Starting /dee2/code/volunteer_pipeline.sh SRR7180064 current disk space = 3058435809280 free memory = 1472127732 SRR7180064 SRAfilesize d6cf87de3cedb0c1e9a2c3195ec5c767 SRR7180064.sra SRR7180064.sra file validated SRR7180064 is paired end SRR7180064 is conventional basespace SRR7180064 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7180064_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.73 34.0 33.0 34.0 32.0 34.0 2 33.117 34.0 33.0 34.0 32.0 34.0 3 32.71 33.0 33.0 34.0 31.0 34.0 4 33.25875 34.0 33.0 34.0 32.0 34.0 5 33.3365 34.0 33.0 34.0 33.0 34.0 6 36.78325 38.0 37.0 38.0 34.0 38.0 7 37.40875 38.0 38.0 38.0 37.0 38.0 8 37.506 38.0 38.0 38.0 37.0 38.0 9 37.677 38.0 38.0 38.0 38.0 38.0 10-14 37.71130000000001 38.0 38.0 38.0 38.0 38.0 15-19 37.6795 38.0 38.0 38.0 38.0 38.0 20-24 37.68445 38.0 38.0 38.0 38.0 38.0 25-29 37.6853 38.0 38.0 38.0 38.0 38.0 30-34 37.6553 38.0 38.0 38.0 38.0 38.0 35-39 37.65095 38.0 38.0 38.0 38.0 38.0 40-44 37.59325 38.0 38.0 38.0 38.0 38.0 45-49 37.5918 38.0 38.0 38.0 38.0 38.0 50-54 37.575199999999995 38.0 38.0 38.0 38.0 38.0 55-59 37.50885000000001 38.0 38.0 38.0 37.4 38.0 60-64 37.50515 38.0 38.0 38.0 37.4 38.0 65-69 37.47045 38.0 38.0 38.0 37.0 38.0 70-74 37.39605 38.0 38.0 38.0 37.0 38.0 75-79 37.3995 38.0 38.0 38.0 37.0 38.0 80-84 37.327549999999995 38.0 38.0 38.0 37.0 38.0 85-89 37.29025 38.0 38.0 38.0 36.8 38.0 90-94 37.253499999999995 38.0 38.0 38.0 36.8 38.0 95-99 37.1822 38.0 38.0 38.0 36.2 38.0 100-104 37.07375 38.0 38.0 38.0 36.0 38.0 105-109 36.94175 38.0 38.0 38.0 35.6 38.0 110-114 36.88475 38.0 38.0 38.0 35.0 38.0 115-119 36.71275000000001 38.0 38.0 38.0 34.6 38.0 120-124 36.6232 38.0 38.0 38.0 34.2 38.0 125-129 36.52714999999999 38.0 38.0 38.0 34.0 38.0 130-134 36.30069999999999 38.0 38.0 38.0 34.0 38.0 135-139 36.136849999999995 38.0 37.2 38.0 33.4 38.0 140-144 35.84415 38.0 36.6 38.0 33.0 38.0 145-149 35.50865 38.0 36.0 38.0 32.2 38.0 150-151 32.507875 36.5 33.5 38.0 16.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 1.0 17 0.0 18 0.0 19 1.0 20 2.0 21 2.0 22 3.0 23 1.0 24 2.0 25 5.0 26 8.0 27 11.0 28 12.0 29 15.0 30 26.0 31 34.0 32 51.0 33 51.0 34 98.0 35 153.0 36 512.0 37 3012.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.02231556839065 14.54449986873195 14.308217379889735 36.12496718298766 2 22.325 19.05 36.05 22.575 3 18.775 27.625 27.474999999999998 26.125 4 22.125 33.125 24.025 20.724999999999998 5 22.125 34.225 25.5 18.15 6 17.575 36.275 25.3 20.849999999999998 7 12.950000000000001 21.675 45.550000000000004 19.825 8 18.575 23.1 31.125000000000004 27.200000000000003 9 17.724999999999998 23.175 33.0 26.1 10-14 19.925 28.939999999999998 26.665 24.47 15-19 19.56 28.52 28.044999999999998 23.875 20-24 19.365 28.625 28.21 23.799999999999997 25-29 19.78 29.07 28.095 23.055 30-34 19.71 29.14 27.985 23.165 35-39 19.99 28.244999999999997 28.355000000000004 23.41 40-44 20.21 28.555000000000003 27.994999999999997 23.24 45-49 20.495 28.38 27.529999999999998 23.595 50-54 19.195 28.46 28.37 23.974999999999998 55-59 19.725 28.395 28.54 23.34 60-64 19.835 28.22 28.04 23.905 65-69 20.044999999999998 27.884999999999998 28.384999999999998 23.685000000000002 70-74 20.169999999999998 28.249999999999996 27.99 23.59 75-79 20.035 28.349999999999998 27.944999999999997 23.669999999999998 80-84 19.78 28.215 28.265 23.74 85-89 20.04 27.935 28.665000000000003 23.36 90-94 20.135 28.07 28.24 23.555 95-99 20.03 28.23 27.845 23.895 100-104 21.085 28.199999999999996 27.46 23.255 105-109 20.275000000000002 28.315 27.944999999999997 23.465 110-114 19.62 27.985 28.360000000000003 24.035 115-119 20.305 28.804999999999996 27.975 22.915 120-124 20.445 28.12 28.09 23.345 125-129 20.375 28.015 28.044999999999998 23.565 130-134 20.549999999999997 27.950000000000003 27.725 23.775 135-139 20.849999999999998 27.779999999999998 27.800000000000004 23.57 140-144 20.560000000000002 28.535 27.200000000000003 23.705000000000002 145-149 19.98 28.144999999999996 27.439999999999998 24.435000000000002 150-151 20.974999999999998 27.212500000000002 27.175 24.637500000000003 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 1.0 21 2.5 22 1.5 23 1.5 24 2.5 25 3.0 26 3.0 27 3.0 28 8.5 29 15.0 30 18.0 31 21.0 32 30.0 33 43.5 34 54.0 35 67.0 36 85.0 37 102.0 38 139.0 39 186.5 40 214.0 41 224.0 42 274.5 43 315.0 44 297.0 45 284.5 46 278.5 47 260.5 48 228.0 49 191.0 50 151.5 51 121.0 52 101.0 53 72.5 54 50.5 55 38.0 56 27.0 57 18.5 58 14.0 59 13.5 60 10.0 61 7.0 62 4.0 63 3.0 64 3.0 65 3.5 66 2.5 67 1.5 68 1.5 69 1.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.775 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54785229841748 99.075 2 0.42702838482793265 0.8500000000000001 3 0.025119316754584273 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.125 0.0 0.0 0.0 0.0 96-97 0.1375 0.0 0.0 0.0 0.0 98-99 0.2 0.0 0.0 0.0 0.0 100-101 0.25 0.0 0.0 0.0 0.0 102-103 0.275 0.0 0.0 0.0 0.0 104-105 0.375 0.0 0.0 0.0 0.0 106-107 0.42500000000000004 0.0 0.0 0.0 0.0 108-109 0.4875 0.0 0.0 0.0 0.0 110-111 0.5625 0.0 0.0 0.0 0.0 112-113 0.65 0.0 0.0 0.0 0.0 114-115 0.825 0.0 0.0 0.0 0.0 116-117 1.025 0.0 0.0 0.0 0.0 118-119 1.2374999999999998 0.0 0.0 0.0 0.0 120-121 1.475 0.0 0.0 0.0 0.0 122-123 1.6875 0.0 0.0 0.0 0.0 124-125 1.925 0.0 0.0 0.0 0.0 126-127 2.0875 0.0 0.0 0.0 0.0 128-129 2.2625 0.0 0.0 0.0 0.0 130-131 2.4125 0.0 0.0 0.0 0.0 132-133 2.6125 0.0 0.0 0.0 0.0 134-135 2.9625 0.0 0.0 0.0 0.0 136-137 3.1875 0.0 0.0 0.0 0.0 138-139 3.45 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7180064 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7180064_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.2125 34.0 33.0 34.0 33.0 34.0 2 33.21375 34.0 33.0 34.0 33.0 34.0 3 33.32425 34.0 33.0 34.0 33.0 34.0 4 33.2835 34.0 33.0 34.0 33.0 34.0 5 33.3005 34.0 33.0 34.0 33.0 34.0 6 37.4855 38.0 38.0 38.0 38.0 38.0 7 37.564 38.0 38.0 38.0 38.0 38.0 8 37.48725 38.0 38.0 38.0 38.0 38.0 9 37.34125 38.0 38.0 38.0 38.0 38.0 10-14 37.45735 38.0 38.0 38.0 38.0 38.0 15-19 37.43695 38.0 38.0 38.0 38.0 38.0 20-24 37.45055 38.0 38.0 38.0 38.0 38.0 25-29 37.457 38.0 38.0 38.0 38.0 38.0 30-34 37.400549999999996 38.0 38.0 38.0 38.0 38.0 35-39 37.3654 38.0 38.0 38.0 37.6 38.0 40-44 37.3582 38.0 38.0 38.0 37.6 38.0 45-49 37.3922 38.0 38.0 38.0 38.0 38.0 50-54 37.3469 38.0 38.0 38.0 37.2 38.0 55-59 37.3144 38.0 38.0 38.0 37.0 38.0 60-64 37.2431 38.0 38.0 38.0 37.0 38.0 65-69 37.19265 38.0 38.0 38.0 37.0 38.0 70-74 37.124700000000004 38.0 38.0 38.0 36.8 38.0 75-79 37.134699999999995 38.0 38.0 38.0 36.8 38.0 80-84 37.05385 38.0 38.0 38.0 36.0 38.0 85-89 36.902499999999996 38.0 38.0 38.0 36.0 38.0 90-94 36.81555 38.0 38.0 38.0 35.4 38.0 95-99 36.81805 38.0 38.0 38.0 35.8 38.0 100-104 36.62505 38.0 38.0 38.0 35.0 38.0 105-109 36.3871 38.0 38.0 38.0 34.0 38.0 110-114 36.33085 38.0 38.0 38.0 34.0 38.0 115-119 36.2769 38.0 38.0 38.0 34.0 38.0 120-124 36.12475 38.0 37.4 38.0 33.6 38.0 125-129 35.883950000000006 38.0 37.0 38.0 33.0 38.0 130-134 35.67985 38.0 36.6 38.0 31.6 38.0 135-139 35.4516 38.0 36.0 38.0 31.0 38.0 140-144 35.2066 38.0 36.0 38.0 31.0 38.0 145-149 34.677049999999994 38.0 35.6 38.0 28.0 38.0 150-151 30.912375 35.5 29.5 38.0 14.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 6.0 3 5.0 4 1.0 5 2.0 6 1.0 7 0.0 8 0.0 9 0.0 10 0.0 11 1.0 12 0.0 13 0.0 14 2.0 15 0.0 16 1.0 17 3.0 18 1.0 19 0.0 20 2.0 21 5.0 22 3.0 23 4.0 24 5.0 25 8.0 26 18.0 27 15.0 28 12.0 29 19.0 30 38.0 31 38.0 32 53.0 33 65.0 34 117.0 35 203.0 36 527.0 37 2845.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.675000000000004 17.05 18.45 27.825 2 26.400000000000002 21.8 34.35 17.45 3 21.349999999999998 27.3 30.975 20.375 4 23.025000000000002 34.275 23.375 19.325 5 23.3 37.125 22.725 16.85 6 19.400000000000002 37.55 23.25 19.8 7 17.4 18.125 43.725 20.75 8 20.5 23.200000000000003 27.325 28.975 9 21.85 25.2 28.475 24.474999999999998 10-14 23.355 28.12 26.565 21.959999999999997 15-19 23.27 27.755000000000003 27.839999999999996 21.135 20-24 22.85 28.63 27.450000000000003 21.07 25-29 23.11 29.054999999999996 27.16 20.674999999999997 30-34 23.365 27.91 28.235 20.49 35-39 23.52 28.275 27.894999999999996 20.31 40-44 22.869999999999997 28.645 27.74 20.745 45-49 23.674999999999997 27.634999999999998 28.205000000000002 20.485 50-54 23.294999999999998 27.900000000000002 28.345 20.46 55-59 23.57 27.694999999999997 27.57 21.165 60-64 23.085 27.900000000000002 28.24 20.775 65-69 23.365 27.445000000000004 28.194999999999997 20.995 70-74 23.465 28.37 27.794999999999998 20.369999999999997 75-79 23.585 28.000000000000004 27.57 20.845 80-84 23.735 28.525 27.310000000000002 20.43 85-89 23.805 28.46 27.625 20.11 90-94 23.265 28.46 27.950000000000003 20.325 95-99 23.445 28.185 28.310000000000002 20.06 100-104 23.97 28.405 27.47 20.155 105-109 23.7 28.435 27.889999999999997 19.975 110-114 23.62 27.994999999999997 28.194999999999997 20.19 115-119 23.849999999999998 28.615000000000002 27.665 19.869999999999997 120-124 23.575 28.76 27.634999999999998 20.03 125-129 24.4 28.42 27.560000000000002 19.62 130-134 24.67 27.815 27.634999999999998 19.88 135-139 23.69 27.810000000000002 28.415000000000003 20.085 140-144 24.34 28.084999999999997 28.035 19.54 145-149 24.765 28.435 27.11 19.689999999999998 150-151 24.359134675503313 29.06089783668876 27.097661623108664 19.482305864699264 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 0.5 23 0.5 24 0.5 25 1.0 26 3.0 27 5.0 28 5.5 29 6.0 30 8.5 31 13.0 32 15.5 33 23.0 34 46.5 35 56.5 36 69.0 37 102.5 38 132.0 39 181.0 40 219.0 41 234.0 42 272.0 43 288.5 44 291.0 45 307.5 46 295.0 47 263.0 48 236.5 49 200.5 50 165.0 51 137.5 52 107.0 53 87.5 54 58.0 55 41.5 56 39.0 57 23.5 58 16.0 59 14.5 60 8.5 61 5.0 62 5.5 63 3.5 64 2.5 65 2.5 66 2.0 67 1.0 68 0.5 69 0.0 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0375 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.075 #Duplication Level Percentage of deduplicated Percentage of total 1 99.1672975018925 98.25 2 0.7317688619732526 1.4500000000000002 3 0.10093363613424174 0.3 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.125 0.0 0.0 0.0 0.0 96-97 0.1375 0.0 0.0 0.0 0.0 98-99 0.2125 0.0 0.0 0.0 0.0 100-101 0.275 0.0 0.0 0.0 0.0 102-103 0.3 0.0 0.0 0.0 0.0 104-105 0.4 0.0 0.0 0.0 0.0 106-107 0.44999999999999996 0.0 0.0 0.0 0.0 108-109 0.5125 0.0 0.0 0.0 0.0 110-111 0.5875 0.0 0.0 0.0 0.0 112-113 0.675 0.0 0.0 0.0 0.0 114-115 0.8500000000000001 0.0 0.0 0.0 0.0 116-117 1.0499999999999998 0.0 0.0 0.0 0.0 118-119 1.2625000000000002 0.0 0.0 0.0 0.0 120-121 1.5 0.0 0.0 0.0 0.0 122-123 1.7125 0.0 0.0 0.0 0.0 124-125 1.95 0.0 0.0 0.0 0.0 126-127 2.1125 0.0 0.0 0.0 0.0 128-129 2.2875 0.0 0.0 0.0 0.0 130-131 2.4375 0.0 0.0 0.0 0.0 132-133 2.6375 0.0 0.0 0.0 0.0 134-135 2.9875 0.0 0.0 0.0 0.0 136-137 3.2125 0.0 0.0 0.0 0.0 138-139 3.4749999999999996 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CGGTTCA 10 0.006830828 145.0 4 >>END_MODULE Read 722914 spots for SRR7180064.sra Written 722914 spots for SRR7180064.sra Read 722914 spots for SRR7180064.sra Written 722914 spots for SRR7180064.sra Read 722914 spots for SRR7180064.sra Written 722914 spots for SRR7180064.sra Read 722914 spots for SRR7180064.sra Written 722914 spots for SRR7180064.sra Read 722914 spots for SRR7180064.sra Written 722914 spots for SRR7180064.sra Read 722921 spots for SRR7180064.sra Written 722921 spots for SRR7180064.sra Read 722914 spots for SRR7180064.sra Written 722914 spots for SRR7180064.sra Read 722914 spots for SRR7180064.sra Written 722914 spots for SRR7180064.sra Read 722914 spots for SRR7180064.sra Written 722914 spots for SRR7180064.sra Read 722914 spots for SRR7180064.sra Written 722914 spots for SRR7180064.sra Read 722914 spots for SRR7180064.sra Written 722914 spots for SRR7180064.sra Read 722914 spots for SRR7180064.sra Written 722914 spots for SRR7180064.sra Read 722914 spots for SRR7180064.sra Written 722914 spots for SRR7180064.sra Read 722914 spots for SRR7180064.sra Written 722914 spots for SRR7180064.sra Read 722914 spots for SRR7180064.sra Written 722914 spots for SRR7180064.sra Read 722914 spots for SRR7180064.sra Written 722914 spots for SRR7180064.sra Read 722914 spots for SRR7180064.sra Written 722914 spots for SRR7180064.sra Read 722914 spots for SRR7180064.sra Written 722914 spots for SRR7180064.sra Read 722914 spots for SRR7180064.sra Written 722914 spots for SRR7180064.sra Read 722914 spots for SRR7180064.sra Written 722914 spots for SRR7180064.sra SRR ids: ['SRR7180064.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_6kyjsmo0 SRR7180064.sra spots: 14458287 blocks: [[1, 722914], [722915, 1445828], [1445829, 2168742], [2168743, 2891656], [2891657, 3614570], [3614571, 4337484], [4337485, 5060398], [5060399, 5783312], [5783313, 6506226], [6506227, 7229140], [7229141, 7952054], [7952055, 8674968], [8674969, 9397882], [9397883, 10120796], [10120797, 10843710], [10843711, 11566624], [11566625, 12289538], [12289539, 13012452], [13012453, 13735366], [13735367, 14458287]] SRR7180064 file size 4877738 SRR7180064 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7180064 SRR7180064_1.fastq SRR7180064_2.fastq Input file: SRR7180064_1.fastq Paired file: SRR7180064_2.fastq trimmed: SRR7180064-trimmed-pair1.fastq, SRR7180064-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 16:32:57 2025 >> started Mon Feb 10 16:33:21 2025 >> done (23.635s) 14458287 read pairs processed; of these: 11075 ( 0.08%) short read pairs filtered out after trimming by size control 7966 ( 0.06%) empty read pairs filtered out after trimming by size control 14439246 (99.87%) read pairs available; of these: 4864004 (33.69%) trimmed read pairs available after processing 9575242 (66.31%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 20 1 0.00% 21 2 0.00% 22 1 0.00% 23 3 0.00% 24 1 0.00% 25 1 0.00% 26 3 0.00% 27 4 0.00% 28 5 0.00% 29 2 0.00% 30 4 0.00% 31 0 0.00% 32 4 0.00% 33 2 0.00% 34 1 0.00% 35 5 0.00% 36 3 0.00% 37 6 0.00% 38 3 0.00% 39 3 0.00% 40 3 0.00% 41 2 0.00% 42 3 0.00% 43 2 0.00% 44 5 0.00% 45 11 0.00% 46 7 0.00% 47 29 0.00% 48 13 0.00% 49 9 0.00% 50 12 0.00% 51 13 0.00% 52 40 0.00% 53 38 0.00% 54 29 0.00% 55 35 0.00% 56 26 0.00% 57 27 0.00% 58 30 0.00% 59 39 0.00% 60 43 0.00% 61 63 0.00% 62 63 0.00% 63 84 0.00% 64 93 0.00% 65 84 0.00% 66 95 0.00% 67 114 0.00% 68 117 0.00% 69 142 0.00% 70 161 0.00% 71 185 0.00% 72 229 0.00% 73 271 0.00% 74 290 0.00% 75 323 0.00% 76 409 0.00% 77 451 0.00% 78 468 0.00% 79 571 0.00% 80 598 0.00% 81 720 0.00% 82 878 0.01% 83 987 0.01% 84 1678 0.01% 85 2088 0.01% 86 2192 0.02% 87 2664 0.02% 88 2823 0.02% 89 2867 0.02% 90 3057 0.02% 91 3324 0.02% 92 3524 0.02% 93 3654 0.03% 94 4039 0.03% 95 4254 0.03% 96 4569 0.03% 97 4763 0.03% 98 5111 0.04% 99 5514 0.04% 100 5838 0.04% 101 6183 0.04% 102 6804 0.05% 103 7142 0.05% 104 7666 0.05% 105 8232 0.06% 106 8593 0.06% 107 9052 0.06% 108 9556 0.07% 109 10166 0.07% 110 10801 0.07% 111 11702 0.08% 112 12088 0.08% 113 13118 0.09% 114 13701 0.09% 115 14314 0.10% 116 15062 0.10% 117 16038 0.11% 118 16758 0.12% 119 17863 0.12% 120 18974 0.13% 121 19896 0.14% 122 20505 0.14% 123 21127 0.15% 124 22403 0.16% 125 22682 0.16% 126 24255 0.17% 127 25143 0.17% 128 25918 0.18% 129 27047 0.19% 130 28911 0.20% 131 30019 0.21% 132 31577 0.22% 133 33549 0.23% 134 35139 0.24% 135 37074 0.26% 136 39255 0.27% 137 41586 0.29% 138 44262 0.31% 139 46808 0.32% 140 51196 0.35% 141 55032 0.38% 142 60362 0.42% 143 66912 0.46% 144 76039 0.53% 145 87736 0.61% 146 106746 0.74% 147 141185 0.98% 148 212495 1.47% 149 426722 2.96% 150 2698785 18.69% 151 9575242 66.31% 14439246 reads passed initial QC criterion=sequence-density sequence-density=0.48 sequence-density-rank=1 fanout-score=2.53 fanout-score-rank=35 prefix-density=0.58 prefix-fanout=2.1 sequence=CATCTCAGACCTCTCATAGAACATCTTAACTGGTGCAACACCTGCAATGATTGTCTCAGTTGTGGTGTTCTCTGAGAAACCTAAGTCAGGGTACATGCCACATTTGCAGCCACTGCCACACTTGCA criterion=fanout-score sequence-density=0.07 sequence-density-rank=26 fanout-score=68.08 fanout-score-rank=1 prefix-density=0.30 prefix-fanout=16.2 sequence=TCATCCTCATCA criterion=sequence-density sequence-density=0.85 sequence-density-rank=1 fanout-score=2.65 fanout-score-rank=30 prefix-density=0.87 prefix-fanout=2.6 sequence=ATGTACCCTGACTTAGGTTTCTCAGA criterion=fanout-score sequence-density=0.08 sequence-density-rank=29 fanout-score=33.66 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=10.8 sequence=AAGGCCAAGATCCAGGACAAGGA SRR7180064 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 16:34:10 Started mapping on | Feb 10 16:34:11 Finished on | Feb 10 16:37:50 Mapping speed, Million of reads per hour | 237.36 Number of input reads | 14439246 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 13589289 Uniquely mapped reads % | 94.11% Average mapped length | 296.80 Number of splices: Total | 14299719 Number of splices: Annotated (sjdb) | 14024793 Number of splices: GT/AG | 14069979 Number of splices: GC/AG | 182947 Number of splices: AT/AC | 11409 Number of splices: Non-canonical | 35384 Mismatch rate per base, % | 0.31% Deletion rate per base | 0.03% Deletion average length | 2.72 Insertion rate per base | 0.02% Insertion average length | 2.52 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 310056 % of reads mapped to multiple loci | 2.15% Number of reads mapped to too many loci | 25635 % of reads mapped to too many loci | 0.18% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.52% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 552336 552336 552336 N_multimapping 310056 310056 310056 N_noFeature 342438 13469577 389741 N_ambiguous 138378 663 65579 UnstrandedReadsAssigned:13108473 PositiveStrandReadsAssigned:119049 NegativeStrandReadsAssigned:13133969 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7180064 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7180064-trimmed-pair1.fastq SRR7180064-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,439,246 reads, 12,999,607 reads pseudoaligned [quant] estimated average fragment length: 250.902 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,052 rounds 52401 SRR7180064.ke.tsv 34699 SRR7180064.se.tsv 87100 total ==> SRR7180064.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1768.1 1209 49.407 Potri.005G024800.1.v4.1 1035 785.098 360 33.132 Potri.004G059700.1.v4.1 961 711.132 14 1.42248 Potri.007G009000.2.v4.1 1416 1166.1 0 0 Potri.003G141000.2.v4.1 2943 2693.1 799.557 21.4519 Potri.016G087400.1.v4.1 270 74.224 1009 982.236 Potri.015G069301.1.v4.1 564 318.553 0 0 Potri.010G195200.1.v4.1 1773 1523.1 387 18.3591 Potri.012G127500.1.v4.1 977 727.104 2246 223.194 ==> SRR7180064.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 46 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 431 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 3 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 148 SRR7180064 completed mapping pipeline successfully