Starting /dee2/code/volunteer_pipeline.sh SRR7172717 current disk space = 3059128963072 free memory = 1413029196 SRR7172717 SRAfilesize 4e86f05fc1e5514bb62599d9c1172963 SRR7172717.sra SRR7172717.sra file validated SRR7172717 is paired end SRR7172717 is conventional basespace SRR7172717 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172717_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 26.8025 32.0 18.0 33.0 18.0 33.0 2 30.75525 33.0 29.0 33.0 27.0 33.0 3 31.94775 33.0 32.0 33.0 30.0 34.0 4 31.9425 33.0 32.0 33.0 31.0 33.0 5 32.7415 33.0 33.0 33.0 32.0 34.0 6 37.136 38.0 38.0 38.0 36.0 38.0 7 37.524 38.0 38.0 38.0 37.0 38.0 8 37.69925 38.0 38.0 38.0 38.0 38.0 9 37.69475 38.0 38.0 38.0 38.0 38.0 10-14 37.73665 38.0 38.0 38.0 38.0 38.0 15-19 37.70665 38.0 38.0 38.0 38.0 38.0 20-24 37.6408 38.0 38.0 38.0 38.0 38.0 25-29 37.6571 38.0 38.0 38.0 38.0 38.0 30-34 37.643800000000006 38.0 38.0 38.0 38.0 38.0 35-39 37.581100000000006 38.0 38.0 38.0 38.0 38.0 40-44 37.55675 38.0 38.0 38.0 38.0 38.0 45-49 37.512950000000004 38.0 38.0 38.0 38.0 38.0 50-54 37.482800000000005 38.0 38.0 38.0 38.0 38.0 55-59 37.406349999999996 38.0 38.0 38.0 37.0 38.0 60-64 37.428650000000005 38.0 38.0 38.0 37.4 38.0 65-69 37.322799999999994 38.0 38.0 38.0 37.0 38.0 70-74 37.3101 38.0 38.0 38.0 37.0 38.0 75-79 37.2059 38.0 38.0 38.0 36.8 38.0 80-84 37.16045 38.0 38.0 38.0 36.6 38.0 85-89 37.06565 38.0 38.0 38.0 36.2 38.0 90-94 37.0423 38.0 38.0 38.0 36.0 38.0 95-99 37.093 38.0 38.0 38.0 36.0 38.0 100-104 36.90865 38.0 38.0 38.0 35.8 38.0 105-109 36.7185 38.0 38.0 38.0 34.8 38.0 110-114 36.65785 38.0 38.0 38.0 34.2 38.0 115-119 36.51315 38.0 38.0 38.0 34.0 38.0 120-124 36.521899999999995 38.0 38.0 38.0 34.0 38.0 125-129 36.15595 38.0 37.4 38.0 33.4 38.0 130-134 35.871 38.0 36.8 38.0 32.0 38.0 135-139 35.5085 38.0 36.0 38.0 31.0 38.0 140-144 35.469950000000004 38.0 36.0 38.0 31.0 38.0 145-149 35.2577 38.0 36.0 38.0 31.0 38.0 150-151 32.399125 36.5 33.5 38.0 16.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 0.0 8 0.0 9 1.0 10 1.0 11 1.0 12 1.0 13 0.0 14 0.0 15 1.0 16 1.0 17 1.0 18 3.0 19 0.0 20 2.0 21 2.0 22 0.0 23 2.0 24 3.0 25 9.0 26 9.0 27 11.0 28 8.0 29 22.0 30 27.0 31 45.0 32 42.0 33 91.0 34 121.0 35 206.0 36 555.0 37 2834.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.52229299363057 12.840764331210192 12.687898089171975 35.94904458598726 2 20.52896725440806 19.899244332493705 37.833753148614605 21.738035264483628 3 20.599999999999998 26.1 27.35 25.95 4 21.375 33.925 22.35 22.35 5 20.200000000000003 36.4 24.474999999999998 18.925 6 16.6 36.0 26.200000000000003 21.2 7 13.275 22.325 45.65 18.75 8 18.25 21.725 31.15 28.875 9 18.35 21.925 33.050000000000004 26.674999999999997 10-14 20.025000000000002 28.860000000000003 27.29 23.825 15-19 19.63 27.18 28.744999999999997 24.445 20-24 20.015 28.16 28.175 23.65 25-29 19.869999999999997 28.225 28.494999999999997 23.41 30-34 19.869999999999997 28.23 28.384999999999998 23.515 35-39 19.595000000000002 27.779999999999998 28.53 24.095 40-44 19.81 27.88 28.875 23.435 45-49 19.75 28.04 28.395 23.815 50-54 20.305 28.689999999999998 27.805000000000003 23.200000000000003 55-59 20.225 27.42 28.825 23.53 60-64 20.095 28.689999999999998 27.43 23.785 65-69 19.919999999999998 28.46 28.110000000000003 23.51 70-74 20.135 28.494999999999997 27.675 23.695 75-79 20.19 28.165000000000003 28.405 23.24 80-84 20.035 28.139999999999997 28.110000000000003 23.715 85-89 20.34 28.125 28.16 23.375 90-94 20.01 27.950000000000003 28.225 23.815 95-99 20.155 28.449999999999996 28.095 23.3 100-104 19.96 27.79 28.485 23.765 105-109 20.265 28.365000000000002 27.82 23.549999999999997 110-114 20.02 27.74 28.58 23.66 115-119 20.625 27.845 28.04 23.49 120-124 20.46 28.025 28.389999999999997 23.125 125-129 21.09 27.805000000000003 27.275 23.830000000000002 130-134 20.28 27.82 27.82 24.08 135-139 20.544999999999998 28.249999999999996 27.584999999999997 23.62 140-144 20.93 27.785 27.71 23.575 145-149 20.685000000000002 28.144999999999996 27.595 23.575 150-151 19.85 28.050000000000004 27.800000000000004 24.3 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.5 21 0.5 22 0.5 23 0.5 24 1.0 25 3.5 26 4.5 27 6.0 28 8.5 29 13.0 30 15.0 31 20.0 32 36.0 33 44.0 34 52.0 35 64.5 36 79.5 37 106.0 38 144.5 39 191.5 40 217.5 41 235.0 42 259.0 43 273.0 44 277.5 45 286.5 46 275.0 47 247.0 48 230.0 49 210.0 50 169.5 51 122.0 52 99.0 53 82.5 54 54.0 55 38.0 56 38.0 57 29.0 58 18.0 59 13.0 60 9.5 61 5.5 62 4.0 63 4.5 64 3.5 65 2.0 66 1.5 67 1.5 68 1.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.875 2 0.75 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.375 #Duplication Level Percentage of deduplicated Percentage of total 1 99.37106918238993 98.75 2 0.628930817610063 1.25 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.1375 0.0 0.0 0.0 0.0 94-95 0.175 0.0 0.0 0.0 0.0 96-97 0.225 0.0 0.0 0.0 0.0 98-99 0.275 0.0 0.0 0.0 0.0 100-101 0.32499999999999996 0.0 0.0 0.0 0.0 102-103 0.4625 0.0 0.0 0.0 0.0 104-105 0.5625 0.0 0.0 0.0 0.0 106-107 0.6125 0.0 0.0 0.0 0.0 108-109 0.6875 0.0 0.0 0.0 0.0 110-111 0.7625 0.0 0.0 0.0 0.0 112-113 0.825 0.0 0.0 0.0 0.0 114-115 0.9125 0.0 0.0 0.0 0.0 116-117 1.0 0.0 0.0 0.0 0.0 118-119 1.15 0.0 0.0 0.0 0.0 120-121 1.3625 0.0 0.0 0.0 0.0 122-123 1.5750000000000002 0.0 0.0 0.0 0.0 124-125 1.7625 0.0 0.0 0.0 0.0 126-127 1.9625 0.0 0.0 0.0 0.0 128-129 2.1875 0.0 0.0 0.0 0.0 130-131 2.4625000000000004 0.0 0.0 0.0 0.0 132-133 2.6500000000000004 0.0 0.0 0.0 0.0 134-135 2.9125 0.0 0.0 0.0 0.0 136-137 3.125 0.0 0.0 0.0 0.0 138-139 3.4 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCAATTG 10 0.006830828 145.0 8 >>END_MODULE SRR7172717 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172717_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.1295 34.0 33.0 34.0 32.0 34.0 2 33.239 34.0 33.0 34.0 33.0 34.0 3 33.23575 34.0 33.0 34.0 33.0 34.0 4 33.23825 34.0 33.0 34.0 33.0 34.0 5 33.21275 34.0 33.0 34.0 33.0 34.0 6 37.291 38.0 38.0 38.0 38.0 38.0 7 37.332 38.0 38.0 38.0 38.0 38.0 8 37.3595 38.0 38.0 38.0 38.0 38.0 9 37.3405 38.0 38.0 38.0 38.0 38.0 10-14 37.276599999999995 38.0 38.0 38.0 38.0 38.0 15-19 37.26205 38.0 38.0 38.0 38.0 38.0 20-24 37.26865 38.0 38.0 38.0 38.0 38.0 25-29 37.0296 38.0 38.0 38.0 37.4 38.0 30-34 36.5029 38.0 38.0 38.0 36.8 38.0 35-39 36.76610000000001 38.0 38.0 38.0 37.0 38.0 40-44 37.12935 38.0 38.0 38.0 37.0 38.0 45-49 37.152950000000004 38.0 38.0 38.0 37.0 38.0 50-54 37.107749999999996 38.0 38.0 38.0 37.0 38.0 55-59 37.031400000000005 38.0 38.0 38.0 37.0 38.0 60-64 36.90945000000001 38.0 38.0 38.0 36.4 38.0 65-69 36.81515 38.0 38.0 38.0 36.0 38.0 70-74 36.834050000000005 38.0 38.0 38.0 36.0 38.0 75-79 36.78975 38.0 38.0 38.0 36.0 38.0 80-84 36.783950000000004 38.0 38.0 38.0 36.0 38.0 85-89 36.7167 38.0 38.0 38.0 35.8 38.0 90-94 36.61225 38.0 38.0 38.0 35.2 38.0 95-99 36.50325 38.0 38.0 38.0 34.8 38.0 100-104 36.44625 38.0 38.0 38.0 34.6 38.0 105-109 36.4008 38.0 38.0 38.0 34.2 38.0 110-114 36.21535 38.0 38.0 38.0 34.0 38.0 115-119 35.979549999999996 38.0 38.0 38.0 33.4 38.0 120-124 35.766000000000005 38.0 37.4 38.0 32.4 38.0 125-129 35.56485 38.0 37.0 38.0 31.8 38.0 130-134 35.32940000000001 38.0 36.4 38.0 30.6 38.0 135-139 35.000099999999996 38.0 36.0 38.0 28.8 38.0 140-144 34.74945 38.0 36.0 38.0 28.6 38.0 145-149 34.2531 38.0 35.2 38.0 27.6 38.0 150-151 29.797874999999998 35.5 27.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 8.0 4 3.0 5 2.0 6 2.0 7 1.0 8 2.0 9 2.0 10 2.0 11 3.0 12 2.0 13 2.0 14 1.0 15 5.0 16 2.0 17 5.0 18 1.0 19 8.0 20 3.0 21 5.0 22 8.0 23 5.0 24 10.0 25 12.0 26 17.0 27 25.0 28 23.0 29 23.0 30 29.0 31 36.0 32 50.0 33 95.0 34 125.0 35 223.0 36 514.0 37 2742.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.275000000000006 16.025 17.299999999999997 29.4 2 24.8 21.95 35.725 17.525 3 20.849999999999998 26.775 31.874999999999996 20.5 4 24.125 34.300000000000004 22.175 19.400000000000002 5 23.799999999999997 35.65 23.0 17.549999999999997 6 17.95 38.95 23.7 19.400000000000002 7 18.075 17.150000000000002 44.0 20.775 8 21.45 21.275 28.325 28.95 9 22.35 24.4 28.825 24.425 10-14 22.985 28.720000000000002 26.515 21.78 15-19 22.305 28.365000000000002 27.74 21.59 20-24 22.93 28.939999999999998 27.384999999999998 20.745 25-29 23.300678221552374 28.746546093946247 27.525747299673448 20.427028384827935 30-34 22.773588750764215 28.846545750968005 27.022620745873244 21.35724475239454 35-39 22.889561270801813 28.30559757942511 28.068582955118508 20.736258194654564 40-44 22.865 28.249999999999996 27.76 21.125 45-49 23.044999999999998 28.23 27.915 20.810000000000002 50-54 23.06 28.544999999999998 27.765 20.630000000000003 55-59 23.36 28.165000000000003 27.74 20.735 60-64 23.28 28.065 28.22 20.435 65-69 22.945 28.57 27.834999999999997 20.65 70-74 23.265 28.895 27.49 20.349999999999998 75-79 23.51 27.54 27.825 21.125 80-84 23.880000000000003 27.825 27.900000000000002 20.395 85-89 23.200000000000003 27.99 27.775 21.035 90-94 23.575 29.020000000000003 27.805000000000003 19.6 95-99 23.745 27.860000000000003 28.075 20.32 100-104 23.82 28.515 27.650000000000002 20.015 105-109 23.57 28.449999999999996 28.12 19.86 110-114 24.05 28.09 27.425 20.435 115-119 24.39 27.975 27.250000000000004 20.385 120-124 23.9 27.805000000000003 27.61 20.685000000000002 125-129 24.415 28.415000000000003 27.185 19.985 130-134 24.224999999999998 28.134999999999998 27.47 20.169999999999998 135-139 23.785 28.57 27.705000000000002 19.939999999999998 140-144 23.93 28.694999999999997 27.384999999999998 19.99 145-149 24.305 28.494999999999997 26.939999999999998 20.26 150-151 24.9 28.050000000000004 28.249999999999996 18.8 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 1.0 18 1.0 19 0.5 20 0.5 21 0.0 22 0.0 23 0.5 24 1.0 25 2.5 26 3.0 27 2.0 28 5.5 29 6.5 30 7.5 31 12.0 32 15.0 33 25.5 34 43.5 35 61.5 36 80.0 37 101.5 38 138.5 39 184.5 40 208.0 41 242.5 42 287.0 43 303.5 44 298.0 45 308.0 46 295.5 47 255.0 48 238.5 49 192.5 50 149.5 51 134.5 52 103.0 53 72.0 54 59.0 55 43.5 56 27.0 57 27.5 58 21.5 59 9.0 60 8.0 61 7.5 62 3.5 63 1.5 64 2.0 65 2.5 66 1.5 67 1.0 68 1.0 69 1.0 70 1.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.475 30-34 1.8599999999999999 35-39 0.8500000000000001 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.175 #Duplication Level Percentage of deduplicated Percentage of total 1 99.26896899420217 98.45 2 0.6554071086463322 1.3 3 0.050415931434333254 0.15 4 0.025207965717166627 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.1375 0.0 0.0 0.0 0.0 94-95 0.175 0.0 0.0 0.0 0.0 96-97 0.225 0.0 0.0 0.0 0.0 98-99 0.275 0.0 0.0 0.0 0.0 100-101 0.32499999999999996 0.0 0.0 0.0 0.0 102-103 0.4625 0.0 0.0 0.0 0.0 104-105 0.5625 0.0 0.0 0.0 0.0 106-107 0.6125 0.0 0.0 0.0 0.0 108-109 0.6875 0.0 0.0 0.0 0.0 110-111 0.775 0.0 0.0 0.0 0.0 112-113 0.85 0.0 0.0 0.0 0.0 114-115 0.9375 0.0 0.0 0.0 0.0 116-117 1.0 0.0 0.0 0.0 0.0 118-119 1.15 0.0 0.0 0.0 0.0 120-121 1.3625 0.0 0.0 0.0 0.0 122-123 1.5750000000000002 0.0 0.0 0.0 0.0 124-125 1.7625 0.0 0.0 0.0 0.0 126-127 1.975 0.0 0.0 0.0 0.0 128-129 2.2125 0.0 0.0 0.0 0.0 130-131 2.5125 0.0 0.0 0.0 0.0 132-133 2.7 0.0 0.0 0.0 0.0 134-135 2.9625 0.0 0.0 0.0 0.0 136-137 3.175 0.0 0.0 0.0 0.0 138-139 3.4625000000000004 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTGGTAA 10 0.006846698 144.88751 9 >>END_MODULE Read 663466 spots for SRR7172717.sra Written 663466 spots for SRR7172717.sra Read 663466 spots for SRR7172717.sra Written 663466 spots for SRR7172717.sra Read 663466 spots for SRR7172717.sra Written 663466 spots for SRR7172717.sra Read 663466 spots for SRR7172717.sra Written 663466 spots for SRR7172717.sra Read 663466 spots for SRR7172717.sra Written 663466 spots for SRR7172717.sra Read 663466 spots for SRR7172717.sra Written 663466 spots for SRR7172717.sra Read 663466 spots for SRR7172717.sra Written 663466 spots for SRR7172717.sra Read 663466 spots for SRR7172717.sra Written 663466 spots for SRR7172717.sra Read 663466 spots for SRR7172717.sra Written 663466 spots for SRR7172717.sra Read 663466 spots for SRR7172717.sra Written 663466 spots for SRR7172717.sra Read 663466 spots for SRR7172717.sra Written 663466 spots for SRR7172717.sra Read 663466 spots for SRR7172717.sra Written 663466 spots for SRR7172717.sra Read 663466 spots for SRR7172717.sra Written 663466 spots for SRR7172717.sra Read 663466 spots for SRR7172717.sra Written 663466 spots for SRR7172717.sra Read 663466 spots for SRR7172717.sra Written 663466 spots for SRR7172717.sra Read 663466 spots for SRR7172717.sra Written 663466 spots for SRR7172717.sra Read 663466 spots for SRR7172717.sra Written 663466 spots for SRR7172717.sra Read 663466 spots for SRR7172717.sra Written 663466 spots for SRR7172717.sra Read 663466 spots for SRR7172717.sra Written 663466 spots for SRR7172717.sra Read 663467 spots for SRR7172717.sra Written 663467 spots for SRR7172717.sra SRR ids: ['SRR7172717.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_f5u66cst SRR7172717.sra spots: 13269321 blocks: [[1, 663466], [663467, 1326932], [1326933, 1990398], [1990399, 2653864], [2653865, 3317330], [3317331, 3980796], [3980797, 4644262], [4644263, 5307728], [5307729, 5971194], [5971195, 6634660], [6634661, 7298126], [7298127, 7961592], [7961593, 8625058], [8625059, 9288524], [9288525, 9951990], [9951991, 10615456], [10615457, 11278922], [11278923, 11942388], [11942389, 12605854], [12605855, 13269321]] SRR7172717 file size 4474837 SRR7172717 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172717 SRR7172717_1.fastq SRR7172717_2.fastq Input file: SRR7172717_1.fastq Paired file: SRR7172717_2.fastq trimmed: SRR7172717-trimmed-pair1.fastq, SRR7172717-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 14:52:11 2025 >> started Mon Feb 10 14:52:37 2025 >> done (25.572s) 13269321 read pairs processed; of these: 13688 ( 0.10%) short read pairs filtered out after trimming by size control 9304 ( 0.07%) empty read pairs filtered out after trimming by size control 13246329 (99.83%) read pairs available; of these: 5352121 (40.40%) trimmed read pairs available after processing 7894208 (59.60%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 20 3 0.00% 21 1 0.00% 22 3 0.00% 23 5 0.00% 24 2 0.00% 25 2 0.00% 26 1 0.00% 27 1 0.00% 28 1 0.00% 29 4 0.00% 30 2 0.00% 31 1 0.00% 32 3 0.00% 33 6 0.00% 34 3 0.00% 35 2 0.00% 36 1 0.00% 37 6 0.00% 38 6 0.00% 39 4 0.00% 40 2 0.00% 41 3 0.00% 42 1 0.00% 43 2 0.00% 44 4 0.00% 45 3 0.00% 46 6 0.00% 47 7 0.00% 48 12 0.00% 49 8 0.00% 50 8 0.00% 51 15 0.00% 52 16 0.00% 53 13 0.00% 54 12 0.00% 55 22 0.00% 56 11 0.00% 57 25 0.00% 58 38 0.00% 59 26 0.00% 60 32 0.00% 61 36 0.00% 62 44 0.00% 63 54 0.00% 64 64 0.00% 65 64 0.00% 66 76 0.00% 67 81 0.00% 68 87 0.00% 69 103 0.00% 70 111 0.00% 71 177 0.00% 72 185 0.00% 73 202 0.00% 74 212 0.00% 75 279 0.00% 76 299 0.00% 77 371 0.00% 78 422 0.00% 79 482 0.00% 80 482 0.00% 81 609 0.00% 82 702 0.01% 83 834 0.01% 84 1563 0.01% 85 2078 0.02% 86 2122 0.02% 87 2333 0.02% 88 2359 0.02% 89 2460 0.02% 90 2568 0.02% 91 2715 0.02% 92 3023 0.02% 93 3210 0.02% 94 3321 0.03% 95 3671 0.03% 96 3912 0.03% 97 4208 0.03% 98 4515 0.03% 99 4895 0.04% 100 5210 0.04% 101 5400 0.04% 102 5820 0.04% 103 6482 0.05% 104 6939 0.05% 105 7261 0.05% 106 7873 0.06% 107 8475 0.06% 108 8893 0.07% 109 9243 0.07% 110 10229 0.08% 111 10896 0.08% 112 11161 0.08% 113 12059 0.09% 114 12754 0.10% 115 13518 0.10% 116 14407 0.11% 117 15102 0.11% 118 15824 0.12% 119 16399 0.12% 120 17405 0.13% 121 18184 0.14% 122 18973 0.14% 123 19988 0.15% 124 21228 0.16% 125 22214 0.17% 126 23316 0.18% 127 24492 0.18% 128 25673 0.19% 129 26919 0.20% 130 27782 0.21% 131 29550 0.22% 132 31126 0.23% 133 33283 0.25% 134 34645 0.26% 135 36676 0.28% 136 39098 0.30% 137 41586 0.31% 138 44302 0.33% 139 47074 0.36% 140 50520 0.38% 141 55339 0.42% 142 60936 0.46% 143 67585 0.51% 144 77887 0.59% 145 92102 0.70% 146 115215 0.87% 147 153375 1.16% 148 234895 1.77% 149 572923 4.33% 150 3028633 22.86% 151 7894208 59.60% 13246329 reads passed initial QC criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=2.16 fanout-score-rank=33 prefix-density=0.19 prefix-fanout=2.1 sequence=CAGGTGCAGTTTGATCC criterion=fanout-score sequence-density=0.06 sequence-density-rank=24 fanout-score=451.47 fanout-score-rank=1 prefix-density=0.78 prefix-fanout=34.9 sequence=TCTTCTTCTTCCT criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=6.42 fanout-score-rank=18 prefix-density=0.39 prefix-fanout=4.0 sequence=CTGCAAATGTGG criterion=fanout-score sequence-density=0.09 sequence-density-rank=14 fanout-score=111.30 fanout-score-rank=1 prefix-density=0.47 prefix-fanout=21.3 sequence=GAAGAAGAGAGG SRR7172717 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 14:53:37 Started mapping on | Feb 10 14:53:38 Finished on | Feb 10 14:56:01 Mapping speed, Million of reads per hour | 333.47 Number of input reads | 13246329 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 12384886 Uniquely mapped reads % | 93.50% Average mapped length | 296.55 Number of splices: Total | 13031973 Number of splices: Annotated (sjdb) | 12822731 Number of splices: GT/AG | 12829248 Number of splices: GC/AG | 162820 Number of splices: AT/AC | 8807 Number of splices: Non-canonical | 31098 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.59 Insertion rate per base | 0.02% Insertion average length | 2.59 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 302860 % of reads mapped to multiple loci | 2.29% Number of reads mapped to too many loci | 25217 % of reads mapped to too many loci | 0.19% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.98% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 571747 571747 571747 N_multimapping 302860 302860 302860 N_noFeature 265603 12286259 302769 N_ambiguous 121210 581 59376 UnstrandedReadsAssigned:11998073 PositiveStrandReadsAssigned:98046 NegativeStrandReadsAssigned:12022741 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7172717 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172717-trimmed-pair1.fastq SRR7172717-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,246,329 reads, 11,918,844 reads pseudoaligned [quant] estimated average fragment length: 248.981 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,092 rounds 52401 SRR7172717.ke.tsv 34699 SRR7172717.se.tsv 87100 total ==> SRR7172717.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1770.02 731 33.8601 Potri.005G024800.1.v4.1 1035 787.019 138 14.3762 Potri.004G059700.1.v4.1 961 713.075 13 1.49471 Potri.007G009000.2.v4.1 1416 1168.02 0 0 Potri.003G141000.2.v4.1 2943 2695.02 414.274 12.603 Potri.016G087400.1.v4.1 270 74.5063 1015 1116.92 Potri.015G069301.1.v4.1 564 320.543 0 0 Potri.010G195200.1.v4.1 1773 1525.02 262 14.0856 Potri.012G127500.1.v4.1 977 729.04 4197 471.993 ==> SRR7172717.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 20 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 365 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 135 SRR7172717 completed mapping pipeline successfully