38.0 38.0 38.0 38.0 38.0 25-29 37.5755 38.0 38.0 38.0 38.0 38.0 30-34 37.5685 38.0 38.0 38.0 38.0 38.0 35-39 37.523849999999996 38.0 38.0 38.0 38.0 38.0 40-44 37.476350000000004 38.0 38.0 38.0 38.0 38.0 45-49 37.436350000000004 38.0 38.0 38.0 37.6 38.0 50-54 37.4 38.0 38.0 38.0 37.0 38.0 55-59 37.3127 38.0 38.0 38.0 37.0 38.0 60-64 37.3016 38.0 38.0 38.0 37.0 38.0 65-69 37.232150000000004 38.0 38.0 38.0 36.6 38.0 70-74 37.20955 38.0 38.0 38.0 36.2 38.0 75-79 37.05380000000001 38.0 38.0 38.0 36.0 38.0 80-84 36.8822 38.0 38.0 38.0 35.4 38.0 85-89 36.8585 38.0 38.0 38.0 35.4 38.0 90-94 36.90895 38.0 38.0 38.0 35.8 38.0 95-99 36.897299999999994 38.0 38.0 38.0 35.8 38.0 100-104 36.806850000000004 38.0 38.0 38.0 35.0 38.0 105-109 36.4546 38.0 38.0 38.0 34.0 38.0 110-114 36.29639999999999 38.0 38.0 38.0 33.8 38.0 115-119 36.3553 38.0 38.0 38.0 33.8 38.0 120-124 36.15445 38.0 37.2 38.0 33.2 38.0 125-129 35.824149999999996 38.0 36.6 38.0 31.4 38.0 130-134 35.28205 38.0 35.8 38.0 29.2 38.0 135-139 35.039100000000005 38.0 35.6 38.0 28.0 38.0 140-144 34.97565 38.0 35.6 38.0 28.8 38.0 145-149 34.50320000000001 38.0 35.0 38.0 27.4 38.0 150-151 30.916249999999998 36.5 29.0 38.0 13.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 0.0 10 0.0 11 0.0 12 1.0 13 0.0 14 0.0 15 0.0 16 1.0 17 2.0 18 2.0 19 2.0 20 0.0 21 4.0 22 2.0 23 4.0 24 9.0 25 5.0 26 13.0 27 18.0 28 22.0 29 26.0 30 36.0 31 35.0 32 62.0 33 120.0 34 144.0 35 271.0 36 724.0 37 2496.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.207778915046056 15.404298874104402 11.821903787103377 36.56601842374616 2 20.020045101478328 19.218241042345277 36.30669005261839 24.455023803558003 3 18.099999999999998 28.025 25.7 28.175 4 23.799999999999997 33.050000000000004 22.325 20.825 5 22.075 36.0 22.85 19.075 6 17.974999999999998 35.125 25.5 21.4 7 13.975000000000001 22.1 44.074999999999996 19.85 8 17.9 22.325 30.775000000000002 28.999999999999996 9 18.775 22.900000000000002 29.95 28.375 10-14 19.825 29.65 26.695 23.830000000000002 15-19 20.16 28.005000000000003 28.23 23.605 20-24 20.175 28.165000000000003 27.815 23.845 25-29 19.950000000000003 28.02 28.465 23.565 30-34 19.900000000000002 28.249999999999996 28.299999999999997 23.549999999999997 35-39 19.495 28.12 28.575 23.810000000000002 40-44 19.935 28.689999999999998 28.025 23.35 45-49 20.544999999999998 28.26 27.905 23.29 50-54 21.005 27.845 28.03 23.119999999999997 55-59 19.939999999999998 27.83 28.4 23.830000000000002 60-64 20.275000000000002 28.34 27.595 23.79 65-69 20.385 27.944999999999997 27.845 23.825 70-74 20.18 27.62 28.53 23.669999999999998 75-79 20.665 28.144999999999996 27.685 23.505000000000003 80-84 20.285 27.800000000000004 28.27 23.645 85-89 19.705000000000002 28.025 28.349999999999998 23.919999999999998 90-94 20.22 28.499999999999996 27.700000000000003 23.580000000000002 95-99 20.085 27.79 28.310000000000002 23.815 100-104 20.075000000000003 28.285 28.015 23.625 105-109 20.335 27.83 28.395 23.44 110-114 20.294999999999998 28.04 27.675 23.990000000000002 115-119 20.72 28.065 27.87 23.345 120-124 20.52 27.405 28.185 23.89 125-129 20.880000000000003 27.755000000000003 28.22 23.145 130-134 20.705000000000002 28.82 27.405 23.07 135-139 20.919999999999998 27.955000000000002 27.37 23.755000000000003 140-144 21.085 28.12 27.365000000000002 23.43 145-149 20.595 28.804999999999996 27.18 23.419999999999998 150-151 21.525 28.475 27.05 22.95 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 0.5 22 0.0 23 0.0 24 0.5 25 1.5 26 4.5 27 8.5 28 8.0 29 12.0 30 19.5 31 20.0 32 27.0 33 34.5 34 41.0 35 53.5 36 70.5 37 103.5 38 144.5 39 191.0 40 208.5 41 231.5 42 275.0 43 284.0 44 277.0 45 273.0 46 258.5 47 246.0 48 243.5 49 213.0 50 172.0 51 138.5 52 113.5 53 89.5 54 62.0 55 43.5 56 34.5 57 29.0 58 20.0 59 10.0 60 7.0 61 8.5 62 7.0 63 4.5 64 2.5 65 3.0 66 2.0 67 0.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.3 2 0.22499999999999998 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67394030599448 99.35000000000001 2 0.32605969400551793 0.65 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.025 0.0 0.0 0.0 84-85 0.025 0.025 0.0 0.0 0.0 86-87 0.075 0.025 0.0 0.0 0.0 88-89 0.075 0.025 0.0 0.0 0.0 90-91 0.125 0.025 0.0 0.0 0.0 92-93 0.1375 0.025 0.0 0.0 0.0 94-95 0.15 0.025 0.0 0.0 0.0 96-97 0.1875 0.025 0.0 0.0 0.0 98-99 0.2875 0.025 0.0 0.0 0.0 100-101 0.375 0.025 0.0 0.0 0.0 102-103 0.4375 0.025 0.0 0.0 0.0 104-105 0.5 0.025 0.0 0.0 0.0 106-107 0.5625 0.025 0.0 0.0 0.0 108-109 0.625 0.025 0.0 0.0 0.0 110-111 0.7625 0.025 0.0 0.0 0.0 112-113 0.9375 0.025 0.0 0.0 0.0 114-115 1.05 0.025 0.0 0.0 0.0 116-117 1.1749999999999998 0.025 0.0 0.0 0.0 118-119 1.3125 0.025 0.0 0.0 0.0 120-121 1.4625 0.025 0.0 0.0 0.0 122-123 1.6375 0.025 0.0 0.0 0.0 124-125 1.8250000000000002 0.025 0.0 0.0 0.0 126-127 2.0125 0.025 0.0 0.0 0.0 128-129 2.375 0.025 0.0 0.0 0.0 130-131 2.8125 0.025 0.0 0.0 0.0 132-133 3.25 0.025 0.0 0.0 0.0 134-135 3.7 0.025 0.0 0.0 0.0 136-137 4.075 0.025 0.0 0.0 0.0 138-139 4.612500000000001 0.025 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTTGGCC 10 0.0068343505 144.975 8 AAGATCT 10 0.0068343505 144.975 3 ACAATGA 10 0.0068343505 144.975 4 >>END_MODULE SRR7172716 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172716_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.028 34.0 33.0 34.0 32.0 34.0 2 33.05575 34.0 33.0 34.0 32.0 34.0 3 33.08825 34.0 33.0 34.0 33.0 34.0 4 33.0635 34.0 33.0 34.0 33.0 34.0 5 33.03275 34.0 33.0 34.0 32.0 34.0 6 37.1485 38.0 38.0 38.0 37.0 38.0 7 37.15125 38.0 38.0 38.0 37.0 38.0 8 37.15425 38.0 38.0 38.0 37.0 38.0 9 37.18675 38.0 38.0 38.0 37.0 38.0 10-14 37.160450000000004 38.0 38.0 38.0 37.0 38.0 15-19 37.1511 38.0 38.0 38.0 37.0 38.0 20-24 37.14185 38.0 38.0 38.0 37.0 38.0 25-29 36.98365 38.0 38.0 38.0 37.0 38.0 30-34 36.483850000000004 38.0 38.0 38.0 36.0 38.0 35-39 36.7029 38.0 38.0 38.0 36.2 38.0 40-44 37.0253 38.0 38.0 38.0 37.0 38.0 45-49 36.9891 38.0 38.0 38.0 37.0 38.0 50-54 36.934149999999995 38.0 38.0 38.0 36.6 38.0 55-59 36.8256 38.0 38.0 38.0 36.0 38.0 60-64 36.65680000000001 38.0 38.0 38.0 35.6 38.0 65-69 36.44175 38.0 38.0 38.0 34.4 38.0 70-74 36.52505 38.0 38.0 38.0 34.6 38.0 75-79 36.50894999999999 38.0 38.0 38.0 34.6 38.0 80-84 36.5451 38.0 38.0 38.0 35.0 38.0 85-89 36.41845000000001 38.0 38.0 38.0 34.2 38.0 90-94 36.40655 38.0 38.0 38.0 34.2 38.0 95-99 36.23245 38.0 38.0 38.0 34.0 38.0 100-104 36.09225 38.0 38.0 38.0 33.6 38.0 105-109 35.9063 38.0 38.0 38.0 33.0 38.0 110-114 35.77195 38.0 37.6 38.0 32.6 38.0 115-119 35.5723 38.0 37.0 38.0 31.6 38.0 120-124 35.32925 38.0 36.8 38.0 29.4 38.0 125-129 35.028749999999995 38.0 36.0 38.0 28.2 38.0 130-134 34.7185 38.0 35.8 38.0 27.2 38.0 135-139 34.33295 38.0 34.8 38.0 24.6 38.0 140-144 33.93495 38.0 33.6 38.0 23.8 38.0 145-149 32.931200000000004 38.0 33.0 38.0 16.0 38.0 150-151 28.561625 35.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 10.0 3 5.0 4 1.0 5 2.0 6 1.0 7 4.0 8 2.0 9 3.0 10 0.0 11 1.0 12 4.0 13 6.0 14 1.0 15 4.0 16 4.0 17 2.0 18 4.0 19 12.0 20 4.0 21 3.0 22 9.0 23 10.0 24 13.0 25 17.0 26 17.0 27 28.0 28 27.0 29 34.0 30 46.0 31 60.0 32 65.0 33 101.0 34 182.0 35 289.0 36 565.0 37 2464.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.25 16.0 17.9 27.85 2 25.0 24.175 33.15 17.675 3 21.175 27.05 30.475 21.3 4 23.799999999999997 33.45 21.65 21.099999999999998 5 23.674999999999997 37.2 21.5 17.625 6 19.400000000000002 38.125 22.95 19.525000000000002 7 18.35 17.349999999999998 41.425 22.875 8 20.9 23.7 26.724999999999998 28.675 9 21.575 25.35 27.85 25.224999999999998 10-14 22.689999999999998 28.985 26.525 21.8 15-19 22.725 28.205000000000002 27.650000000000002 21.42 20-24 22.74 28.799999999999997 26.6 21.86 25-29 23.027932400581715 28.554234993230025 27.395817662103205 21.02201494408505 30-34 23.068707725169098 28.21034430147994 27.422061740324466 21.298886233026497 35-39 22.373256809142628 28.616019735186025 27.8105019382772 21.200221517394148 40-44 23.07 28.505000000000003 27.435 20.990000000000002 45-49 23.05 28.175 27.555000000000003 21.22 50-54 22.689999999999998 28.57 27.875 20.865000000000002 55-59 23.119999999999997 27.73 27.93 21.22 60-64 22.705000000000002 28.384999999999998 28.000000000000004 20.91 65-69 23.78 27.884999999999998 27.584999999999997 20.75 70-74 23.655 28.08 27.74 20.525 75-79 23.549999999999997 27.800000000000004 28.08 20.57 80-84 23.865 27.63 27.584999999999997 20.919999999999998 85-89 23.935000000000002 28.565 26.88 20.62 90-94 23.02 28.12 28.189999999999998 20.669999999999998 95-99 23.525 28.335 27.46 20.68 100-104 23.79 27.900000000000002 27.49 20.82 105-109 23.24 27.744999999999997 27.83 21.185000000000002 110-114 23.405 28.34 27.455000000000002 20.8 115-119 23.9 28.54 27.425 20.135 120-124 23.965 28.360000000000003 27.560000000000002 20.115 125-129 23.84 28.165000000000003 27.705000000000002 20.29 130-134 24.245 28.17 27.439999999999998 20.145 135-139 24.205 28.13 27.825 19.84 140-144 24.495 27.925 27.35 20.23 145-149 24.585 27.88 26.96 20.575 150-151 25.3 27.987499999999997 26.150000000000002 20.5625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.0 21 0.5 22 2.0 23 1.5 24 0.5 25 0.5 26 2.0 27 3.5 28 5.0 29 8.0 30 9.0 31 12.0 32 21.5 33 31.0 34 48.5 35 69.0 36 80.5 37 99.0 38 131.0 39 164.5 40 198.5 41 235.5 42 266.5 43 288.5 44 290.0 45 283.0 46 270.5 47 253.5 48 229.0 49 205.5 50 163.5 51 135.0 52 121.0 53 89.5 54 70.0 55 56.5 56 47.0 57 32.5 58 21.5 59 12.5 60 9.5 61 7.5 62 7.5 63 6.0 64 2.5 65 3.0 66 1.0 67 0.0 68 0.5 69 0.5 70 1.0 71 1.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.295 30-34 1.685 35-39 0.685 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.4 #Duplication Level Percentage of deduplicated Percentage of total 1 99.42152917505031 98.825 2 0.5533199195171026 1.0999999999999999 3 0.025150905432595575 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.1375 0.0 0.0 0.0 0.0 94-95 0.15 0.0 0.0 0.0 0.0 96-97 0.1875 0.0 0.0 0.0 0.0 98-99 0.2875 0.0 0.0 0.0 0.0 100-101 0.375 0.0 0.0 0.0 0.0 102-103 0.4375 0.0 0.0 0.0 0.0 104-105 0.5 0.0 0.0 0.0 0.0 106-107 0.5625 0.0 0.0 0.0 0.0 108-109 0.625 0.0 0.0 0.0 0.0 110-111 0.7625 0.0 0.0 0.0 0.0 112-113 0.9375 0.0 0.0 0.0 0.0 114-115 1.05 0.0 0.0 0.0 0.0 116-117 1.1749999999999998 0.0 0.0 0.0 0.0 118-119 1.3125 0.0 0.0 0.0 0.0 120-121 1.4625 0.0 0.0 0.0 0.0 122-123 1.625 0.0 0.0 0.0 0.0 124-125 1.7999999999999998 0.0 0.0 0.0 0.0 126-127 1.9874999999999998 0.0 0.0 0.0 0.0 128-129 2.35 0.0 0.0 0.0 0.0 130-131 2.7625 0.0 0.0 0.0 0.0 132-133 3.175 0.0 0.0 0.0 0.0 134-135 3.6 0.0 0.0 0.0 0.0 136-137 3.9625000000000004 0.0 0.0 0.0 0.0 138-139 4.5375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 811947 spots for SRR7172716.sra Written 811947 spots for SRR7172716.sra Read 811947 spots for SRR7172716.sra Written 811947 spots for SRR7172716.sra Read 811947 spots for SRR7172716.sra Written 811947 spots for SRR7172716.sra Read 811947 spots for SRR7172716.sra Written 811947 spots for SRR7172716.sra Read 811947 spots for SRR7172716.sra Written 811947 spots for SRR7172716.sra Read 811947 spots for SRR7172716.sra Written 811947 spots for SRR7172716.sra Read 811947 spots for SRR7172716.sra Written 811947 spots for SRR7172716.sra Read 811947 spots for SRR7172716.sra Written 811947 spots for SRR7172716.sra Read 811947 spots for SRR7172716.sra Written 811947 spots for SRR7172716.sra Read 811947 spots for SRR7172716.sra Written 811947 spots for SRR7172716.sra Read 811947 spots for SRR7172716.sra Written 811947 spots for SRR7172716.sra Read 811947 spots for SRR7172716.sra Written 811947 spots for SRR7172716.sra Read 811963 spots for SRR7172716.sra Written 811963 spots for SRR7172716.sra Read 811947 spots for SRR7172716.sra Written 811947 spots for SRR7172716.sra Read 811947 spots for SRR7172716.sra Written 811947 spots for SRR7172716.sra Read 811947 spots for SRR7172716.sra Written 811947 spots for SRR7172716.sra Read 811947 spots for SRR7172716.sra Written 811947 spots for SRR7172716.sra Read 811947 spots for SRR7172716.sra Written 811947 spots for SRR7172716.sra Read 811947 spots for SRR7172716.sra Written 811947 spots for SRR7172716.sra Read 811947 spots for SRR7172716.sra Written 811947 spots for SRR7172716.sra SRR ids: ['SRR7172716.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_a2dyc96e SRR7172716.sra spots: 16238956 blocks: [[1, 811947], [811948, 1623894], [1623895, 2435841], [2435842, 3247788], [3247789, 4059735], [4059736, 4871682], [4871683, 5683629], [5683630, 6495576], [6495577, 7307523], [7307524, 8119470], [8119471, 8931417], [8931418, 9743364], [9743365, 10555311], [10555312, 11367258], [11367259, 12179205], [12179206, 12991152], [12991153, 13803099], [13803100, 14615046], [14615047, 15426993], [15426994, 16238956]] SRR7172716 file size 5481148 SRR7172716 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172716 SRR7172716_1.fastq SRR7172716_2.fastq Input file: SRR7172716_1.fastq Paired file: SRR7172716_2.fastq trimmed: SRR7172716-trimmed-pair1.fastq, SRR7172716-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 16:07:49 2025 >> started Mon Feb 10 16:08:06 2025 >> done (17.183s) 16238956 read pairs processed; of these: 25595 ( 0.16%) short read pairs filtered out after trimming by size control 20549 ( 0.13%) empty read pairs filtered out after trimming by size control 16192812 (99.72%) read pairs available; of these: 6565895 (40.55%) trimmed read pairs available after processing 9626917 (59.45%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 0 0.00% 20 0 0.00% 21 3 0.00% 22 2 0.00% 23 6 0.00% 24 3 0.00% 25 1 0.00% 26 3 0.00% 27 4 0.00% 28 3 0.00% 29 1 0.00% 30 1 0.00% 31 1 0.00% 32 1 0.00% 33 3 0.00% 34 3 0.00% 35 1 0.00% 36 4 0.00% 37 3 0.00% 38 4 0.00% 39 6 0.00% 40 3 0.00% 41 6 0.00% 42 4 0.00% 43 5 0.00% 44 9 0.00% 45 6 0.00% 46 10 0.00% 47 6 0.00% 48 10 0.00% 49 3 0.00% 50 17 0.00% 51 10 0.00% 52 15 0.00% 53 21 0.00% 54 30 0.00% 55 15 0.00% 56 22 0.00% 57 31 0.00% 58 35 0.00% 59 34 0.00% 60 39 0.00% 61 40 0.00% 62 58 0.00% 63 71 0.00% 64 83 0.00% 65 72 0.00% 66 85 0.00% 67 98 0.00% 68 123 0.00% 69 137 0.00% 70 175 0.00% 71 189 0.00% 72 232 0.00% 73 284 0.00% 74 281 0.00% 75 364 0.00% 76 448 0.00% 77 481 0.00% 78 528 0.00% 79 582 0.00% 80 705 0.00% 81 781 0.00% 82 978 0.01% 83 1144 0.01% 84 2264 0.01% 85 3111 0.02% 86 3243 0.02% 87 3424 0.02% 88 3416 0.02% 89 3590 0.02% 90 3694 0.02% 91 3951 0.02% 92 4095 0.03% 93 4385 0.03% 94 4766 0.03% 95 5033 0.03% 96 5532 0.03% 97 5784 0.04% 98 6124 0.04% 99 6563 0.04% 100 7127 0.04% 101 7494 0.05% 102 8245 0.05% 103 8958 0.06% 104 9157 0.06% 105 10202 0.06% 106 10832 0.07% 107 11563 0.07% 108 12118 0.07% 109 12761 0.08% 110 13397 0.08% 111 14727 0.09% 112 15474 0.10% 113 16404 0.10% 114 17539 0.11% 115 18666 0.12% 116 19358 0.12% 117 20601 0.13% 118 21586 0.13% 119 22785 0.14% 120 23582 0.15% 121 24907 0.15% 122 26145 0.16% 123 27855 0.17% 124 29417 0.18% 125 30754 0.19% 126 32091 0.20% 127 33537 0.21% 128 35327 0.22% 129 36691 0.23% 130 38599 0.24% 131 40478 0.25% 132 43213 0.27% 133 45623 0.28% 134 48312 0.30% 135 50611 0.31% 136 54048 0.33% 137 57620 0.36% 138 61159 0.38% 139 65591 0.41% 140 70531 0.44% 141 76923 0.48% 142 84605 0.52% 143 94377 0.58% 144 107811 0.67% 145 127970 0.79% 146 158662 0.98% 147 214001 1.32% 148 335098 2.07% 149 626729 3.87% 150 3507334 21.66% 151 9626917 59.45% 16192812 reads passed initial QC criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=6.76 fanout-score-rank=16 prefix-density=0.26 prefix-fanout=3.8 sequence=TCCTTGTCCTGGATCTTGGCCTT criterion=fanout-score sequence-density=0.08 sequence-density-rank=29 fanout-score=158.65 fanout-score-rank=1 prefix-density=0.56 prefix-fanout=22.8 sequence=CCACCACCATGGGCT criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=5.81 fanout-score-rank=14 prefix-density=0.32 prefix-fanout=3.8 sequence=CTGCAAATGTGG criterion=fanout-score sequence-density=0.03 sequence-density-rank=31 fanout-score=94.17 fanout-score-rank=1 prefix-density=0.22 prefix-fanout=14.4 sequence=TCTTCCTCTCTATAATTTTCTAGGGTTTAGCAATGTCTGCCGAGGTTGAGTACAGGTGCTTTGTTGG SRR7172716 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 16:08:52 Started mapping on | Feb 10 16:08:53 Finished on | Feb 10 16:10:43 Mapping speed, Million of reads per hour | 529.95 Number of input reads | 16192812 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 15236386 Uniquely mapped reads % | 94.09% Average mapped length | 296.04 Number of splices: Total | 15764296 Number of splices: Annotated (sjdb) | 15504427 Number of splices: GT/AG | 15522998 Number of splices: GC/AG | 195374 Number of splices: AT/AC | 12230 Number of splices: Non-canonical | 33694 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.79 Insertion rate per base | 0.02% Insertion average length | 2.66 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 393593 % of reads mapped to multiple loci | 2.43% Number of reads mapped to too many loci | 40097 % of reads mapped to too many loci | 0.25% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.16% % of reads unmapped: other | 0.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 584631 584631 584631 N_multimapping 393593 393593 393593 N_noFeature 296653 15110957 353989 N_ambiguous 147006 723 78439 UnstrandedReadsAssigned:14792727 PositiveStrandReadsAssigned:124706 NegativeStrandReadsAssigned:14803958 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7172716 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172716-trimmed-pair1.fastq SRR7172716-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,192,812 reads, 14,667,430 reads pseudoaligned [quant] estimated average fragment length: 245.409 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,121 rounds 52401 SRR7172716.ke.tsv 34699 SRR7172716.se.tsv 87100 total ==> SRR7172716.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1773.59 988 38.522 Potri.005G024800.1.v4.1 1035 790.591 324 28.3399 Potri.004G059700.1.v4.1 961 716.599 90 8.68503 Potri.007G009000.2.v4.1 1416 1171.59 0 0 Potri.003G141000.2.v4.1 2943 2698.59 500.272 12.8196 Potri.016G087400.1.v4.1 270 76.1998 1064 965.59 Potri.015G069301.1.v4.1 564 323.852 0 0 Potri.010G195200.1.v4.1 1773 1528.59 243 10.9931 Potri.012G127500.1.v4.1 977 732.599 4620 436.095 ==> SRR7172716.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 30 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 367 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 3 Potri.001G452600.v4.1 185 SRR7172716 completed mapping pipeline successfully