Starting /dee2/code/volunteer_pipeline.sh SRR7180065 current disk space = 3058547490816 free memory = 1112092024 SRR7180065 SRAfilesize 7a7b48e9471719f132a2ca54b00d19bc SRR7180065.sra SRR7180065.sra file validated SRR7180065 is paired end SRR7180065 is conventional basespace SRR7180065 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7180065_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 26.44675 30.0 18.0 33.0 18.0 33.0 2 28.4035 30.0 27.0 33.0 18.0 33.0 3 31.045 33.0 30.0 33.0 27.0 33.0 4 32.4825 33.0 33.0 33.0 32.0 33.0 5 32.6175 33.0 33.0 33.0 32.0 34.0 6 35.6305 37.0 35.0 38.0 31.0 38.0 7 36.8935 38.0 37.0 38.0 35.0 38.0 8 37.14675 38.0 38.0 38.0 36.0 38.0 9 37.3815 38.0 38.0 38.0 37.0 38.0 10-14 37.52485 38.0 38.0 38.0 37.6 38.0 15-19 37.49325 38.0 38.0 38.0 37.6 38.0 20-24 37.5366 38.0 38.0 38.0 37.6 38.0 25-29 37.510999999999996 38.0 38.0 38.0 37.6 38.0 30-34 37.50925 38.0 38.0 38.0 37.8 38.0 35-39 37.4636 38.0 38.0 38.0 37.4 38.0 40-44 37.3908 38.0 38.0 38.0 37.0 38.0 45-49 37.37445 38.0 38.0 38.0 37.0 38.0 50-54 37.346199999999996 38.0 38.0 38.0 37.0 38.0 55-59 37.2729 38.0 38.0 38.0 37.0 38.0 60-64 37.26425 38.0 38.0 38.0 37.0 38.0 65-69 37.2022 38.0 38.0 38.0 36.8 38.0 70-74 37.15935 38.0 38.0 38.0 36.2 38.0 75-79 37.11645 38.0 38.0 38.0 36.0 38.0 80-84 36.9543 38.0 38.0 38.0 35.8 38.0 85-89 36.9445 38.0 38.0 38.0 36.0 38.0 90-94 36.940250000000006 38.0 38.0 38.0 36.0 38.0 95-99 36.7632 38.0 38.0 38.0 35.4 38.0 100-104 36.72545 38.0 38.0 38.0 35.0 38.0 105-109 36.6568 38.0 38.0 38.0 35.0 38.0 110-114 36.4447 38.0 38.0 38.0 34.0 38.0 115-119 36.32535 38.0 38.0 38.0 34.0 38.0 120-124 36.2214 38.0 38.0 38.0 34.0 38.0 125-129 36.0629 38.0 37.6 38.0 33.4 38.0 130-134 35.92755 38.0 37.2 38.0 33.0 38.0 135-139 35.62329999999999 38.0 36.4 38.0 31.4 38.0 140-144 35.3395 38.0 36.0 38.0 31.2 38.0 145-149 34.8644 38.0 36.0 38.0 29.4 38.0 150-151 31.921125 36.5 32.0 38.0 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 1.0 10 2.0 11 0.0 12 0.0 13 3.0 14 1.0 15 0.0 16 0.0 17 1.0 18 3.0 19 0.0 20 3.0 21 6.0 22 2.0 23 3.0 24 6.0 25 10.0 26 15.0 27 15.0 28 25.0 29 29.0 30 36.0 31 41.0 32 59.0 33 87.0 34 111.0 35 218.0 36 608.0 37 2714.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.00726141078838 15.871369294605808 11.410788381742739 35.71058091286307 2 20.200000000000003 16.775000000000002 35.949999999999996 27.075 3 20.25 20.9 26.900000000000002 31.95 4 22.400000000000002 27.150000000000002 23.549999999999997 26.900000000000002 5 23.1 30.099999999999998 25.624999999999996 21.175 6 19.1 33.0 26.650000000000002 21.25 7 15.35 24.675 40.849999999999994 19.125 8 17.349999999999998 24.7 32.25 25.7 9 18.275 25.4 33.300000000000004 23.025000000000002 10-14 19.365 29.4 27.900000000000002 23.335 15-19 19.994999999999997 28.76 27.845 23.400000000000002 20-24 19.725 28.01 28.375 23.89 25-29 19.325 28.185 28.08 24.41 30-34 19.035 29.104999999999997 28.325 23.535 35-39 19.485 28.67 27.77 24.075 40-44 19.59 28.939999999999998 28.335 23.135 45-49 19.325 28.294999999999998 28.4 23.98 50-54 19.965 28.455000000000002 28.07 23.51 55-59 19.855 28.425 27.71 24.01 60-64 19.265 28.744999999999997 27.779999999999998 24.21 65-69 19.919999999999998 28.235 27.705000000000002 24.14 70-74 20.04 28.425 27.855 23.68 75-79 19.36 27.935 28.689999999999998 24.015 80-84 20.474999999999998 27.98 27.79 23.755000000000003 85-89 20.1 27.950000000000003 28.26 23.69 90-94 20.225 28.035 27.67 24.07 95-99 20.235 28.73 27.055 23.98 100-104 20.185 28.095 27.82 23.9 105-109 20.68 28.549999999999997 27.115000000000002 23.655 110-114 20.43 27.66 28.199999999999996 23.71 115-119 20.4 28.12 27.96 23.52 120-124 20.625 28.04 27.425 23.91 125-129 20.880000000000003 27.955000000000002 27.255000000000003 23.91 130-134 21.275 27.77 27.395000000000003 23.56 135-139 21.115000000000002 27.595 27.375 23.915 140-144 20.495 28.470000000000002 27.265 23.77 145-149 20.47 27.994999999999997 27.35 24.185000000000002 150-151 20.7375 27.474999999999998 27.212500000000002 24.575 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 4.0 1 2.5 2 0.5 3 0.0 4 1.0 5 1.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 1.0 16 0.5 17 0.0 18 0.0 19 0.0 20 0.5 21 1.5 22 2.0 23 2.0 24 2.5 25 4.0 26 3.5 27 4.5 28 11.5 29 17.0 30 20.5 31 30.0 32 39.0 33 46.0 34 55.0 35 67.5 36 89.5 37 111.0 38 131.0 39 161.0 40 184.0 41 209.5 42 240.5 43 263.0 44 258.0 45 256.0 46 274.0 47 269.0 48 240.0 49 218.0 50 186.5 51 139.0 52 112.0 53 93.5 54 70.5 55 44.0 56 33.0 57 27.0 58 17.5 59 11.5 60 8.0 61 8.5 62 7.5 63 6.5 64 4.0 65 2.0 66 3.0 67 1.5 68 1.0 69 1.0 70 0.0 71 1.0 72 1.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.5999999999999996 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.725 #Duplication Level Percentage of deduplicated Percentage of total 1 99.79944848332916 99.52499999999999 2 0.1504136375031336 0.3 3 0.0250689395838556 0.075 4 0.0250689395838556 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.037500000000000006 0.0 0.0 0.0 0.0 86-87 0.0875 0.0 0.0 0.0 0.0 88-89 0.1125 0.0 0.0 0.0 0.0 90-91 0.1375 0.0 0.0 0.0 0.0 92-93 0.2375 0.0 0.0 0.0 0.0 94-95 0.30000000000000004 0.0 0.0 0.0 0.0 96-97 0.3625 0.0 0.0 0.0 0.0 98-99 0.4375 0.0 0.0 0.0 0.0 100-101 0.525 0.0 0.0 0.0 0.0 102-103 0.6499999999999999 0.0 0.0 0.0 0.0 104-105 0.8125 0.0 0.0 0.0 0.0 106-107 0.95 0.0 0.0 0.0 0.0 108-109 1.0375 0.0 0.0 0.0 0.0 110-111 1.175 0.0 0.0 0.0 0.0 112-113 1.475 0.0 0.0 0.0 0.0 114-115 1.65 0.0 0.0 0.0 0.0 116-117 1.9 0.0 0.0 0.0 0.0 118-119 2.2750000000000004 0.0 0.0 0.0 0.0 120-121 2.6375 0.0 0.0 0.0 0.0 122-123 2.9125 0.0 0.0 0.0 0.0 124-125 3.325 0.0 0.0 0.0 0.0 126-127 3.8125 0.0 0.0 0.0 0.0 128-129 4.0375 0.0 0.0 0.0 0.0 130-131 4.5 0.0 0.0 0.0 0.0 132-133 5.1125 0.0 0.0 0.0 0.0 134-135 5.525 0.0 0.0 0.0 0.0 136-137 6.0625 0.0 0.0 0.0 0.0 138-139 6.6625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7180065 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7180065_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.59225 33.0 33.0 34.0 32.0 34.0 2 32.6685 33.0 33.0 34.0 32.0 34.0 3 32.6235 34.0 33.0 34.0 32.0 34.0 4 32.54675 34.0 33.0 34.0 32.0 34.0 5 32.54675 34.0 33.0 34.0 32.0 34.0 6 36.6305 38.0 38.0 38.0 36.0 38.0 7 36.6395 38.0 38.0 38.0 36.0 38.0 8 36.534 38.0 38.0 38.0 36.0 38.0 9 36.59075 38.0 38.0 38.0 36.0 38.0 10-14 36.59654999999999 38.0 38.0 38.0 36.0 38.0 15-19 36.47705 38.0 38.0 38.0 35.4 38.0 20-24 36.44995 38.0 38.0 38.0 35.6 38.0 25-29 36.4492 38.0 38.0 38.0 35.8 38.0 30-34 36.4274 38.0 38.0 38.0 35.8 38.0 35-39 36.319050000000004 38.0 38.0 38.0 35.6 38.0 40-44 36.28005 38.0 38.0 38.0 34.8 38.0 45-49 36.28065 38.0 38.0 38.0 35.0 38.0 50-54 36.306400000000004 38.0 38.0 38.0 35.0 38.0 55-59 36.203250000000004 38.0 38.0 38.0 34.4 38.0 60-64 36.06925 38.0 38.0 38.0 34.0 38.0 65-69 36.11415 38.0 38.0 38.0 34.4 38.0 70-74 36.0 38.0 38.0 38.0 34.0 38.0 75-79 35.965250000000005 38.0 38.0 38.0 33.8 38.0 80-84 35.92425 38.0 38.0 38.0 34.0 38.0 85-89 35.7457 38.0 38.0 38.0 33.0 38.0 90-94 35.66465 38.0 38.0 38.0 32.8 38.0 95-99 35.5304 38.0 37.8 38.0 32.2 38.0 100-104 35.345150000000004 38.0 37.2 38.0 30.6 38.0 105-109 35.171749999999996 38.0 37.0 38.0 29.8 38.0 110-114 35.2349 38.0 37.0 38.0 30.6 38.0 115-119 35.17985 38.0 37.0 38.0 30.6 38.0 120-124 35.032 38.0 36.8 38.0 29.8 38.0 125-129 34.73055000000001 38.0 36.0 38.0 27.8 38.0 130-134 34.42715 38.0 35.6 38.0 26.2 38.0 135-139 34.17075 38.0 35.2 38.0 23.8 38.0 140-144 33.7442 38.0 35.0 38.0 20.6 38.0 145-149 33.0312 38.0 34.4 38.0 14.0 38.0 150-151 29.3935 36.0 27.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 33.0 3 16.0 4 8.0 5 6.0 6 5.0 7 5.0 8 4.0 9 4.0 10 5.0 11 6.0 12 1.0 13 5.0 14 4.0 15 7.0 16 2.0 17 6.0 18 6.0 19 6.0 20 7.0 21 7.0 22 5.0 23 4.0 24 15.0 25 10.0 26 21.0 27 26.0 28 30.0 29 44.0 30 42.0 31 66.0 32 78.0 33 97.0 34 143.0 35 215.0 36 552.0 37 2509.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.74387193596798 18.534267133566786 18.584292146073036 25.137568784392194 2 23.705926481620406 25.95648912228057 33.65841460365091 16.67916979244811 3 22.330582645661416 29.00725181295324 28.882220555138783 19.779944986246562 4 26.025 32.775 22.7 18.5 5 24.15603900975244 36.159039759939986 22.9057264316079 16.779194798699677 6 20.10502625656414 35.0587646911728 25.406351587896975 19.42985746436609 7 20.260130065032516 19.65982991495748 39.04452226113057 21.03551775887944 8 21.905476369092273 23.980995248812203 28.457114278569644 25.656414103525883 9 22.1055263815954 26.18154538634659 29.03225806451613 22.680670167541887 10-14 23.663549532429865 28.73431014652198 26.293944091613742 21.308196229434415 15-19 22.676803040912276 28.55856757027108 27.853356006802038 20.911273382014606 20-24 23.01456237802132 28.579292398538758 27.708552269429017 20.69759295401091 25-29 23.84935142985927 29.323383582911806 26.58386337456804 20.24340161266089 30-34 23.05186670007517 28.514156852919072 27.341518416436983 21.092458030568782 35-39 23.06805074971165 27.972518930845997 28.067800010029586 20.89163030941277 40-44 23.50581628559968 28.103690332932207 27.752707581227437 20.637785800240675 45-49 23.66511534804584 28.033828754441277 27.027973777711058 21.27308211980183 50-54 23.43085771442861 28.22205551387847 27.526881720430108 20.820205051262818 55-59 23.883582537380608 27.914187128069212 27.46912036805521 20.733109966494975 60-64 23.63472694538908 28.555711142228446 27.015403080616124 20.794158831766353 65-69 23.357335733573358 28.90789078907891 27.20772077207721 20.527052705270528 70-74 24.341217060853044 27.83639181959098 27.391369568478424 20.431021551077556 75-79 24.24621231061553 27.57637881894095 27.816390819540977 20.361018050902548 80-84 23.91739173917392 28.30783078307831 27.262726272627262 20.512051205120514 85-89 23.881194059702985 28.651432571628582 27.51637581879094 19.950997549877496 90-94 23.79 28.105000000000004 27.365000000000002 20.74 95-99 24.195 28.244999999999997 27.61 19.950000000000003 100-104 23.655 28.375 27.474999999999998 20.495 105-109 24.13 28.165000000000003 27.62 20.085 110-114 24.12 28.4 27.47 20.01 115-119 24.465 28.315 26.99 20.23 120-124 24.38 27.750000000000004 27.72 20.150000000000002 125-129 24.54 28.095 27.32 20.044999999999998 130-134 24.535 28.585 27.24 19.64 135-139 25.28 28.084999999999997 27.155 19.48 140-144 25.34 28.305000000000003 26.945000000000004 19.41 145-149 25.369999999999997 28.515 27.279999999999998 18.834999999999997 150-151 25.465683210401302 28.353544193024128 26.978372296537067 19.202400300037507 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 1.0 10 1.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.5 18 0.5 19 1.5 20 2.5 21 2.0 22 3.5 23 4.0 24 2.5 25 2.5 26 3.0 27 6.5 28 8.5 29 12.0 30 15.0 31 15.0 32 18.5 33 23.5 34 29.0 35 41.0 36 59.0 37 97.0 38 131.5 39 150.0 40 198.0 41 237.5 42 247.5 43 282.0 44 305.0 45 298.5 46 298.5 47 258.5 48 224.5 49 225.0 50 193.0 51 133.5 52 106.5 53 102.5 54 75.5 55 50.5 56 36.0 57 29.5 58 20.5 59 9.5 60 9.5 61 7.5 62 4.0 63 2.5 64 1.0 65 2.0 66 3.0 67 3.0 68 1.5 69 0.5 70 0.5 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.025 3 0.025 4 0.0 5 0.025 6 0.025 7 0.05 8 0.025 9 0.025 10-14 0.015 15-19 0.03 20-24 0.08499999999999999 25-29 0.165 30-34 0.22499999999999998 35-39 0.295 40-44 0.27999999999999997 45-49 0.08499999999999999 50-54 0.025 55-59 0.015 60-64 0.02 65-69 0.01 70-74 0.005 75-79 0.005 80-84 0.01 85-89 0.005 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.425 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59768669851647 99.02499999999999 2 0.2765903947699271 0.5499999999999999 3 0.10057832537088257 0.3 4 0.0 0.0 5 0.025144581342720643 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCTTGAGCAAATTCAGTTTCTAAGCAAAAGCTTTCCAGGCCCCTTTATCC 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0125 0.0 0.0 0.0 0.0 86-87 0.0875 0.0 0.0 0.0 0.0 88-89 0.1125 0.0 0.0 0.0 0.0 90-91 0.1375 0.0 0.0 0.0 0.0 92-93 0.2375 0.0 0.0 0.0 0.0 94-95 0.30000000000000004 0.0 0.0 0.0 0.0 96-97 0.3625 0.0 0.0 0.0 0.0 98-99 0.45 0.0 0.0 0.0 0.0 100-101 0.525 0.0 0.0 0.0 0.0 102-103 0.6499999999999999 0.0 0.0 0.0 0.0 104-105 0.8125 0.0 0.0 0.0 0.0 106-107 0.95 0.0 0.0 0.0 0.0 108-109 1.0375 0.0 0.0 0.0 0.0 110-111 1.15 0.0 0.0 0.0 0.0 112-113 1.475 0.0 0.0 0.0 0.0 114-115 1.6625 0.0 0.0 0.0 0.0 116-117 1.9125 0.0 0.0 0.0 0.0 118-119 2.2750000000000004 0.0 0.0 0.0 0.0 120-121 2.6375 0.0 0.0 0.0 0.0 122-123 2.9125 0.0 0.0 0.0 0.0 124-125 3.3625 0.0 0.0 0.0 0.0 126-127 3.925 0.0 0.0 0.0 0.0 128-129 4.137499999999999 0.0 0.0 0.0 0.0 130-131 4.574999999999999 0.0 0.0 0.0 0.0 132-133 5.1875 0.0 0.0 0.0 0.0 134-135 5.625 0.0 0.0 0.0 0.0 136-137 6.1375 0.0 0.0 0.0 0.0 138-139 6.7625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AACAGAG 10 0.006830828 145.0 2 >>END_MODULE Read 617484 spots for SRR7180065.sra Written 617484 spots for SRR7180065.sra Read 617484 spots for SRR7180065.sra Written 617484 spots for SRR7180065.sra Read 617484 spots for SRR7180065.sra Written 617484 spots for SRR7180065.sra Read 617484 spots for SRR7180065.sra Written 617484 spots for SRR7180065.sra Read 617484 spots for SRR7180065.sra Written 617484 spots for SRR7180065.sra Read 617484 spots for SRR7180065.sra Written 617484 spots for SRR7180065.sra Read 617484 spots for SRR7180065.sra Written 617484 spots for SRR7180065.sra Read 617484 spots for SRR7180065.sra Written 617484 spots for SRR7180065.sra Read 617484 spots for SRR7180065.sra Written 617484 spots for SRR7180065.sra Read 617484 spots for SRR7180065.sra Written 617484 spots for SRR7180065.sra Read 617484 spots for SRR7180065.sra Written 617484 spots for SRR7180065.sra Read 617484 spots for SRR7180065.sra Written 617484 spots for SRR7180065.sra Read 617484 spots for SRR7180065.sra Written 617484 spots for SRR7180065.sra Read 617484 spots for SRR7180065.sra Written 617484 spots for SRR7180065.sra Read 617484 spots for SRR7180065.sra Written 617484 spots for SRR7180065.sra Read 617484 spots for SRR7180065.sra Written 617484 spots for SRR7180065.sra Read 617484 spots for SRR7180065.sra Written 617484 spots for SRR7180065.sra Read 617484 spots for SRR7180065.sra Written 617484 spots for SRR7180065.sra Read 617484 spots for SRR7180065.sra Written 617484 spots for SRR7180065.sra Read 617494 spots for SRR7180065.sra Written 617494 spots for SRR7180065.sra SRR ids: ['SRR7180065.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_6khitsyn SRR7180065.sra spots: 12349690 blocks: [[1, 617484], [617485, 1234968], [1234969, 1852452], [1852453, 2469936], [2469937, 3087420], [3087421, 3704904], [3704905, 4322388], [4322389, 4939872], [4939873, 5557356], [5557357, 6174840], [6174841, 6792324], [6792325, 7409808], [7409809, 8027292], [8027293, 8644776], [8644777, 9262260], [9262261, 9879744], [9879745, 10497228], [10497229, 11114712], [11114713, 11732196], [11732197, 12349690]] SRR7180065 file size 4163204 SRR7180065 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7180065 SRR7180065_1.fastq SRR7180065_2.fastq Input file: SRR7180065_1.fastq Paired file: SRR7180065_2.fastq trimmed: SRR7180065-trimmed-pair1.fastq, SRR7180065-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 16:18:25 2025 >> started Mon Feb 10 16:18:39 2025 >> done (14.211s) 12349690 read pairs processed; of these: 57524 ( 0.47%) short read pairs filtered out after trimming by size control 44085 ( 0.36%) empty read pairs filtered out after trimming by size control 12248081 (99.18%) read pairs available; of these: 5127327 (41.86%) trimmed read pairs available after processing 7120754 (58.14%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 2 0.00% 20 6 0.00% 21 10 0.00% 22 12 0.00% 23 16 0.00% 24 10 0.00% 25 12 0.00% 26 16 0.00% 27 16 0.00% 28 24 0.00% 29 19 0.00% 30 9 0.00% 31 12 0.00% 32 14 0.00% 33 14 0.00% 34 22 0.00% 35 18 0.00% 36 13 0.00% 37 26 0.00% 38 20 0.00% 39 19 0.00% 40 33 0.00% 41 31 0.00% 42 17 0.00% 43 19 0.00% 44 38 0.00% 45 82 0.00% 46 60 0.00% 47 26 0.00% 48 35 0.00% 49 72 0.00% 50 124 0.00% 51 63 0.00% 52 60 0.00% 53 55 0.00% 54 79 0.00% 55 131 0.00% 56 54 0.00% 57 70 0.00% 58 87 0.00% 59 185 0.00% 60 124 0.00% 61 89 0.00% 62 111 0.00% 63 148 0.00% 64 181 0.00% 65 165 0.00% 66 168 0.00% 67 200 0.00% 68 245 0.00% 69 297 0.00% 70 318 0.00% 71 365 0.00% 72 397 0.00% 73 510 0.00% 74 520 0.00% 75 610 0.00% 76 828 0.01% 77 940 0.01% 78 998 0.01% 79 1055 0.01% 80 1175 0.01% 81 1425 0.01% 82 1629 0.01% 83 1923 0.02% 84 4292 0.04% 85 6116 0.05% 86 6215 0.05% 87 6764 0.06% 88 6858 0.06% 89 7118 0.06% 90 7063 0.06% 91 7386 0.06% 92 7663 0.06% 93 7807 0.06% 94 8260 0.07% 95 8534 0.07% 96 8912 0.07% 97 9633 0.08% 98 9989 0.08% 99 10478 0.09% 100 11240 0.09% 101 11815 0.10% 102 12651 0.10% 103 13264 0.11% 104 13927 0.11% 105 15117 0.12% 106 16015 0.13% 107 16916 0.14% 108 18051 0.15% 109 18945 0.15% 110 19492 0.16% 111 20679 0.17% 112 22083 0.18% 113 22933 0.19% 114 24134 0.20% 115 24969 0.20% 116 25940 0.21% 117 27449 0.22% 118 28574 0.23% 119 30163 0.25% 120 31032 0.25% 121 32753 0.27% 122 33647 0.27% 123 34889 0.28% 124 36198 0.30% 125 37318 0.30% 126 38307 0.31% 127 40045 0.33% 128 41522 0.34% 129 42673 0.35% 130 44471 0.36% 131 45788 0.37% 132 48231 0.39% 133 50500 0.41% 134 52382 0.43% 135 54282 0.44% 136 56061 0.46% 137 58417 0.48% 138 60563 0.49% 139 63572 0.52% 140 66766 0.55% 141 70711 0.58% 142 75909 0.62% 143 82468 0.67% 144 91884 0.75% 145 103787 0.85% 146 122723 1.00% 147 153394 1.25% 148 219451 1.79% 149 405282 3.31% 150 2298800 18.77% 151 7120754 58.14% 12248081 reads passed initial QC criterion=sequence-density sequence-density=0.36 sequence-density-rank=1 fanout-score=4.19 fanout-score-rank=17 prefix-density=0.68 prefix-fanout=2.2 sequence=CACACTTGCAGCCATTCTCAGCACC criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=47.02 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=8.2 sequence=CTTTAGCTTCTACTTTTATTTAATAGTTTTATAGATTACACAAAGGAAATACAACACAAGATCTCCCCACAAATCACACGCATTGATGCAGTACTGAACTCGTTGCACGAAAGCGCTTAGATATATATTATACAAGTACTAGCATGATCACAAACATGTGATATATGCTTATTGGTCGAGATCGATGACCCCTTCTATTACTCCGTGCTAAGGGCTTCGTCGATGTCTTTAGTCATATGAACCATAAGATCAACATAAATCTCTGGAACCGGGACTTCAGGATGGAGTTTTTCGTATTCAATGGTCAGTTTTGCCAAGCAGCCCGAGCCTTTTGGTGTAAGCTGCCAG criterion=sequence-density sequence-density=0.50 sequence-density-rank=1 fanout-score=4.34 fanout-score-rank=17 prefix-density=0.65 prefix-fanout=3.3 sequence=TGCAAGTGCGGCAGTG criterion=fanout-score sequence-density=0.01 sequence-density-rank=34 fanout-score=41.10 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=4.6 sequence=ATTTTCTTTGAGAGTGCATAGATTTGTGTTGATATAGAAAACAATGGCACTACATGGAAAGATTGAGACAACATTAGAACTCAAGTCCTCCGCAGAGAAGTTCTACAAAGTGTGGAGGAGCCAGTCCTTCCATGTTCCCAAACATGCTTCCAAGCATATCCAAGGAGTTGATATACATGCAGGTGACTGGGAGACTGCGGGCTCTATCAGGATTTGGCAGTACACAATCGGAGGGAAAGCCGGGGTCTTTAAAGAGGAGGTTTCCTTCGATGATGAGAACAAGATCATAACTCTTAATGGTTTGGAAGGAGATGTCATGAAAATTTACAAGGTCTATA SRR7180065 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 16:19:46 Started mapping on | Feb 10 16:19:47 Finished on | Feb 10 16:21:23 Mapping speed, Million of reads per hour | 459.30 Number of input reads | 12248081 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 11429861 Uniquely mapped reads % | 93.32% Average mapped length | 292.91 Number of splices: Total | 10963854 Number of splices: Annotated (sjdb) | 10742786 Number of splices: GT/AG | 10786211 Number of splices: GC/AG | 135520 Number of splices: AT/AC | 9274 Number of splices: Non-canonical | 32849 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.73 Insertion rate per base | 0.02% Insertion average length | 2.74 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 305456 % of reads mapped to multiple loci | 2.49% Number of reads mapped to too many loci | 41255 % of reads mapped to too many loci | 0.34% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.77% % of reads unmapped: other | 0.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 561875 561875 561875 N_multimapping 305456 305456 305456 N_noFeature 291021 11312045 345351 N_ambiguous 119731 817 55803 UnstrandedReadsAssigned:11019109 PositiveStrandReadsAssigned:116999 NegativeStrandReadsAssigned:11028707 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7180065 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7180065-trimmed-pair1.fastq SRR7180065-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,248,081 reads, 10,960,872 reads pseudoaligned [quant] estimated average fragment length: 221.993 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,087 rounds 52401 SRR7180065.ke.tsv 34699 SRR7180065.se.tsv 87100 total ==> SRR7180065.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1797.01 1103 47.0767 Potri.005G024800.1.v4.1 1035 814.007 215 20.2577 Potri.004G059700.1.v4.1 961 740.017 19 1.96921 Potri.007G009000.2.v4.1 1416 1195.01 0 0 Potri.003G141000.2.v4.1 2943 2722.01 393 11.0735 Potri.016G087400.1.v4.1 270 84.7126 696.482 630.583 Potri.015G069301.1.v4.1 564 345.312 0 0 Potri.010G195200.1.v4.1 1773 1552.01 398 19.6684 Potri.012G127500.1.v4.1 977 756.012 5699 578.163 ==> SRR7180065.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 17 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 535 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 155 SRR7180065 completed mapping pipeline successfully