Starting /dee2/code/volunteer_pipeline.sh SRR7180062 current disk space = 3058594312192 free memory = 1414162280 SRR7180062 SRAfilesize 50d152cb108f9a50e857630e498d754a SRR7180062.sra SRR7180062.sra file validated SRR7180062 is paired end SRR7180062 is conventional basespace SRR7180062 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7180062_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 23.96625 25.0 18.0 32.0 18.0 33.0 2 29.442 30.0 27.0 33.0 25.0 33.0 3 31.188 33.0 31.0 33.0 27.0 33.0 4 32.26175 33.0 32.0 33.0 32.0 33.0 5 32.3595 33.0 33.0 33.0 32.0 34.0 6 36.523 38.0 37.0 38.0 34.0 38.0 7 37.04375 38.0 37.0 38.0 35.0 38.0 8 37.32525 38.0 38.0 38.0 36.0 38.0 9 37.4755 38.0 38.0 38.0 37.0 38.0 10-14 37.59775 38.0 38.0 38.0 37.8 38.0 15-19 37.61695 38.0 38.0 38.0 38.0 38.0 20-24 37.60765 38.0 38.0 38.0 38.0 38.0 25-29 37.581300000000006 38.0 38.0 38.0 38.0 38.0 30-34 37.5361 38.0 38.0 38.0 38.0 38.0 35-39 37.528800000000004 38.0 38.0 38.0 37.8 38.0 40-44 37.4484 38.0 38.0 38.0 37.0 38.0 45-49 37.43599999999999 38.0 38.0 38.0 37.0 38.0 50-54 37.41525 38.0 38.0 38.0 37.0 38.0 55-59 37.41345 38.0 38.0 38.0 37.0 38.0 60-64 37.359 38.0 38.0 38.0 37.0 38.0 65-69 37.3209 38.0 38.0 38.0 37.0 38.0 70-74 37.25605 38.0 38.0 38.0 37.0 38.0 75-79 37.252750000000006 38.0 38.0 38.0 36.6 38.0 80-84 37.148849999999996 38.0 38.0 38.0 36.2 38.0 85-89 37.0535 38.0 38.0 38.0 36.0 38.0 90-94 37.0007 38.0 38.0 38.0 36.0 38.0 95-99 36.8769 38.0 38.0 38.0 35.6 38.0 100-104 36.800599999999996 38.0 38.0 38.0 35.0 38.0 105-109 36.70415 38.0 38.0 38.0 34.6 38.0 110-114 36.54505 38.0 38.0 38.0 34.0 38.0 115-119 36.50385 38.0 38.0 38.0 34.2 38.0 120-124 36.3791 38.0 37.8 38.0 34.0 38.0 125-129 36.21 38.0 37.8 38.0 33.6 38.0 130-134 35.935500000000005 38.0 36.8 38.0 32.6 38.0 135-139 35.71225 38.0 36.6 38.0 31.4 38.0 140-144 35.431 38.0 36.0 38.0 31.0 38.0 145-149 35.05355 38.0 36.0 38.0 31.0 38.0 150-151 32.072625 36.5 32.5 38.0 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 0.0 10 0.0 11 0.0 12 2.0 13 0.0 14 0.0 15 1.0 16 1.0 17 1.0 18 4.0 19 1.0 20 2.0 21 1.0 22 3.0 23 2.0 24 5.0 25 10.0 26 11.0 27 14.0 28 12.0 29 22.0 30 37.0 31 44.0 32 45.0 33 72.0 34 113.0 35 260.0 36 610.0 37 2726.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 30.55775839280994 13.825006608511764 14.803066349458103 40.81416864922019 2 20.375 19.275000000000002 40.2 20.150000000000002 3 19.75 26.275 26.575 27.400000000000002 4 21.099999999999998 35.375 21.9 21.625 5 21.45 34.975 24.975 18.6 6 15.950000000000001 36.875 26.85 20.325 7 13.775 20.65 44.2 21.375 8 18.575 22.475 31.1 27.85 9 17.025000000000002 23.7 33.300000000000004 25.974999999999998 10-14 20.04 28.345 27.05 24.565 15-19 19.665 27.73 28.470000000000002 24.135 20-24 19.595000000000002 28.384999999999998 28.110000000000003 23.91 25-29 19.655 28.425 28.095 23.825 30-34 19.895 28.28 28.24 23.585 35-39 20.080000000000002 27.715 28.26 23.945 40-44 20.315 28.18 27.88 23.625 45-49 19.935 27.96 28.025 24.08 50-54 20.585 28.155 27.155 24.104999999999997 55-59 20.11 28.349999999999998 27.88 23.66 60-64 19.73 28.08 27.905 24.285 65-69 20.07 28.53 27.839999999999996 23.56 70-74 19.935 27.925 27.875 24.265 75-79 19.775000000000002 27.839999999999996 28.799999999999997 23.585 80-84 19.73 28.189999999999998 27.975 24.104999999999997 85-89 20.275000000000002 27.765 28.215 23.745 90-94 19.715 27.889999999999997 28.255000000000003 24.14 95-99 20.405 28.24 27.715 23.64 100-104 20.785 27.74 27.750000000000004 23.724999999999998 105-109 20.655 28.134999999999998 27.735 23.474999999999998 110-114 19.905 27.675 28.27 24.15 115-119 20.895 27.839999999999996 27.445000000000004 23.82 120-124 20.865000000000002 27.834999999999997 27.62 23.68 125-129 20.855 27.589999999999996 27.815 23.74 130-134 21.044999999999998 28.28 26.924999999999997 23.75 135-139 20.919999999999998 27.935 27.295 23.849999999999998 140-144 20.64 28.26 26.87 24.23 145-149 20.685000000000002 28.255000000000003 27.02 24.04 150-151 20.849999999999998 26.974999999999998 28.349999999999998 23.825 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.5 3 1.0 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.0 21 1.5 22 1.5 23 1.5 24 2.5 25 2.5 26 2.5 27 2.5 28 5.0 29 8.5 30 12.5 31 22.0 32 30.5 33 35.0 34 45.5 35 63.0 36 82.0 37 116.0 38 148.5 39 153.5 40 189.5 41 237.0 42 259.5 43 292.0 44 312.0 45 291.0 46 269.5 47 259.0 48 225.0 49 205.0 50 173.0 51 132.0 52 101.5 53 75.0 54 65.0 55 50.5 56 34.0 57 20.5 58 16.0 59 12.5 60 9.5 61 8.5 62 8.0 63 6.0 64 2.5 65 2.0 66 1.5 67 1.0 68 1.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 5.425 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.8 #Duplication Level Percentage of deduplicated Percentage of total 1 99.8246492985972 99.625 2 0.15030060120240482 0.3 3 0.0250501002004008 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0125 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.0625 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.2 0.0 0.0 0.0 0.0 92-93 0.225 0.0 0.0 0.0 0.0 94-95 0.2625 0.0 0.0 0.0 0.0 96-97 0.4125 0.0 0.0 0.0 0.0 98-99 0.4875 0.0 0.0 0.0 0.0 100-101 0.6000000000000001 0.0 0.0 0.0 0.0 102-103 0.725 0.0 0.0 0.0 0.0 104-105 0.7875 0.0 0.0 0.0 0.0 106-107 0.8875 0.0 0.0 0.0 0.0 108-109 0.9875 0.0 0.0 0.0 0.0 110-111 1.0875 0.0 0.0 0.0 0.0 112-113 1.35 0.0 0.0 0.0 0.0 114-115 1.6124999999999998 0.0 0.0 0.0 0.0 116-117 1.9 0.0 0.0 0.0 0.0 118-119 2.25 0.0 0.0 0.0 0.0 120-121 2.5875 0.0 0.0 0.0 0.0 122-123 2.8625 0.0 0.0 0.0 0.0 124-125 3.0250000000000004 0.0 0.0 0.0 0.0 126-127 3.3499999999999996 0.0 0.0 0.0 0.0 128-129 3.7625 0.0 0.0 0.0 0.0 130-131 4.0 0.0 0.0 0.0 0.0 132-133 4.449999999999999 0.0 0.0 0.0 0.0 134-135 4.85 0.0 0.0 0.0 0.0 136-137 5.199999999999999 0.0 0.0 0.0 0.0 138-139 5.612500000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7180062 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7180062_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.8585 33.0 33.0 34.0 32.0 34.0 2 33.046 33.0 33.0 34.0 32.0 34.0 3 33.03275 34.0 33.0 34.0 32.0 34.0 4 32.88925 34.0 33.0 34.0 32.0 34.0 5 32.973 34.0 33.0 34.0 32.0 34.0 6 37.14125 38.0 38.0 38.0 36.0 38.0 7 37.202 38.0 38.0 38.0 37.0 38.0 8 37.16675 38.0 38.0 38.0 37.0 38.0 9 37.226 38.0 38.0 38.0 37.0 38.0 10-14 37.2677 38.0 38.0 38.0 37.0 38.0 15-19 37.1992 38.0 38.0 38.0 37.0 38.0 20-24 37.184250000000006 38.0 38.0 38.0 36.8 38.0 25-29 37.1487 38.0 38.0 38.0 37.0 38.0 30-34 37.10555 38.0 38.0 38.0 36.8 38.0 35-39 37.01875 38.0 38.0 38.0 36.4 38.0 40-44 37.02825 38.0 38.0 38.0 36.4 38.0 45-49 37.06775 38.0 38.0 38.0 36.2 38.0 50-54 37.12705 38.0 38.0 38.0 36.0 38.0 55-59 37.05045 38.0 38.0 38.0 36.0 38.0 60-64 36.91345 38.0 38.0 38.0 35.8 38.0 65-69 36.9133 38.0 38.0 38.0 35.8 38.0 70-74 36.840250000000005 38.0 38.0 38.0 35.4 38.0 75-79 36.7602 38.0 38.0 38.0 35.0 38.0 80-84 36.730450000000005 38.0 38.0 38.0 35.0 38.0 85-89 36.5861 38.0 38.0 38.0 34.2 38.0 90-94 36.4861 38.0 38.0 38.0 34.0 38.0 95-99 36.397299999999994 38.0 38.0 38.0 34.0 38.0 100-104 36.2259 38.0 38.0 38.0 33.6 38.0 105-109 36.06224999999999 38.0 37.4 38.0 33.0 38.0 110-114 36.092499999999994 38.0 37.2 38.0 33.2 38.0 115-119 35.900400000000005 38.0 37.0 38.0 32.8 38.0 120-124 35.8187 38.0 37.0 38.0 32.4 38.0 125-129 35.48455 38.0 36.2 38.0 31.0 38.0 130-134 35.1497 38.0 35.6 38.0 28.8 38.0 135-139 34.9901 38.0 35.4 38.0 28.6 38.0 140-144 34.432550000000006 38.0 35.0 38.0 25.6 38.0 145-149 33.70145 38.0 35.0 38.0 21.0 38.0 150-151 30.05825 36.5 28.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 3 2.0 4 1.0 5 1.0 6 0.0 7 0.0 8 0.0 9 0.0 10 1.0 11 2.0 12 0.0 13 0.0 14 2.0 15 2.0 16 1.0 17 1.0 18 5.0 19 2.0 20 6.0 21 4.0 22 8.0 23 9.0 24 16.0 25 16.0 26 14.0 27 25.0 28 32.0 29 41.0 30 51.0 31 62.0 32 70.0 33 99.0 34 150.0 35 260.0 36 628.0 37 2489.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.4333583395849 15.078769692423105 18.079519879969993 33.408352088022006 2 23.280820205051263 23.055763940985248 37.259314828707176 16.404101025256317 3 20.580145036259065 25.756439109777446 31.007751937984494 22.655663915978995 4 23.575 34.325 22.2 19.900000000000002 5 24.55613903475869 35.88397099274819 22.705676419104776 16.854213553388348 6 17.329332333083272 38.33458364591148 25.531382845711427 18.804701175293822 7 17.404351087771943 15.603900975243812 45.03625906476619 21.955488872218055 8 19.379844961240313 22.55563890972743 29.03225806451613 29.03225806451613 9 21.48037009252313 24.456114028507127 29.132283070767688 24.93123280820205 10-14 23.058458768815324 27.879181877281596 26.809021353202983 22.253338000700104 15-19 23.410852713178297 27.886971742935735 27.246811702925733 21.45536384096024 20-24 22.995294824306736 28.53639002903193 27.720492541795977 20.747822604865352 25-29 22.938402889245584 28.430979133226327 27.17696629213483 21.453651685393258 30-34 22.123493975903614 28.549196787148595 27.515060240963855 21.812248995983936 35-39 22.76974080771549 28.596544102873217 27.501506931886677 21.132208157524612 40-44 22.904635162958872 27.84110882338171 28.202681665243812 21.05157434841561 45-49 23.42044658055472 27.64093321317713 27.756082907780115 21.182537298488036 50-54 22.865716429107277 28.08702175543886 27.49687421855464 21.550387596899228 55-59 22.93844076611492 28.079211881782268 28.05420813121968 20.928139220883132 60-64 23.704740948189638 28.285657131426284 26.925385077015402 21.084216843368676 65-69 23.67736773677368 28.007800780078007 27.797779777977798 20.517051705170516 70-74 23.26116305815291 28.091404570228512 27.726386319315964 20.921046052302618 75-79 23.45617280864043 28.21141057052853 27.661383069153455 20.671033551677585 80-84 23.42851427714157 28.334250137520627 27.72415862379357 20.513076961544233 85-89 23.45617280864043 28.626431321566077 27.731386569328464 20.186009300465024 90-94 24.135 27.800000000000004 27.22 20.845 95-99 24.055 28.075 28.16 19.71 100-104 24.64 27.315 27.800000000000004 20.244999999999997 105-109 23.695 28.37 27.74 20.195 110-114 24.39 28.12 27.685 19.805 115-119 24.285 27.83 27.169999999999998 20.715 120-124 24.29 27.800000000000004 27.589999999999996 20.32 125-129 24.715 27.650000000000002 27.295 20.34 130-134 25.040000000000003 27.565 27.73 19.665 135-139 24.42 27.794999999999998 27.355 20.43 140-144 24.7 28.365000000000002 27.245 19.689999999999998 145-149 25.330000000000002 27.884999999999998 27.22 19.564999999999998 150-151 25.278159769971246 27.265908238529818 28.053506688336043 19.402425303162897 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 1.0 18 0.5 19 0.5 20 1.0 21 1.0 22 1.0 23 1.0 24 1.0 25 0.5 26 1.0 27 4.0 28 6.0 29 10.0 30 13.0 31 10.5 32 12.0 33 22.0 34 36.0 35 57.5 36 78.0 37 95.5 38 130.5 39 159.5 40 191.0 41 247.5 42 276.0 43 274.5 44 296.5 45 300.0 46 300.0 47 277.5 48 244.5 49 219.5 50 169.5 51 142.0 52 110.0 53 73.5 54 55.5 55 49.0 56 36.5 57 19.5 58 14.0 59 13.5 60 14.0 61 11.0 62 7.0 63 6.5 64 2.5 65 1.0 66 1.0 67 1.0 68 0.5 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.025 3 0.025 4 0.0 5 0.025 6 0.025 7 0.025 8 0.025 9 0.025 10-14 0.015 15-19 0.025 20-24 0.11 25-29 0.32 30-34 0.4 35-39 0.45999999999999996 40-44 0.43499999999999994 45-49 0.13 50-54 0.025 55-59 0.015 60-64 0.02 65-69 0.01 70-74 0.005 75-79 0.005 80-84 0.015 85-89 0.005 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.75 #Duplication Level Percentage of deduplicated Percentage of total 1 99.74937343358395 99.5 2 0.2506265664160401 0.5 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0125 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.0875 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.225 0.0 0.0 0.0 0.0 92-93 0.25 0.0 0.0 0.0 0.0 94-95 0.2875 0.0 0.0 0.0 0.0 96-97 0.4375 0.0 0.0 0.0 0.0 98-99 0.5125 0.0 0.0 0.0 0.0 100-101 0.625 0.0 0.0 0.0 0.0 102-103 0.75 0.0 0.0 0.0 0.0 104-105 0.8125 0.0 0.0 0.0 0.0 106-107 0.9125000000000001 0.0 0.0 0.0 0.0 108-109 1.0125 0.0 0.0 0.0 0.0 110-111 1.1124999999999998 0.0 0.0 0.0 0.0 112-113 1.375 0.0 0.0 0.0 0.0 114-115 1.6375000000000002 0.0 0.0 0.0 0.0 116-117 1.925 0.0 0.0 0.0 0.0 118-119 2.275 0.0 0.0 0.0 0.0 120-121 2.6125 0.0 0.0 0.0 0.0 122-123 2.8875 0.0 0.0 0.0 0.0 124-125 3.05 0.0 0.0 0.0 0.0 126-127 3.375 0.0 0.0 0.0 0.0 128-129 3.7625 0.0 0.0 0.0 0.0 130-131 4.0 0.0 0.0 0.0 0.0 132-133 4.449999999999999 0.0 0.0 0.0 0.0 134-135 4.800000000000001 0.0 0.0 0.0 0.0 136-137 5.15 0.0 0.0 0.0 0.0 138-139 5.5625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAACAAA 10 0.0069339755 144.27501 4 >>END_MODULE Read 990302 spots for SRR7180062.sra Written 990302 spots for SRR7180062.sra Read 990302 spots for SRR7180062.sra Written 990302 spots for SRR7180062.sra Read 990302 spots for SRR7180062.sra Written 990302 spots for SRR7180062.sra Read 990302 spots for SRR7180062.sra Written 990302 spots for SRR7180062.sra Read 990302 spots for SRR7180062.sra Written 990302 spots for SRR7180062.sra Read 990302 spots for SRR7180062.sra Written 990302 spots for SRR7180062.sra Read 990302 spots for SRR7180062.sra Written 990302 spots for SRR7180062.sra Read 990302 spots for SRR7180062.sra Written 990302 spots for SRR7180062.sra Read 990302 spots for SRR7180062.sra Written 990302 spots for SRR7180062.sra Read 990302 spots for SRR7180062.sra Written 990302 spots for SRR7180062.sra Read 990302 spots for SRR7180062.sra Written 990302 spots for SRR7180062.sra Read 990302 spots for SRR7180062.sra Written 990302 spots for SRR7180062.sra Read 990302 spots for SRR7180062.sra Written 990302 spots for SRR7180062.sra Read 990302 spots for SRR7180062.sra Written 990302 spots for SRR7180062.sra Read 990302 spots for SRR7180062.sra Written 990302 spots for SRR7180062.sra Read 990302 spots for SRR7180062.sra Written 990302 spots for SRR7180062.sra Read 990302 spots for SRR7180062.sra Written 990302 spots for SRR7180062.sra Read 990302 spots for SRR7180062.sra Written 990302 spots for SRR7180062.sra Read 990302 spots for SRR7180062.sra Written 990302 spots for SRR7180062.sra Read 990302 spots for SRR7180062.sra Written 990302 spots for SRR7180062.sra SRR ids: ['SRR7180062.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_wi7_3r1r SRR7180062.sra spots: 19806040 blocks: [[1, 990302], [990303, 1980604], [1980605, 2970906], [2970907, 3961208], [3961209, 4951510], [4951511, 5941812], [5941813, 6932114], [6932115, 7922416], [7922417, 8912718], [8912719, 9903020], [9903021, 10893322], [10893323, 11883624], [11883625, 12873926], [12873927, 13864228], [13864229, 14854530], [14854531, 15844832], [15844833, 16835134], [16835135, 17825436], [17825437, 18815738], [18815739, 19806040]] SRR7180062 file size 6689916 SRR7180062 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7180062 SRR7180062_1.fastq SRR7180062_2.fastq Input file: SRR7180062_1.fastq Paired file: SRR7180062_2.fastq trimmed: SRR7180062-trimmed-pair1.fastq, SRR7180062-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 16:03:09 2025 >> started Mon Feb 10 16:03:45 2025 >> done (36.464s) 19806040 read pairs processed; of these: 11599 ( 0.06%) short read pairs filtered out after trimming by size control 14388 ( 0.07%) empty read pairs filtered out after trimming by size control 19780053 (99.87%) read pairs available; of these: 7696625 (38.91%) trimmed read pairs available after processing 12083428 (61.09%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 6 0.00% 20 2 0.00% 21 2 0.00% 22 4 0.00% 23 1 0.00% 24 4 0.00% 25 0 0.00% 26 4 0.00% 27 4 0.00% 28 2 0.00% 29 2 0.00% 30 2 0.00% 31 3 0.00% 32 0 0.00% 33 3 0.00% 34 0 0.00% 35 4 0.00% 36 13 0.00% 37 20 0.00% 38 7 0.00% 39 9 0.00% 40 37 0.00% 41 26 0.00% 42 8 0.00% 43 7 0.00% 44 45 0.00% 45 95 0.00% 46 85 0.00% 47 25 0.00% 48 34 0.00% 49 84 0.00% 50 172 0.00% 51 78 0.00% 52 82 0.00% 53 51 0.00% 54 116 0.00% 55 172 0.00% 56 61 0.00% 57 78 0.00% 58 84 0.00% 59 236 0.00% 60 157 0.00% 61 133 0.00% 62 123 0.00% 63 152 0.00% 64 221 0.00% 65 181 0.00% 66 215 0.00% 67 279 0.00% 68 289 0.00% 69 392 0.00% 70 410 0.00% 71 466 0.00% 72 608 0.00% 73 629 0.00% 74 720 0.00% 75 836 0.00% 76 963 0.00% 77 1216 0.01% 78 1359 0.01% 79 1358 0.01% 80 1511 0.01% 81 1798 0.01% 82 1977 0.01% 83 2337 0.01% 84 3115 0.02% 85 3783 0.02% 86 4108 0.02% 87 4466 0.02% 88 5149 0.03% 89 5334 0.03% 90 5688 0.03% 91 6235 0.03% 92 6583 0.03% 93 7177 0.04% 94 7944 0.04% 95 8695 0.04% 96 9449 0.05% 97 10069 0.05% 98 10724 0.05% 99 11407 0.06% 100 12257 0.06% 101 12926 0.07% 102 13882 0.07% 103 14919 0.08% 104 15623 0.08% 105 16684 0.08% 106 17944 0.09% 107 18678 0.09% 108 20421 0.10% 109 21308 0.11% 110 22028 0.11% 111 23334 0.12% 112 24270 0.12% 113 25346 0.13% 114 26465 0.13% 115 28157 0.14% 116 29279 0.15% 117 30584 0.15% 118 33072 0.17% 119 34575 0.17% 120 35490 0.18% 121 37802 0.19% 122 38866 0.20% 123 39528 0.20% 124 40940 0.21% 125 42405 0.21% 126 44084 0.22% 127 46454 0.23% 128 48064 0.24% 129 50512 0.26% 130 52111 0.26% 131 54044 0.27% 132 57143 0.29% 133 60100 0.30% 134 61700 0.31% 135 65220 0.33% 136 68294 0.35% 137 71969 0.36% 138 76489 0.39% 139 81476 0.41% 140 86713 0.44% 141 93180 0.47% 142 102084 0.52% 143 112231 0.57% 144 127781 0.65% 145 148155 0.75% 146 181635 0.92% 147 237468 1.20% 148 356009 1.80% 149 690030 3.49% 150 3916969 19.80% 151 12083428 61.09% 19780053 reads passed initial QC criterion=sequence-density sequence-density=0.39 sequence-density-rank=1 fanout-score=3.05 fanout-score-rank=22 prefix-density=0.61 prefix-fanout=1.9 sequence=CACTTGCAGCCATTCTCAGCACCA criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=36.19 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=5.6 sequence=GCAGCTTTAGCTTCTACTTTTATTTAATAGTTTTATAGATTACACAAAGGAAATACAACACAAGATCTCCCCACAAATCACACACATTGATGCAGTACTGAACTCGTTGCACGAAAGCGCTTAGATATATATTATACAAGTACTAGCATGATCACAAACATGTGATGCTTATTGGTCGAGATCGATGACCCCTTCTATTACTCCGTGCTAAGGGCTTCGTCGATGTCTTTAGTCATATGAACCATAAGATCAACATAAATCTCTGGAACCGGGACTTCAGGATGGAGTTTTTCGTATTCAATGGTCAGTTTTGCCAAGCAGCCCGAGCCTTTTGGTGTAAGCTGCCAGACGGGCCTATAGACCTTGTAAATTTTCATGACATCTCCTTCCAAACCATTAAGAGTTATGATCTTGTTCTCATCATCGAAGGAAACCTCCTCTTTAAAGACCCCGGCTTTCCCTCCGATTGTGTACTGCCAAATCCTGATAGAGCCCGCAGTCTCCCAGTCAC criterion=sequence-density sequence-density=0.58 sequence-density-rank=1 fanout-score=2.26 fanout-score-rank=29 prefix-density=0.60 prefix-fanout=2.2 sequence=ATGTACCCTGACTTAGGTTTCTCAGA criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=89.39 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=8.2 sequence=TTTTCTTTGAGAGTGCATAGATTTGTGTTGATATAGAAAACAATGGCACTACATGGAAAGATTGAGACAACATTAGAACTCAAGTCCTCCGCAGAGAAGTTCTACAAAGTGTGGAGGAGCCAGTCCTTCCATGTTCCCAAACATGCTTCCAAGCATATCCAAGGAGTTGATATACATGCAGGTGACTGGGAGACTGCGGGCTCTATCAGGATTTGGCAGTACACAATCGGAGGGAAAGCCGGGGTCTTTAAAGAGGAGGTTTCCTTCGATGATGAGAACAAGATCATAACTCTTAATGGTTTGGAAGGAGATGTCATGAAAATTTACAAGGTCTATAGGCCCGTCTGGCAGCTTACACCAAAAGGCTCGGGCTGCTTGGCAAAACTGACCATTGAATACGAAAAACTCCATCCTGAAGTCCCGGTTCCAGAGATTTATGTTGATCTTATGGTTCATATGACTAAAGACATCGACGAAGCCCTTAGCACGGAGTAATAGAAGGGGTCATCGA SRR7180062 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 16:04:47 Started mapping on | Feb 10 16:04:47 Finished on | Feb 10 16:08:10 Mapping speed, Million of reads per hour | 350.78 Number of input reads | 19780053 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 18501017 Uniquely mapped reads % | 93.53% Average mapped length | 295.38 Number of splices: Total | 18594131 Number of splices: Annotated (sjdb) | 18224336 Number of splices: GT/AG | 18287931 Number of splices: GC/AG | 242191 Number of splices: AT/AC | 13553 Number of splices: Non-canonical | 50456 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.03% Deletion average length | 2.60 Insertion rate per base | 0.02% Insertion average length | 2.61 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 480216 % of reads mapped to multiple loci | 2.43% Number of reads mapped to too many loci | 74927 % of reads mapped to too many loci | 0.38% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.57% % of reads unmapped: other | 0.09% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 808815 808815 808815 N_multimapping 480216 480216 480216 N_noFeature 471593 18342817 539456 N_ambiguous 184436 904 93686 UnstrandedReadsAssigned:17844988 PositiveStrandReadsAssigned:157296 NegativeStrandReadsAssigned:17867875 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7180062 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7180062-trimmed-pair1.fastq SRR7180062-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,780,053 reads, 17,748,264 reads pseudoaligned [quant] estimated average fragment length: 244.685 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,007 rounds 52401 SRR7180062.ke.tsv 34699 SRR7180062.se.tsv 87100 total ==> SRR7180062.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1774.32 1767 56.3664 Potri.005G024800.1.v4.1 1035 791.315 196 14.0191 Potri.004G059700.1.v4.1 961 717.339 36 2.84049 Potri.007G009000.2.v4.1 1416 1172.32 0 0 Potri.003G141000.2.v4.1 2943 2699.32 828.432 17.3707 Potri.016G087400.1.v4.1 270 80.1902 1102 777.812 Potri.015G069301.1.v4.1 564 325.668 0 0 Potri.010G195200.1.v4.1 1773 1529.32 763.75 28.2663 Potri.012G127500.1.v4.1 977 733.321 6972 538.118 ==> SRR7180062.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 45 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 588 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 632 SRR7180062 completed mapping pipeline successfully