Starting /dee2/code/volunteer_pipeline.sh SRR7172718 current disk space = 3059097313280 free memory = 971495812 SRR7172718 SRAfilesize 24a9646db09201c434bf1e53cf221478 SRR7172718.sra SRR7172718.sra file validated SRR7172718 is paired end SRR7172718 is conventional basespace SRR7172718 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172718_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 23.50475 18.0 18.0 31.0 18.0 32.0 2 30.26825 31.0 29.0 33.0 27.0 33.0 3 31.70325 33.0 32.0 33.0 27.0 33.0 4 31.9525 33.0 32.0 33.0 30.0 33.0 5 32.5945 33.0 33.0 33.0 32.0 34.0 6 37.1145 38.0 37.0 38.0 36.0 38.0 7 37.4295 38.0 38.0 38.0 37.0 38.0 8 37.4225 38.0 38.0 38.0 37.0 38.0 9 37.48425 38.0 38.0 38.0 37.0 38.0 10-14 37.60415 38.0 38.0 38.0 38.0 38.0 15-19 37.5536 38.0 38.0 38.0 38.0 38.0 20-24 37.58050000000001 38.0 38.0 38.0 38.0 38.0 25-29 37.6342 38.0 38.0 38.0 38.0 38.0 30-34 37.59505 38.0 38.0 38.0 38.0 38.0 35-39 37.60055 38.0 38.0 38.0 38.0 38.0 40-44 37.56825 38.0 38.0 38.0 38.0 38.0 45-49 37.50625 38.0 38.0 38.0 38.0 38.0 50-54 37.416650000000004 38.0 38.0 38.0 37.2 38.0 55-59 37.3823 38.0 38.0 38.0 37.0 38.0 60-64 37.35115 38.0 38.0 38.0 37.0 38.0 65-69 37.243849999999995 38.0 38.0 38.0 37.0 38.0 70-74 37.247 38.0 38.0 38.0 36.8 38.0 75-79 37.11385 38.0 38.0 38.0 36.0 38.0 80-84 36.98085 38.0 38.0 38.0 36.0 38.0 85-89 36.922799999999995 38.0 38.0 38.0 35.6 38.0 90-94 36.99555 38.0 38.0 38.0 36.0 38.0 95-99 36.97325 38.0 38.0 38.0 36.0 38.0 100-104 36.82785 38.0 38.0 38.0 35.2 38.0 105-109 36.56455 38.0 38.0 38.0 34.2 38.0 110-114 36.35905 38.0 38.0 38.0 34.0 38.0 115-119 36.392199999999995 38.0 38.0 38.0 34.0 38.0 120-124 36.22445 38.0 37.2 38.0 33.6 38.0 125-129 35.9801 38.0 37.0 38.0 32.8 38.0 130-134 35.41715000000001 38.0 36.0 38.0 29.8 38.0 135-139 35.2211 38.0 35.8 38.0 28.8 38.0 140-144 35.0116 38.0 35.6 38.0 28.0 38.0 145-149 34.64725 38.0 35.2 38.0 28.2 38.0 150-151 30.9595 36.5 30.0 38.0 13.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 2.0 17 2.0 18 2.0 19 1.0 20 2.0 21 2.0 22 3.0 23 6.0 24 8.0 25 5.0 26 7.0 27 12.0 28 9.0 29 29.0 30 33.0 31 54.0 32 65.0 33 86.0 34 143.0 35 268.0 36 740.0 37 2521.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 30.88197480071998 14.785291848804318 13.0110568269478 41.3216765235279 2 18.106479156202912 19.688598694123556 38.90005022601707 23.304871923656453 3 20.65 24.75 25.4 29.2 4 21.125 33.650000000000006 21.15 24.075 5 20.349999999999998 34.699999999999996 26.0 18.95 6 16.725 36.925000000000004 25.674999999999997 20.674999999999997 7 12.325 23.200000000000003 45.625 18.85 8 18.55 22.8 30.349999999999998 28.299999999999997 9 18.05 23.45 32.7 25.8 10-14 19.13 29.915000000000003 26.96 23.995 15-19 19.5 28.665000000000003 28.04 23.794999999999998 20-24 19.485 28.470000000000002 27.705000000000002 24.34 25-29 19.165 29.24 27.985 23.61 30-34 19.865 28.92 28.175 23.04 35-39 20.150000000000002 28.275 27.595 23.98 40-44 19.525000000000002 28.389999999999997 28.065 24.02 45-49 19.655 29.244999999999997 27.794999999999998 23.305 50-54 19.905 28.1 28.23 23.765 55-59 20.31 27.605 28.005000000000003 24.08 60-64 19.845 28.249999999999996 27.96 23.945 65-69 19.865 28.51 27.685 23.94 70-74 20.22 28.13 27.965 23.685000000000002 75-79 19.31 28.305000000000003 27.944999999999997 24.44 80-84 20.01 28.38 27.955000000000002 23.655 85-89 19.575 28.275 28.144999999999996 24.005000000000003 90-94 19.765 28.285 27.575 24.375 95-99 20.555 27.83 28.235 23.380000000000003 100-104 20.505000000000003 27.825 27.815 23.855 105-109 19.99 28.175 27.87 23.965 110-114 20.49 27.794999999999998 27.779999999999998 23.935000000000002 115-119 20.355 28.525 26.779999999999998 24.34 120-124 20.695 28.43 27.084999999999997 23.79 125-129 20.724999999999998 28.62 27.045 23.61 130-134 20.375 28.725 26.96 23.94 135-139 20.625 27.644999999999996 27.529999999999998 24.2 140-144 21.01 27.93 26.924999999999997 24.135 145-149 20.925 28.32 27.339999999999996 23.415 150-151 20.5375 27.450000000000003 26.987499999999997 25.025 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.5 21 1.0 22 1.5 23 2.5 24 1.5 25 1.0 26 5.0 27 13.0 28 19.5 29 20.5 30 22.5 31 26.5 32 28.5 33 42.5 34 55.5 35 76.5 36 98.0 37 113.0 38 139.5 39 156.0 40 184.0 41 218.5 42 249.5 43 269.5 44 277.0 45 283.0 46 271.5 47 253.0 48 231.5 49 197.0 50 163.0 51 130.5 52 108.5 53 87.5 54 63.0 55 51.5 56 35.0 57 20.0 58 18.5 59 16.0 60 9.5 61 10.0 62 9.0 63 4.5 64 2.5 65 2.0 66 2.0 67 3.0 68 1.5 69 0.0 70 0.0 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.775 2 0.44999999999999996 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.75 #Duplication Level Percentage of deduplicated Percentage of total 1 99.74937343358395 99.5 2 0.2506265664160401 0.5 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.1125 0.0 0.0 0.0 0.0 92-93 0.1375 0.0 0.0 0.0 0.0 94-95 0.16249999999999998 0.0 0.0 0.0 0.0 96-97 0.21250000000000002 0.0 0.0 0.0 0.0 98-99 0.2625 0.0 0.0 0.0 0.0 100-101 0.2875 0.0 0.0 0.0 0.0 102-103 0.35 0.0 0.0 0.0 0.0 104-105 0.4375 0.0 0.0 0.0 0.0 106-107 0.5625 0.0 0.0 0.0 0.0 108-109 0.65 0.0 0.0 0.0 0.0 110-111 0.75 0.0 0.0 0.0 0.0 112-113 0.925 0.0 0.0 0.0 0.0 114-115 1.0875 0.0 0.0 0.0 0.0 116-117 1.2125 0.0 0.0 0.0 0.0 118-119 1.4375 0.0 0.0 0.0 0.0 120-121 1.75 0.0 0.0 0.0 0.0 122-123 1.95 0.0 0.0 0.0 0.0 124-125 2.3499999999999996 0.0 0.0 0.0 0.0 126-127 2.7125 0.0 0.0 0.0 0.0 128-129 3.0875000000000004 0.0 0.0 0.0 0.0 130-131 3.6125 0.0 0.0 0.0 0.0 132-133 3.9499999999999997 0.0 0.0 0.0 0.0 134-135 4.4625 0.0 0.0 0.0 0.0 136-137 4.987500000000001 0.0 0.0 0.0 0.0 138-139 5.3875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CGGTTGT 10 0.0068343505 144.975 3 >>END_MODULE SRR7172718 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172718_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.09975 34.0 33.0 34.0 33.0 34.0 2 33.168 34.0 33.0 34.0 33.0 34.0 3 33.1815 34.0 33.0 34.0 33.0 34.0 4 33.17325 34.0 33.0 34.0 33.0 34.0 5 33.07375 34.0 33.0 34.0 33.0 34.0 6 37.2055 38.0 38.0 38.0 37.0 38.0 7 37.19175 38.0 38.0 38.0 37.0 38.0 8 37.32 38.0 38.0 38.0 38.0 38.0 9 37.28075 38.0 38.0 38.0 38.0 38.0 10-14 37.225750000000005 38.0 38.0 38.0 37.4 38.0 15-19 37.27955 38.0 38.0 38.0 37.4 38.0 20-24 37.287 38.0 38.0 38.0 37.6 38.0 25-29 37.15835 38.0 38.0 38.0 37.2 38.0 30-34 36.508950000000006 38.0 38.0 38.0 36.4 38.0 35-39 36.78345 38.0 38.0 38.0 36.6 38.0 40-44 37.157599999999995 38.0 38.0 38.0 37.0 38.0 45-49 37.17370000000001 38.0 38.0 38.0 37.0 38.0 50-54 37.08635 38.0 38.0 38.0 37.0 38.0 55-59 37.05605 38.0 38.0 38.0 37.0 38.0 60-64 36.8305 38.0 38.0 38.0 36.0 38.0 65-69 36.64535 38.0 38.0 38.0 35.2 38.0 70-74 36.7602 38.0 38.0 38.0 35.8 38.0 75-79 36.75575 38.0 38.0 38.0 35.6 38.0 80-84 36.7379 38.0 38.0 38.0 35.8 38.0 85-89 36.6653 38.0 38.0 38.0 35.2 38.0 90-94 36.58895 38.0 38.0 38.0 35.0 38.0 95-99 36.5364 38.0 38.0 38.0 34.6 38.0 100-104 36.3602 38.0 38.0 38.0 34.0 38.0 105-109 36.258 38.0 38.0 38.0 34.0 38.0 110-114 36.12155 38.0 38.0 38.0 33.8 38.0 115-119 35.905699999999996 38.0 37.6 38.0 32.8 38.0 120-124 35.628499999999995 38.0 37.0 38.0 31.4 38.0 125-129 35.4474 38.0 36.6 38.0 30.8 38.0 130-134 35.0334 38.0 36.0 38.0 28.4 38.0 135-139 34.665350000000004 38.0 35.0 38.0 27.4 38.0 140-144 34.23715 38.0 34.8 38.0 25.8 38.0 145-149 33.29305000000001 38.0 33.2 38.0 18.4 38.0 150-151 28.621375 35.0 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 9.0 3 2.0 4 1.0 5 1.0 6 2.0 7 4.0 8 2.0 9 0.0 10 1.0 11 1.0 12 1.0 13 2.0 14 3.0 15 1.0 16 3.0 17 3.0 18 4.0 19 3.0 20 4.0 21 6.0 22 4.0 23 11.0 24 7.0 25 12.0 26 17.0 27 20.0 28 31.0 29 34.0 30 49.0 31 51.0 32 67.0 33 92.0 34 143.0 35 292.0 36 579.0 37 2538.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.150000000000006 16.1 17.675 32.074999999999996 2 22.05 22.875 38.75 16.325 3 22.375 25.924999999999997 31.025000000000002 20.674999999999997 4 25.15 33.775 21.55 19.525000000000002 5 25.775 35.425000000000004 21.375 17.424999999999997 6 19.6 39.65 22.725 18.025 7 18.375 18.25 42.9 20.474999999999998 8 22.0 21.3 27.85 28.849999999999998 9 24.25 24.375 29.2 22.175 10-14 23.78 28.425 26.795 21.0 15-19 23.585 27.975 27.889999999999997 20.549999999999997 20-24 23.465 28.58 27.72 20.235 25-29 23.50637614218295 28.97881313384878 26.819961843558595 20.69484888040968 30-34 23.463344905043904 27.88441903206045 27.98141719420053 20.67081886869512 35-39 24.510792818236837 27.60238047205971 27.425862416784348 20.460964292919105 40-44 23.895 28.115000000000002 27.555000000000003 20.435 45-49 23.715 28.134999999999998 27.515 20.635 50-54 23.599999999999998 27.915 27.345000000000002 21.14 55-59 23.325000000000003 28.410000000000004 27.689999999999998 20.575 60-64 23.74 28.410000000000004 27.245 20.605 65-69 24.14 27.72 27.529999999999998 20.61 70-74 23.724999999999998 27.894999999999996 28.000000000000004 20.380000000000003 75-79 23.915 27.79 27.32 20.974999999999998 80-84 23.91 27.650000000000002 28.26 20.18 85-89 23.86 27.915 28.16 20.064999999999998 90-94 23.62 27.939999999999998 27.955000000000002 20.485 95-99 23.97 28.395 27.49 20.145 100-104 23.549999999999997 27.71 27.855 20.885 105-109 23.765 28.205000000000002 27.839999999999996 20.19 110-114 24.055 27.965 27.534999999999997 20.445 115-119 23.56 28.465 27.435 20.54 120-124 24.240000000000002 27.515 27.52 20.724999999999998 125-129 24.154999999999998 27.96 27.950000000000003 19.935 130-134 24.515 28.52 27.115000000000002 19.85 135-139 24.6 28.335 27.04 20.025000000000002 140-144 25.15 28.03 27.474999999999998 19.345000000000002 145-149 25.16 28.54 27.01 19.29 150-151 26.487500000000004 27.875 26.900000000000002 18.7375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.5 26 4.5 27 5.0 28 6.5 29 11.0 30 14.0 31 19.0 32 18.0 33 25.0 34 37.0 35 50.5 36 74.5 37 99.5 38 125.0 39 156.5 40 201.5 41 256.5 42 275.5 43 278.0 44 287.5 45 293.5 46 282.5 47 252.5 48 241.5 49 212.5 50 168.0 51 126.5 52 96.5 53 88.5 54 72.0 55 53.0 56 42.0 57 32.5 58 24.5 59 15.0 60 10.5 61 11.0 62 8.5 63 5.0 64 5.0 65 3.5 66 0.5 67 2.0 68 2.0 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.41000000000000003 30-34 2.06 35-39 0.86 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67394030599448 99.35000000000001 2 0.32605969400551793 0.65 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0125 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.0875 0.0 0.0 0.0 0.0 92-93 0.1125 0.0 0.0 0.0 0.0 94-95 0.1375 0.0 0.0 0.0 0.0 96-97 0.16249999999999998 0.0 0.0 0.0 0.0 98-99 0.21250000000000002 0.0 0.0 0.0 0.0 100-101 0.2375 0.0 0.0 0.0 0.0 102-103 0.30000000000000004 0.0 0.0 0.0 0.0 104-105 0.38749999999999996 0.0 0.0 0.0 0.0 106-107 0.5125 0.0 0.0 0.0 0.0 108-109 0.6 0.0 0.0 0.0 0.0 110-111 0.7 0.0 0.0 0.0 0.0 112-113 0.875 0.0 0.0 0.0 0.0 114-115 1.0375 0.0 0.0 0.0 0.0 116-117 1.1625 0.0 0.0 0.0 0.0 118-119 1.3875 0.0 0.0 0.0 0.0 120-121 1.7 0.0 0.0 0.0 0.0 122-123 1.9125 0.0 0.0 0.0 0.0 124-125 2.325 0.0 0.0 0.0 0.0 126-127 2.7 0.0 0.0 0.0 0.0 128-129 3.1 0.0 0.0 0.0 0.0 130-131 3.6375 0.0 0.0 0.0 0.0 132-133 3.975 0.0 0.0 0.0 0.0 134-135 4.5125 0.0 0.0 0.0 0.0 136-137 5.0375 0.0 0.0 0.0 0.0 138-139 5.4375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTAATGG 10 0.006862618 144.77501 7 >>END_MODULE Read 800348 spots for SRR7172718.sra Written 800348 spots for SRR7172718.sra Read 800348 spots for SRR7172718.sra Written 800348 spots for SRR7172718.sra Read 800348 spots for SRR7172718.sra Written 800348 spots for SRR7172718.sra Read 800348 spots for SRR7172718.sra Written 800348 spots for SRR7172718.sra Read 800348 spots for SRR7172718.sra Written 800348 spots for SRR7172718.sra Read 800348 spots for SRR7172718.sra Written 800348 spots for SRR7172718.sra Read 800348 spots for SRR7172718.sra Written 800348 spots for SRR7172718.sra Read 800348 spots for SRR7172718.sra Written 800348 spots for SRR7172718.sra Read 800348 spots for SRR7172718.sra Written 800348 spots for SRR7172718.sra Read 800348 spots for SRR7172718.sra Written 800348 spots for SRR7172718.sra Read 800348 spots for SRR7172718.sra Written 800348 spots for SRR7172718.sra Read 800348 spots for SRR7172718.sra Written 800348 spots for SRR7172718.sra Read 800348 spots for SRR7172718.sra Written 800348 spots for SRR7172718.sra Read 800349 spots for SRR7172718.sra Written 800349 spots for SRR7172718.sra Read 800348 spots for SRR7172718.sra Written 800348 spots for SRR7172718.sra Read 800348 spots for SRR7172718.sra Written 800348 spots for SRR7172718.sra Read 800348 spots for SRR7172718.sra Written 800348 spots for SRR7172718.sra Read 800348 spots for SRR7172718.sra Written 800348 spots for SRR7172718.sra Read 800348 spots for SRR7172718.sra Written 800348 spots for SRR7172718.sra Read 800348 spots for SRR7172718.sra Written 800348 spots for SRR7172718.sra SRR ids: ['SRR7172718.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_mzkr4e_h SRR7172718.sra spots: 16006961 blocks: [[1, 800348], [800349, 1600696], [1600697, 2401044], [2401045, 3201392], [3201393, 4001740], [4001741, 4802088], [4802089, 5602436], [5602437, 6402784], [6402785, 7203132], [7203133, 8003480], [8003481, 8803828], [8803829, 9604176], [9604177, 10404524], [10404525, 11204872], [11204873, 12005220], [12005221, 12805568], [12805569, 13605916], [13605917, 14406264], [14406265, 15206612], [15206613, 16006961]] SRR7172718 file size 5402533 SRR7172718 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172718 SRR7172718_1.fastq SRR7172718_2.fastq Input file: SRR7172718_1.fastq Paired file: SRR7172718_2.fastq trimmed: SRR7172718-trimmed-pair1.fastq, SRR7172718-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 15:04:08 2025 >> started Mon Feb 10 15:04:27 2025 >> done (18.761s) 16006961 read pairs processed; of these: 15548 ( 0.10%) short read pairs filtered out after trimming by size control 14169 ( 0.09%) empty read pairs filtered out after trimming by size control 15977244 (99.81%) read pairs available; of these: 6420150 (40.18%) trimmed read pairs available after processing 9557094 (59.82%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 1 0.00% 20 2 0.00% 21 3 0.00% 22 1 0.00% 23 3 0.00% 24 2 0.00% 25 1 0.00% 26 3 0.00% 27 0 0.00% 28 4 0.00% 29 1 0.00% 30 0 0.00% 31 2 0.00% 32 1 0.00% 33 0 0.00% 34 6 0.00% 35 0 0.00% 36 1 0.00% 37 2 0.00% 38 1 0.00% 39 2 0.00% 40 1 0.00% 41 4 0.00% 42 3 0.00% 43 3 0.00% 44 3 0.00% 45 3 0.00% 46 6 0.00% 47 14 0.00% 48 6 0.00% 49 11 0.00% 50 4 0.00% 51 13 0.00% 52 17 0.00% 53 18 0.00% 54 18 0.00% 55 23 0.00% 56 24 0.00% 57 28 0.00% 58 31 0.00% 59 26 0.00% 60 31 0.00% 61 51 0.00% 62 62 0.00% 63 49 0.00% 64 67 0.00% 65 82 0.00% 66 74 0.00% 67 115 0.00% 68 105 0.00% 69 134 0.00% 70 149 0.00% 71 182 0.00% 72 199 0.00% 73 235 0.00% 74 282 0.00% 75 345 0.00% 76 395 0.00% 77 438 0.00% 78 503 0.00% 79 604 0.00% 80 649 0.00% 81 755 0.00% 82 898 0.01% 83 1044 0.01% 84 1950 0.01% 85 2460 0.02% 86 2659 0.02% 87 2864 0.02% 88 2970 0.02% 89 3146 0.02% 90 3349 0.02% 91 3537 0.02% 92 3750 0.02% 93 4231 0.03% 94 4423 0.03% 95 4718 0.03% 96 5232 0.03% 97 5618 0.04% 98 6095 0.04% 99 6600 0.04% 100 7169 0.04% 101 7517 0.05% 102 8254 0.05% 103 8881 0.06% 104 9566 0.06% 105 10410 0.07% 106 11084 0.07% 107 11939 0.07% 108 12473 0.08% 109 13292 0.08% 110 14243 0.09% 111 15083 0.09% 112 15700 0.10% 113 16888 0.11% 114 18261 0.11% 115 19590 0.12% 116 20329 0.13% 117 21242 0.13% 118 22623 0.14% 119 23376 0.15% 120 24379 0.15% 121 25815 0.16% 122 27284 0.17% 123 28420 0.18% 124 29987 0.19% 125 31342 0.20% 126 33075 0.21% 127 34970 0.22% 128 36219 0.23% 129 38077 0.24% 130 39587 0.25% 131 41530 0.26% 132 43716 0.27% 133 45962 0.29% 134 48521 0.30% 135 50740 0.32% 136 53519 0.33% 137 57071 0.36% 138 60819 0.38% 139 64862 0.41% 140 69922 0.44% 141 74944 0.47% 142 82268 0.51% 143 90738 0.57% 144 103078 0.65% 145 120978 0.76% 146 149197 0.93% 147 200467 1.25% 148 315727 1.98% 149 595311 3.73% 150 3442363 21.55% 151 9557094 59.82% 15977244 reads passed initial QC criterion=sequence-density sequence-density=0.36 sequence-density-rank=1 fanout-score=3.02 fanout-score-rank=24 prefix-density=0.52 prefix-fanout=2.1 sequence=CACTTGCAGCCATTCTCAGCACC criterion=fanout-score sequence-density=0.02 sequence-density-rank=30 fanout-score=114.18 fanout-score-rank=1 prefix-density=0.18 prefix-fanout=11.9 sequence=CCTTGAAGAAAAACATTACGATTATTACATTACATGCGCAATTGGGATAAAAAGGCCCTTGAAGAAATACACGTCACTGTTATAGCACGCGCTTACTTATAGGTACAAATGCACAAAAGGCCAACACGGAGAAAATGGAACAAACTGGGCTTGATTTTCATCTTTAATACATCATCAAATGGCCAAAAGTAAAGCATCACAATCATCACTTCTTGAAAGGAATGGCTCT criterion=sequence-density sequence-density=0.46 sequence-density-rank=1 fanout-score=2.59 fanout-score-rank=30 prefix-density=0.46 prefix-fanout=2.6 sequence=ATGTACCCTGACTTAGGTTTCTCAGA criterion=fanout-score sequence-density=0.04 sequence-density-rank=33 fanout-score=46.04 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=8.7 sequence=GGTGCTGGTGTGGTGAAAGGATTTTACGGGAAAACAAACTACGAGTTGCATAATGGTGGTGCCAATATGGTCGCTCATGGTTACACCAAAGGTGATGGCCTTGGTGCTGAGATTGTTGGCACTTTT SRR7172718 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 15:05:18 Started mapping on | Feb 10 15:05:18 Finished on | Feb 10 15:07:57 Mapping speed, Million of reads per hour | 361.75 Number of input reads | 15977244 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 14755930 Uniquely mapped reads % | 92.36% Average mapped length | 296.08 Number of splices: Total | 14710469 Number of splices: Annotated (sjdb) | 14443944 Number of splices: GT/AG | 14486714 Number of splices: GC/AG | 174113 Number of splices: AT/AC | 10281 Number of splices: Non-canonical | 39361 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.58 Insertion rate per base | 0.02% Insertion average length | 2.59 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 343630 % of reads mapped to multiple loci | 2.15% Number of reads mapped to too many loci | 60511 % of reads mapped to too many loci | 0.38% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.02% % of reads unmapped: other | 0.09% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 890865 890865 890865 N_multimapping 343630 343630 343630 N_noFeature 355421 14620926 401498 N_ambiguous 158492 729 69153 UnstrandedReadsAssigned:14242017 PositiveStrandReadsAssigned:134275 NegativeStrandReadsAssigned:14285279 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7172718 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172718-trimmed-pair1.fastq SRR7172718-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,977,244 reads, 14,171,734 reads pseudoaligned [quant] estimated average fragment length: 236.665 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,122 rounds 52401 SRR7172718.ke.tsv 34699 SRR7172718.se.tsv 87100 total ==> SRR7172718.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1782.33 1660 58.31 Potri.005G024800.1.v4.1 1035 799.335 1119 87.6446 Potri.004G059700.1.v4.1 961 725.355 19 1.63994 Potri.007G009000.2.v4.1 1416 1180.33 0 0 Potri.003G141000.2.v4.1 2943 2707.33 739.444 17.0996 Potri.016G087400.1.v4.1 270 77.5021 1453 1173.75 Potri.015G069301.1.v4.1 564 330.99 0 0 Potri.010G195200.1.v4.1 1773 1537.33 461.753 18.8046 Potri.012G127500.1.v4.1 977 741.34 4302 363.31 ==> SRR7172718.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 9 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 459 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 3 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 104 SRR7172718 completed mapping pipeline successfully