Starting /dee2/code/volunteer_pipeline.sh SRR7172719 current disk space = 3059176767488 free memory = 1008855120 SRR7172719 SRAfilesize b002950f4314cd7e1d8bdaf1ea55a62b SRR7172719.sra SRR7172719.sra file validated SRR7172719 is paired end SRR7172719 is conventional basespace SRR7172719 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172719_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.83325 33.0 33.0 33.0 31.0 34.0 2 32.45225 33.0 33.0 34.0 32.0 34.0 3 31.8025 33.0 32.0 33.0 28.0 34.0 4 31.34075 33.0 31.0 33.0 29.0 33.0 5 32.371 33.0 33.0 33.0 32.0 34.0 6 36.99425 38.0 37.0 38.0 36.0 38.0 7 37.4635 38.0 38.0 38.0 37.0 38.0 8 37.549 38.0 38.0 38.0 37.0 38.0 9 37.54825 38.0 38.0 38.0 38.0 38.0 10-14 37.6209 38.0 38.0 38.0 38.0 38.0 15-19 37.65565 38.0 38.0 38.0 38.0 38.0 20-24 37.55735 38.0 38.0 38.0 38.0 38.0 25-29 37.60195 38.0 38.0 38.0 38.0 38.0 30-34 37.5581 38.0 38.0 38.0 38.0 38.0 35-39 37.52885 38.0 38.0 38.0 38.0 38.0 40-44 37.452450000000006 38.0 38.0 38.0 37.8 38.0 45-49 37.4736 38.0 38.0 38.0 38.0 38.0 50-54 37.416149999999995 38.0 38.0 38.0 37.2 38.0 55-59 37.29245 38.0 38.0 38.0 37.0 38.0 60-64 37.26955 38.0 38.0 38.0 37.0 38.0 65-69 37.20125 38.0 38.0 38.0 36.8 38.0 70-74 37.0303 38.0 38.0 38.0 36.2 38.0 75-79 37.07025 38.0 38.0 38.0 36.0 38.0 80-84 36.98800000000001 38.0 38.0 38.0 36.0 38.0 85-89 36.71485 38.0 38.0 38.0 35.0 38.0 90-94 36.81570000000001 38.0 38.0 38.0 35.4 38.0 95-99 36.833000000000006 38.0 38.0 38.0 35.2 38.0 100-104 36.719500000000004 38.0 38.0 38.0 34.8 38.0 105-109 36.34655 38.0 38.0 38.0 34.0 38.0 110-114 36.18235 38.0 37.8 38.0 33.0 38.0 115-119 36.109249999999996 38.0 37.4 38.0 33.2 38.0 120-124 36.1985 38.0 37.8 38.0 33.8 38.0 125-129 36.01065 38.0 37.2 38.0 32.8 38.0 130-134 35.613600000000005 38.0 36.2 38.0 31.0 38.0 135-139 35.24805 38.0 36.0 38.0 28.6 38.0 140-144 35.30575 38.0 36.0 38.0 30.6 38.0 145-149 34.9957 38.0 35.8 38.0 30.0 38.0 150-151 31.59025 36.5 31.5 38.0 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 5 1.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 1.0 12 0.0 13 0.0 14 1.0 15 0.0 16 0.0 17 1.0 18 2.0 19 3.0 20 2.0 21 1.0 22 4.0 23 2.0 24 3.0 25 5.0 26 11.0 27 21.0 28 27.0 29 28.0 30 38.0 31 58.0 32 61.0 33 99.0 34 133.0 35 239.0 36 559.0 37 2700.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.49478769387236 13.704551233155351 11.899313501144166 35.90134757182812 2 19.944737503139915 21.10022607385079 38.83446370258729 20.120572720422008 3 20.0 26.424999999999997 27.0 26.575 4 23.25 33.050000000000004 22.900000000000002 20.8 5 21.925 35.875 23.425 18.775 6 17.424999999999997 36.25 25.55 20.775 7 13.525 23.599999999999998 44.025 18.85 8 17.825 22.650000000000002 30.2 29.325000000000003 9 18.4 21.675 32.2 27.725 10-14 19.66 29.315 26.85 24.175 15-19 20.07 27.71 28.515 23.705000000000002 20-24 19.325 28.235 28.060000000000002 24.38 25-29 19.67 28.005000000000003 28.16 24.165 30-34 20.005 28.29 28.105000000000004 23.599999999999998 35-39 19.814999999999998 28.095 28.044999999999998 24.044999999999998 40-44 20.055 28.405 27.689999999999998 23.849999999999998 45-49 19.3 28.405 28.04 24.255 50-54 19.49 28.665000000000003 28.065 23.78 55-59 20.04 28.08 28.199999999999996 23.68 60-64 19.41 28.345 27.810000000000002 24.435000000000002 65-69 19.875 28.16 27.36 24.605 70-74 19.755 28.665000000000003 28.15 23.43 75-79 20.13 27.735 27.944999999999997 24.19 80-84 20.215 28.235 27.794999999999998 23.755000000000003 85-89 20.005 28.189999999999998 28.185 23.62 90-94 20.385 28.03 27.575 24.01 95-99 20.25 28.15 28.110000000000003 23.49 100-104 19.68 28.38 27.62 24.32 105-109 20.025000000000002 28.175 28.33 23.47 110-114 20.236129871429288 28.080444244334384 28.035419480714392 23.648006403521936 115-119 20.275000000000002 28.225 27.750000000000004 23.75 120-124 20.01 28.765 27.205000000000002 24.02 125-129 20.669999999999998 28.194999999999997 27.67 23.465 130-134 20.385 28.465 27.034999999999997 24.115000000000002 135-139 20.19 28.044999999999998 27.779999999999998 23.985 140-144 20.794999999999998 27.925 27.71 23.57 145-149 20.565 28.32 27.644999999999996 23.47 150-151 21.1375 27.437499999999996 26.637499999999996 24.7875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.0 20 1.0 21 2.0 22 1.0 23 0.0 24 0.5 25 2.0 26 5.0 27 7.0 28 7.0 29 11.5 30 16.5 31 18.5 32 27.0 33 38.5 34 46.5 35 61.0 36 82.5 37 99.0 38 124.5 39 148.0 40 195.5 41 244.0 42 273.0 43 296.0 44 301.5 45 298.0 46 278.5 47 251.0 48 240.5 49 214.0 50 172.5 51 133.5 52 97.0 53 80.0 54 59.0 55 44.5 56 35.5 57 25.5 58 14.5 59 11.0 60 10.0 61 7.5 62 5.0 63 2.5 64 1.5 65 3.5 66 3.0 67 0.5 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.675 2 0.475 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.055 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.4 #Duplication Level Percentage of deduplicated Percentage of total 1 99.3963782696177 98.8 2 0.6036217303822937 1.2 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0125 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.0625 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.1875 0.0 0.0 0.0 0.0 96-97 0.25 0.0 0.0 0.0 0.0 98-99 0.3125 0.0 0.0 0.0 0.0 100-101 0.35 0.0 0.0 0.0 0.0 102-103 0.375 0.0 0.0 0.0 0.0 104-105 0.475 0.0 0.0 0.0 0.0 106-107 0.5874999999999999 0.0 0.0 0.0 0.0 108-109 0.6625000000000001 0.0 0.0 0.0 0.0 110-111 0.775 0.0 0.0 0.0 0.0 112-113 0.825 0.0 0.0 0.0 0.0 114-115 0.9625 0.0 0.0 0.0 0.0 116-117 1.2 0.0 0.0 0.0 0.0 118-119 1.3625 0.0 0.0 0.0 0.0 120-121 1.6375000000000002 0.0 0.0 0.0 0.0 122-123 1.875 0.0 0.0 0.0 0.0 124-125 2.0875000000000004 0.0 0.0 0.0 0.0 126-127 2.2625 0.0 0.0 0.0 0.0 128-129 2.55 0.0 0.0 0.0 0.0 130-131 2.75 0.0 0.0 0.0125 0.0 132-133 3.0125 0.0 0.0 0.025 0.0 134-135 3.3125 0.0 0.0 0.025 0.0 136-137 3.575 0.0 0.0 0.025 0.0 138-139 3.9625000000000004 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTTCCC 10 0.006832588 144.9875 7 >>END_MODULE SRR7172719 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7172719_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.144 34.0 33.0 34.0 32.0 34.0 2 33.1775 34.0 33.0 34.0 33.0 34.0 3 33.2295 34.0 33.0 34.0 33.0 34.0 4 33.18075 34.0 33.0 34.0 33.0 34.0 5 33.132 34.0 33.0 34.0 33.0 34.0 6 37.265 38.0 38.0 38.0 38.0 38.0 7 37.2955 38.0 38.0 38.0 38.0 38.0 8 37.2545 38.0 38.0 38.0 38.0 38.0 9 37.23025 38.0 38.0 38.0 37.0 38.0 10-14 37.2421 38.0 38.0 38.0 37.2 38.0 15-19 37.2111 38.0 38.0 38.0 37.4 38.0 20-24 37.210550000000005 38.0 38.0 38.0 37.6 38.0 25-29 36.95935 38.0 38.0 38.0 37.0 38.0 30-34 36.374 38.0 38.0 38.0 36.4 38.0 35-39 36.571600000000004 38.0 38.0 38.0 36.2 38.0 40-44 37.036249999999995 38.0 38.0 38.0 37.0 38.0 45-49 37.07185 38.0 38.0 38.0 37.0 38.0 50-54 37.089349999999996 38.0 38.0 38.0 37.0 38.0 55-59 36.9331 38.0 38.0 38.0 36.6 38.0 60-64 36.85875 38.0 38.0 38.0 36.0 38.0 65-69 36.76255 38.0 38.0 38.0 36.0 38.0 70-74 36.7504 38.0 38.0 38.0 36.0 38.0 75-79 36.64445 38.0 38.0 38.0 35.6 38.0 80-84 36.67565 38.0 38.0 38.0 35.8 38.0 85-89 36.665800000000004 38.0 38.0 38.0 35.6 38.0 90-94 36.50685 38.0 38.0 38.0 35.0 38.0 95-99 36.444599999999994 38.0 38.0 38.0 34.8 38.0 100-104 36.34565 38.0 38.0 38.0 34.2 38.0 105-109 36.290949999999995 38.0 38.0 38.0 34.0 38.0 110-114 36.11665 38.0 38.0 38.0 34.0 38.0 115-119 35.933099999999996 38.0 37.8 38.0 33.0 38.0 120-124 35.635149999999996 38.0 37.2 38.0 31.6 38.0 125-129 35.40304999999999 38.0 37.0 38.0 31.0 38.0 130-134 35.10215 38.0 36.0 38.0 28.8 38.0 135-139 34.965050000000005 38.0 36.0 38.0 28.6 38.0 140-144 34.4183 38.0 35.6 38.0 26.4 38.0 145-149 33.5938 38.0 33.0 38.0 21.2 38.0 150-151 29.2605 35.5 27.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 7.0 3 5.0 4 5.0 5 3.0 6 1.0 7 4.0 8 1.0 9 4.0 10 1.0 11 1.0 12 0.0 13 2.0 14 3.0 15 4.0 16 3.0 17 3.0 18 5.0 19 3.0 20 8.0 21 9.0 22 5.0 23 7.0 24 9.0 25 9.0 26 18.0 27 17.0 28 21.0 29 32.0 30 41.0 31 47.0 32 61.0 33 94.0 34 153.0 35 254.0 36 504.0 37 2656.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.35 15.275 16.0 29.375 2 24.2 23.5 34.75 17.549999999999997 3 20.275000000000002 25.474999999999998 33.125 21.125 4 23.799999999999997 35.025 22.25 18.925 5 23.200000000000003 36.875 22.1 17.825 6 18.85 37.775 23.075000000000003 20.3 7 18.725 16.275000000000002 42.9 22.1 8 20.775 23.125 28.125 27.975 9 21.875 23.974999999999998 29.225 24.925 10-14 23.330000000000002 28.205000000000002 26.939999999999998 21.525 15-19 23.145 28.215 27.48 21.16 20-24 23.16 28.33 27.33 21.18 25-29 22.820783662793623 28.861727277299938 27.44831748905991 20.869171570846536 30-34 23.35375191424196 28.611536498213376 27.616130678917816 20.41858090862685 35-39 22.719240672489523 28.600999646589592 27.42969657191902 21.250063109001868 40-44 23.04 28.325 27.765 20.87 45-49 23.48 28.595 27.279999999999998 20.645 50-54 23.405 27.99 27.800000000000004 20.805 55-59 23.3 28.410000000000004 27.815 20.474999999999998 60-64 23.23 28.33 27.63 20.810000000000002 65-69 23.215 28.465 27.584999999999997 20.735 70-74 23.880000000000003 27.68 27.905 20.535 75-79 23.400000000000002 28.194999999999997 28.09 20.315 80-84 23.5 28.470000000000002 27.900000000000002 20.13 85-89 23.75 27.925 27.91 20.415 90-94 23.799999999999997 27.68 27.839999999999996 20.68 95-99 23.455000000000002 28.03 28.405 20.11 100-104 24.169999999999998 27.625 28.07 20.135 105-109 23.65 27.54 28.735 20.075000000000003 110-114 23.580000000000002 28.499999999999996 27.560000000000002 20.36 115-119 24.07 27.689999999999998 28.035 20.205000000000002 120-124 24.03 28.15 28.244999999999997 19.575 125-129 24.065 28.075 27.700000000000003 20.16 130-134 24.215 28.01 27.96 19.814999999999998 135-139 24.125 27.765 28.060000000000002 20.05 140-144 24.37 28.26 27.595 19.775000000000002 145-149 24.195 28.084999999999997 28.084999999999997 19.634999999999998 150-151 25.7875 28.1375 26.900000000000002 19.175 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 1.0 21 1.5 22 1.5 23 1.5 24 3.0 25 3.0 26 2.0 27 4.5 28 4.5 29 3.0 30 6.5 31 13.0 32 20.0 33 33.5 34 44.0 35 50.5 36 73.5 37 109.0 38 150.5 39 180.5 40 209.0 41 234.0 42 261.5 43 295.5 44 300.0 45 293.0 46 289.0 47 253.5 48 213.0 49 196.5 50 165.5 51 136.0 52 106.5 53 91.0 54 79.0 55 45.5 56 29.5 57 27.5 58 20.0 59 9.5 60 6.0 61 9.0 62 8.0 63 3.5 64 2.5 65 2.0 66 1.0 67 2.5 68 2.5 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.5950000000000001 30-34 2.0500000000000003 35-39 0.9650000000000001 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.425 #Duplication Level Percentage of deduplicated Percentage of total 1 99.44681921046015 98.875 2 0.5280362081971335 1.05 3 0.025144581342720643 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0125 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.0625 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.1875 0.0 0.0 0.0 0.0 96-97 0.25 0.0 0.0 0.0 0.0 98-99 0.3125 0.0 0.0 0.0 0.0 100-101 0.35 0.0 0.0 0.0 0.0 102-103 0.375 0.0 0.0 0.0 0.0 104-105 0.475 0.0 0.0 0.0 0.0 106-107 0.5874999999999999 0.0 0.0 0.0 0.0 108-109 0.6625000000000001 0.0 0.0 0.0 0.0 110-111 0.775 0.0 0.0 0.0 0.0 112-113 0.825 0.0 0.0 0.0 0.0 114-115 0.9625 0.0 0.0 0.0 0.0 116-117 1.2 0.0 0.0 0.0 0.0 118-119 1.3625 0.0 0.0 0.0 0.0 120-121 1.6375000000000002 0.0 0.0 0.0 0.0 122-123 1.875 0.0 0.0 0.0 0.0 124-125 2.0875000000000004 0.0 0.0 0.0 0.0 126-127 2.2625 0.0 0.0 0.0 0.0 128-129 2.55 0.0 0.0 0.0 0.0 130-131 2.75 0.0 0.0 0.0 0.0 132-133 3.0 0.0 0.0 0.0 0.0 134-135 3.2875 0.0 0.0 0.0 0.0 136-137 3.55 0.0 0.0 0.0 0.0 138-139 3.95 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 655550 spots for SRR7172719.sra Written 655550 spots for SRR7172719.sra Read 655550 spots for SRR7172719.sra Written 655550 spots for SRR7172719.sra Read 655550 spots for SRR7172719.sra Written 655550 spots for SRR7172719.sra Read 655550 spots for SRR7172719.sra Written 655550 spots for SRR7172719.sra Read 655550 spots for SRR7172719.sra Written 655550 spots for SRR7172719.sra Read 655550 spots for SRR7172719.sra Written 655550 spots for SRR7172719.sra Read 655550 spots for SRR7172719.sra Written 655550 spots for SRR7172719.sra Read 655550 spots for SRR7172719.sra Written 655550 spots for SRR7172719.sra Read 655550 spots for SRR7172719.sra Written 655550 spots for SRR7172719.sra Read 655550 spots for SRR7172719.sra Written 655550 spots for SRR7172719.sra Read 655550 spots for SRR7172719.sra Written 655550 spots for SRR7172719.sra Read 655550 spots for SRR7172719.sra Written 655550 spots for SRR7172719.sra Read 655550 spots for SRR7172719.sra Written 655550 spots for SRR7172719.sra Read 655550 spots for SRR7172719.sra Written 655550 spots for SRR7172719.sra Read 655550 spots for SRR7172719.sra Written 655550 spots for SRR7172719.sra Read 655550 spots for SRR7172719.sra Written 655550 spots for SRR7172719.sra Read 655569 spots for SRR7172719.sra Written 655569 spots for SRR7172719.sra Read 655550 spots for SRR7172719.sra Written 655550 spots for SRR7172719.sra Read 655550 spots for SRR7172719.sra Written 655550 spots for SRR7172719.sra Read 655550 spots for SRR7172719.sra Written 655550 spots for SRR7172719.sra SRR ids: ['SRR7172719.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_8t4ktruk SRR7172719.sra spots: 13111019 blocks: [[1, 655550], [655551, 1311100], [1311101, 1966650], [1966651, 2622200], [2622201, 3277750], [3277751, 3933300], [3933301, 4588850], [4588851, 5244400], [5244401, 5899950], [5899951, 6555500], [6555501, 7211050], [7211051, 7866600], [7866601, 8522150], [8522151, 9177700], [9177701, 9833250], [9833251, 10488800], [10488801, 11144350], [11144351, 11799900], [11799901, 12455450], [12455451, 13111019]] SRR7172719 file size 4421193 SRR7172719 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7172719 SRR7172719_1.fastq SRR7172719_2.fastq Input file: SRR7172719_1.fastq Paired file: SRR7172719_2.fastq trimmed: SRR7172719-trimmed-pair1.fastq, SRR7172719-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 15:09:36 2025 >> started Mon Feb 10 15:09:50 2025 >> done (13.815s) 13111019 read pairs processed; of these: 13411 ( 0.10%) short read pairs filtered out after trimming by size control 10024 ( 0.08%) empty read pairs filtered out after trimming by size control 13087584 (99.82%) read pairs available; of these: 6481930 (49.53%) trimmed read pairs available after processing 6605654 (50.47%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 0 0.00% 20 0 0.00% 21 3 0.00% 22 2 0.00% 23 1 0.00% 24 0 0.00% 25 4 0.00% 26 5 0.00% 27 2 0.00% 28 2 0.00% 29 2 0.00% 30 0 0.00% 31 0 0.00% 32 1 0.00% 33 2 0.00% 34 3 0.00% 35 8 0.00% 36 3 0.00% 37 0 0.00% 38 0 0.00% 39 3 0.00% 40 1 0.00% 41 4 0.00% 42 6 0.00% 43 7 0.00% 44 4 0.00% 45 9 0.00% 46 2 0.00% 47 5 0.00% 48 7 0.00% 49 9 0.00% 50 12 0.00% 51 8 0.00% 52 11 0.00% 53 20 0.00% 54 17 0.00% 55 20 0.00% 56 25 0.00% 57 16 0.00% 58 35 0.00% 59 32 0.00% 60 31 0.00% 61 52 0.00% 62 54 0.00% 63 61 0.00% 64 68 0.00% 65 72 0.00% 66 95 0.00% 67 107 0.00% 68 90 0.00% 69 140 0.00% 70 141 0.00% 71 169 0.00% 72 199 0.00% 73 245 0.00% 74 253 0.00% 75 328 0.00% 76 367 0.00% 77 410 0.00% 78 484 0.00% 79 497 0.00% 80 643 0.00% 81 695 0.01% 82 785 0.01% 83 969 0.01% 84 1700 0.01% 85 2189 0.02% 86 2222 0.02% 87 2395 0.02% 88 2626 0.02% 89 2692 0.02% 90 2725 0.02% 91 3045 0.02% 92 3213 0.02% 93 3485 0.03% 94 3800 0.03% 95 4069 0.03% 96 4361 0.03% 97 4587 0.04% 98 4854 0.04% 99 5264 0.04% 100 5742 0.04% 101 6015 0.05% 102 6660 0.05% 103 7085 0.05% 104 7595 0.06% 105 8275 0.06% 106 8655 0.07% 107 9177 0.07% 108 9788 0.07% 109 10202 0.08% 110 10884 0.08% 111 11341 0.09% 112 12428 0.09% 113 13405 0.10% 114 13922 0.11% 115 14844 0.11% 116 15348 0.12% 117 15989 0.12% 118 17016 0.13% 119 17707 0.14% 120 18585 0.14% 121 19783 0.15% 122 20565 0.16% 123 21642 0.17% 124 22632 0.17% 125 24009 0.18% 126 25159 0.19% 127 26426 0.20% 128 27791 0.21% 129 28989 0.22% 130 30520 0.23% 131 32101 0.25% 132 34188 0.26% 133 36284 0.28% 134 37906 0.29% 135 40307 0.31% 136 43062 0.33% 137 46516 0.36% 138 49571 0.38% 139 53234 0.41% 140 57330 0.44% 141 63720 0.49% 142 70759 0.54% 143 79505 0.61% 144 91458 0.70% 145 109558 0.84% 146 137972 1.05% 147 187187 1.43% 148 298770 2.28% 149 700868 5.36% 150 3762981 28.75% 151 6605654 50.47% 13087584 reads passed initial QC criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=7.51 fanout-score-rank=15 prefix-density=0.25 prefix-fanout=4.1 sequence=TCCTTGTCCTGGATCTTGGCCTTCAC criterion=fanout-score sequence-density=0.08 sequence-density-rank=21 fanout-score=175.40 fanout-score-rank=1 prefix-density=0.59 prefix-fanout=23.2 sequence=CCACCACCATGGGCT criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=2.71 fanout-score-rank=30 prefix-density=0.18 prefix-fanout=2.4 sequence=ATGTACCCTGACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=102.59 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=8.3 sequence=CTTCCATTTCCGCCCAAGCTGCTCACAGTATACGGGCGTCGGCATCCAGACCGTCGGCTGATCGTGGTTTTACTAGGCTAGACTAGCGTACGAGCACTATGGTCAGTAATTCCTGGAGGAATAGGTACCAAGAAAAAAACGAACCTTTGGGTTCCAGAGCTGTACGGTCGCACTGAACTCGGATAGGTCTCAGAAAAACGAAATATAGGCTTACGGTAGGTCCGAATGGCACAAAGCTTGTTCCGTTAGCTGGCATAAGATTCCATGCCTAGATGTGATACACGTTTCTGGAAACTGCCTCGTCATGCGACTGTTCCCCGGGGTCAGGGCCGCTGGTATTTGCTGTAAAGAGGGGCGTTGAGTCCGTCCGACTTCACTGCCCCCTTTCAGCCTTTTGGGTCCTGTATCCCAATTCTCAGAGGTCCCGCCGTACGCTGAGGACCACCTGAAACGGGCATCGTCGCTCTTCGTTGTTCGTCGACTTCTAGTGTGGAGACGAATTGCCAGAATT SRR7172719 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 15:10:35 Started mapping on | Feb 10 15:10:35 Finished on | Feb 10 15:12:22 Mapping speed, Million of reads per hour | 440.33 Number of input reads | 13087584 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 12188121 Uniquely mapped reads % | 93.13% Average mapped length | 295.91 Number of splices: Total | 12620970 Number of splices: Annotated (sjdb) | 12422086 Number of splices: GT/AG | 12425865 Number of splices: GC/AG | 159813 Number of splices: AT/AC | 8271 Number of splices: Non-canonical | 27021 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.59 Insertion rate per base | 0.02% Insertion average length | 2.55 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 314351 % of reads mapped to multiple loci | 2.40% Number of reads mapped to too many loci | 36965 % of reads mapped to too many loci | 0.28% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.13% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 597763 597763 597763 N_multimapping 314351 314351 314351 N_noFeature 282779 12097438 318885 N_ambiguous 111601 605 56608 UnstrandedReadsAssigned:11793741 PositiveStrandReadsAssigned:90078 NegativeStrandReadsAssigned:11812628 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7172719 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7172719-trimmed-pair1.fastq SRR7172719-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,087,584 reads, 11,743,039 reads pseudoaligned [quant] estimated average fragment length: 242.709 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,090 rounds 52401 SRR7172719.ke.tsv 34699 SRR7172719.se.tsv 87100 total ==> SRR7172719.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1776.29 713 37.2506 Potri.005G024800.1.v4.1 1035 793.291 125 14.623 Potri.004G059700.1.v4.1 961 719.302 20 2.58034 Potri.007G009000.2.v4.1 1416 1174.29 0 0 Potri.003G141000.2.v4.1 2943 2701.29 420.41 14.4431 Potri.016G087400.1.v4.1 270 75.605 726 891.137 Potri.015G069301.1.v4.1 564 325.987 0 0 Potri.010G195200.1.v4.1 1773 1531.29 129 7.8179 Potri.012G127500.1.v4.1 977 735.302 1519 191.712 ==> SRR7172719.se.tsv <== Potri.001G166300.v4.1 2 Potri.001G448400.v4.1 21 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 259 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 132 SRR7172719 completed mapping pipeline successfully