Starting /dee2/code/volunteer_pipeline.sh SRR7180066 current disk space = 3057939644416 free memory = 1578957068 SRR7180066 SRAfilesize 9cb85fc53464772a5671120c01a9f095 SRR7180066.sra SRR7180066.sra file validated SRR7180066 is paired end SRR7180066 is conventional basespace SRR7180066 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7180066_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 27.67275 33.0 18.0 33.0 18.0 34.0 2 29.9775 31.0 28.0 33.0 25.0 34.0 3 31.82925 33.0 31.0 33.0 29.0 34.0 4 32.6515 33.0 33.0 34.0 31.0 34.0 5 32.89425 33.0 33.0 34.0 32.0 34.0 6 36.90525 38.0 37.0 38.0 35.0 38.0 7 37.5215 38.0 38.0 38.0 37.0 38.0 8 37.5715 38.0 38.0 38.0 38.0 38.0 9 37.65 38.0 38.0 38.0 38.0 38.0 10-14 37.70645 38.0 38.0 38.0 38.0 38.0 15-19 37.66285 38.0 38.0 38.0 38.0 38.0 20-24 37.64189999999999 38.0 38.0 38.0 38.0 38.0 25-29 37.639849999999996 38.0 38.0 38.0 38.0 38.0 30-34 37.608850000000004 38.0 38.0 38.0 38.0 38.0 35-39 37.55929999999999 38.0 38.0 38.0 38.0 38.0 40-44 37.521 38.0 38.0 38.0 38.0 38.0 45-49 37.5196 38.0 38.0 38.0 38.0 38.0 50-54 37.459050000000005 38.0 38.0 38.0 38.0 38.0 55-59 37.412749999999996 38.0 38.0 38.0 37.0 38.0 60-64 37.388349999999996 38.0 38.0 38.0 37.0 38.0 65-69 37.360200000000006 38.0 38.0 38.0 37.0 38.0 70-74 37.31405 38.0 38.0 38.0 37.0 38.0 75-79 37.214150000000004 38.0 38.0 38.0 36.8 38.0 80-84 37.18665 38.0 38.0 38.0 37.0 38.0 85-89 37.1688 38.0 38.0 38.0 36.8 38.0 90-94 37.06185 38.0 38.0 38.0 36.0 38.0 95-99 36.98415 38.0 38.0 38.0 36.0 38.0 100-104 36.88245 38.0 38.0 38.0 36.0 38.0 105-109 36.74535 38.0 38.0 38.0 35.0 38.0 110-114 36.6919 38.0 38.0 38.0 35.0 38.0 115-119 36.64025 38.0 38.0 38.0 35.0 38.0 120-124 36.476099999999995 38.0 38.0 38.0 34.0 38.0 125-129 36.281150000000004 38.0 38.0 38.0 34.0 38.0 130-134 36.13755 38.0 37.8 38.0 33.8 38.0 135-139 35.926550000000006 38.0 37.0 38.0 33.0 38.0 140-144 35.681 38.0 36.6 38.0 33.0 38.0 145-149 35.371249999999996 38.0 36.0 38.0 32.4 38.0 150-151 32.756875 37.0 33.5 38.0 16.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 1.0 8 1.0 9 1.0 10 0.0 11 2.0 12 0.0 13 0.0 14 2.0 15 1.0 16 2.0 17 3.0 18 1.0 19 5.0 20 3.0 21 3.0 22 2.0 23 2.0 24 7.0 25 7.0 26 5.0 27 10.0 28 9.0 29 23.0 30 21.0 31 37.0 32 31.0 33 69.0 34 104.0 35 193.0 36 487.0 37 2967.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.4367666232073 16.81877444589309 13.559322033898304 34.18513689700131 2 19.499374217772214 21.576971214017522 35.819774718397994 23.103879849812266 3 18.3 28.65 27.700000000000003 25.35 4 20.674999999999997 33.75 24.075 21.5 5 21.075 35.625 25.324999999999996 17.974999999999998 6 17.125 36.8 25.825 20.25 7 13.075000000000001 23.925 44.425 18.575 8 16.675 23.549999999999997 31.324999999999996 28.449999999999996 9 16.6 25.775 32.324999999999996 25.3 10-14 19.384999999999998 30.36 26.845000000000002 23.41 15-19 19.509999999999998 29.73 27.815 22.945 20-24 19.53 29.785 27.779999999999998 22.905 25-29 19.365 30.009999999999998 27.63 22.994999999999997 30-34 19.505 29.625 27.955000000000002 22.915 35-39 19.45 29.65 27.72 23.18 40-44 19.605 29.315 27.74 23.34 45-49 19.875 29.485 27.365000000000002 23.275000000000002 50-54 19.134999999999998 29.925 27.99 22.95 55-59 19.295 29.580000000000002 27.305 23.82 60-64 19.24 29.28 27.68 23.799999999999997 65-69 19.13 29.459999999999997 27.88 23.53 70-74 19.59 29.225 27.965 23.22 75-79 19.36 29.744999999999997 27.33 23.565 80-84 19.400000000000002 29.07 28.000000000000004 23.53 85-89 19.975 28.945 27.6 23.48 90-94 20.195 28.76 27.32 23.724999999999998 95-99 19.759999999999998 28.76 27.944999999999997 23.535 100-104 20.085 29.445 27.055 23.415 105-109 19.895 28.875 27.534999999999997 23.695 110-114 19.865 29.459999999999997 27.060000000000002 23.615 115-119 20.265 28.549999999999997 27.800000000000004 23.385 120-124 20.39 28.725 27.18 23.705000000000002 125-129 20.565 28.345 27.055 24.035 130-134 20.32 28.89 27.250000000000004 23.54 135-139 20.825 28.57 27.339999999999996 23.265 140-144 20.54 28.035 27.310000000000002 24.115000000000002 145-149 21.07 28.335 26.950000000000003 23.645 150-151 21.4956783164224 27.821620944507075 26.606538895152198 24.076161843918324 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 2.0 1 1.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 1.0 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.5 19 1.5 20 0.5 21 0.5 22 2.5 23 6.0 24 5.5 25 3.5 26 7.0 27 13.5 28 20.0 29 23.0 30 28.0 31 38.5 32 51.5 33 73.5 34 81.5 35 82.0 36 104.0 37 145.5 38 158.5 39 176.0 40 209.5 41 211.5 42 234.0 43 257.0 44 254.0 45 254.0 46 248.0 47 232.5 48 222.5 49 198.0 50 154.5 51 119.0 52 98.0 53 81.0 54 60.5 55 39.5 56 25.5 57 15.0 58 13.0 59 12.0 60 6.5 61 6.5 62 5.5 63 3.0 64 1.5 65 2.5 66 3.0 67 1.5 68 0.5 69 0.0 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.125 2 0.125 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.21250000000000002 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.15 #Duplication Level Percentage of deduplicated Percentage of total 1 99.24357034795764 98.4 2 0.6555723651033787 1.3 3 0.10085728693898136 0.3 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.0875 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.23750000000000002 0.0 0.0 0.0 0.0 88-89 0.2875 0.0 0.0 0.0 0.0 90-91 0.3 0.0 0.0 0.0 0.0 92-93 0.3375 0.0 0.0 0.0 0.0 94-95 0.375 0.0 0.0 0.0 0.0 96-97 0.4375 0.0 0.0 0.0 0.0 98-99 0.5375 0.0 0.0 0.0 0.0 100-101 0.7375 0.0 0.0 0.0 0.0 102-103 0.875 0.0 0.0 0.0 0.0 104-105 0.975 0.0 0.0 0.0 0.0 106-107 1.0625 0.0 0.0 0.0 0.0 108-109 1.2125 0.0 0.0 0.0 0.0 110-111 1.45 0.0 0.0 0.0 0.0 112-113 1.6625 0.0 0.0 0.0 0.0 114-115 1.8 0.0 0.0 0.0 0.0 116-117 2.1375 0.0 0.0 0.0 0.0 118-119 2.4625000000000004 0.0 0.0 0.0 0.0 120-121 2.7750000000000004 0.0 0.0 0.0 0.0 122-123 3.3875 0.0 0.0 0.0 0.0 124-125 3.7125 0.0 0.0 0.0 0.0 126-127 4.0625 0.0 0.0 0.0 0.0 128-129 4.512499999999999 0.0 0.0 0.0 0.0 130-131 5.0375 0.0 0.0 0.0 0.0 132-133 5.375 0.0 0.0 0.0 0.0 134-135 5.862500000000001 0.0 0.0 0.0 0.0 136-137 6.5625 0.0 0.0 0.0 0.0 138-139 6.975 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGGAAAT 10 0.0068343505 144.975 2 >>END_MODULE SRR7180066 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7180066_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.0205 33.0 33.0 34.0 32.0 34.0 2 33.14725 34.0 33.0 34.0 33.0 34.0 3 33.19975 34.0 33.0 34.0 33.0 34.0 4 33.14475 34.0 33.0 34.0 33.0 34.0 5 33.14575 34.0 33.0 34.0 33.0 34.0 6 37.25775 38.0 38.0 38.0 37.0 38.0 7 37.333 38.0 38.0 38.0 38.0 38.0 8 37.27025 38.0 38.0 38.0 38.0 38.0 9 37.205 38.0 38.0 38.0 37.0 38.0 10-14 37.246050000000004 38.0 38.0 38.0 37.4 38.0 15-19 37.1629 38.0 38.0 38.0 37.4 38.0 20-24 37.158100000000005 38.0 38.0 38.0 37.4 38.0 25-29 37.157300000000006 38.0 38.0 38.0 37.4 38.0 30-34 37.062349999999995 38.0 38.0 38.0 37.0 38.0 35-39 36.9654 38.0 38.0 38.0 37.0 38.0 40-44 36.947700000000005 38.0 38.0 38.0 37.0 38.0 45-49 37.0044 38.0 38.0 38.0 37.0 38.0 50-54 37.0286 38.0 38.0 38.0 37.0 38.0 55-59 36.997749999999996 38.0 38.0 38.0 37.0 38.0 60-64 36.983250000000005 38.0 38.0 38.0 36.6 38.0 65-69 36.9321 38.0 38.0 38.0 36.4 38.0 70-74 36.87555 38.0 38.0 38.0 36.0 38.0 75-79 36.87455 38.0 38.0 38.0 36.0 38.0 80-84 36.8377 38.0 38.0 38.0 36.0 38.0 85-89 36.71585 38.0 38.0 38.0 36.0 38.0 90-94 36.603899999999996 38.0 38.0 38.0 35.4 38.0 95-99 36.58005 38.0 38.0 38.0 35.2 38.0 100-104 36.42605 38.0 38.0 38.0 34.4 38.0 105-109 36.247249999999994 38.0 38.0 38.0 34.0 38.0 110-114 36.183800000000005 38.0 38.0 38.0 34.0 38.0 115-119 36.07955 38.0 38.0 38.0 34.0 38.0 120-124 35.938199999999995 38.0 38.0 38.0 33.4 38.0 125-129 35.65165 38.0 37.2 38.0 32.2 38.0 130-134 35.454150000000006 38.0 36.6 38.0 31.2 38.0 135-139 35.0447 38.0 36.0 38.0 29.0 38.0 140-144 34.714549999999996 38.0 35.6 38.0 27.8 38.0 145-149 34.32415 38.0 34.8 38.0 27.0 38.0 150-151 30.670125 36.5 29.5 38.0 8.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 16.0 3 8.0 4 2.0 5 1.0 6 1.0 7 2.0 8 1.0 9 1.0 10 0.0 11 1.0 12 1.0 13 1.0 14 4.0 15 4.0 16 1.0 17 2.0 18 1.0 19 6.0 20 2.0 21 5.0 22 7.0 23 12.0 24 6.0 25 10.0 26 10.0 27 20.0 28 18.0 29 19.0 30 34.0 31 40.0 32 68.0 33 72.0 34 107.0 35 200.0 36 523.0 37 2794.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.7008760951189 14.818523153942428 18.39799749687109 26.082603254067582 2 27.474999999999998 20.75 33.375 18.4 3 20.75 26.75 32.75 19.75 4 26.125 32.225 22.525000000000002 19.125 5 23.575 36.6 21.7 18.125 6 19.904976244061015 36.134033508377094 24.48112028007002 19.479869967491872 7 21.4160620465349 16.962722041531148 40.10507880910683 21.51613710282712 8 21.65206508135169 23.779724655819777 27.033792240300375 27.53441802252816 9 22.075 25.95 27.85 24.125 10-14 24.33621681084054 27.886394319715986 26.351317565878297 21.426071303565177 15-19 23.59533696902987 27.898133786961527 27.84309801370891 20.663431230299693 20-24 23.99619505356964 28.597176329227995 26.839891859417243 20.56673675778512 25-29 23.86318108974359 28.370392628205128 27.34875801282051 20.417668269230766 30-34 23.829573934837093 28.005012531328322 27.67919799498747 20.48621553884712 35-39 22.96809151113787 28.642384105960268 27.704194260485654 20.685330122416214 40-44 23.952846751943817 27.93077501881114 27.654878354652624 20.461499874592427 45-49 23.844111606471973 27.94670139758553 27.711265841807343 20.497921154135152 50-54 23.856470823741365 27.764988489640675 27.995195676108498 20.38334501050946 55-59 23.95014765503779 28.38980929976475 28.07948345763051 19.580559587566945 60-64 23.826913456728363 28.029014507253624 27.518759379689843 20.625312656328166 65-69 23.649189513708222 28.24194516710026 28.171903141885128 19.936962177306384 70-74 23.639455782312925 27.495998399359745 28.42637054821929 20.438175270108044 75-79 23.791189559477974 28.24641232061603 27.84639231961598 20.116005800290015 80-84 23.76569456255315 27.742484117853035 28.372767745485465 20.11905357410835 85-89 23.86 27.47 28.67 20.0 90-94 23.77 27.315 28.675 20.24 95-99 23.635 27.565 28.29 20.51 100-104 23.875 27.785 28.645 19.695 105-109 24.04 28.04 27.779999999999998 20.14 110-114 23.755000000000003 28.01 28.585 19.650000000000002 115-119 23.94 28.005000000000003 28.449999999999996 19.605 120-124 24.57 27.495000000000005 28.17 19.765 125-129 24.57245724572457 27.927792779277926 28.277827782778274 19.22192219221922 130-134 24.255 27.83 28.084999999999997 19.830000000000002 135-139 24.445 27.97 28.205000000000002 19.38 140-144 25.215 27.834999999999997 28.07 18.88 145-149 25.055 28.194999999999997 27.525 19.225 150-151 25.31693234592695 27.413078950671522 27.262457637755745 20.00753106564579 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.5 9 0.5 10 0.5 11 0.5 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 0.5 20 1.0 21 2.0 22 1.0 23 0.5 24 0.5 25 0.0 26 1.0 27 5.0 28 4.5 29 5.0 30 8.5 31 10.5 32 12.5 33 23.5 34 38.5 35 53.5 36 75.0 37 89.5 38 112.0 39 152.5 40 197.0 41 236.5 42 277.0 43 305.5 44 316.0 45 305.5 46 270.5 47 256.0 48 245.5 49 211.0 50 169.0 51 143.5 52 122.0 53 95.0 54 71.5 55 52.0 56 42.5 57 33.0 58 18.5 59 9.0 60 7.0 61 3.0 62 1.5 63 1.5 64 1.5 65 1.0 66 2.0 67 1.5 68 0.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.5 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.125 2 0.0 3 0.0 4 0.0 5 0.0 6 0.025 7 0.075 8 0.125 9 0.0 10-14 0.005 15-19 0.065 20-24 0.13 25-29 0.16 30-34 0.25 35-39 0.33999999999999997 40-44 0.325 45-49 0.185 50-54 0.09 55-59 0.105 60-64 0.05 65-69 0.06 70-74 0.04 75-79 0.005 80-84 0.045 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.01 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.41250000000000003 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.825 #Duplication Level Percentage of deduplicated Percentage of total 1 99.13989375158107 97.975 2 0.7336200354161396 1.4500000000000002 3 0.0 0.0 4 0.07589172780166961 0.3 5 0.025297242600556536 0.125 6 0.025297242600556536 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCTTGAGCAAATTCAGTTTCTAAGCAAAAGCTTTCCAGGCCCCTTTATCC 6 0.15 No Hit GGCTTGAGCAGATTCATTCGCCAACTAACCCTTTAATTTATCCTATTTTT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.037500000000000006 0.0 0.0 0.0 0.0 82-83 0.1125 0.0 0.0 0.0 0.0 84-85 0.2 0.0 0.0 0.0 0.0 86-87 0.2625 0.0 0.0 0.0 0.0 88-89 0.3125 0.0 0.0 0.0 0.0 90-91 0.325 0.0 0.0 0.0 0.0 92-93 0.3625 0.0 0.0 0.0 0.0 94-95 0.4 0.0 0.0 0.0 0.0 96-97 0.4625 0.0 0.0 0.0 0.0 98-99 0.5625 0.0 0.0 0.0 0.0 100-101 0.7625 0.0 0.0 0.0 0.0 102-103 0.9 0.0 0.0 0.0 0.0 104-105 1.0 0.0 0.0 0.0 0.0 106-107 1.0750000000000002 0.0 0.0 0.0 0.0 108-109 1.225 0.0 0.0 0.0 0.0 110-111 1.475 0.0 0.0 0.0 0.0 112-113 1.6875 0.0 0.0 0.0 0.0 114-115 1.825 0.0 0.0 0.0 0.0 116-117 2.1625 0.0 0.0 0.0 0.0 118-119 2.5125 0.0 0.0 0.0 0.0 120-121 2.8 0.0 0.0 0.0 0.0 122-123 3.4124999999999996 0.0 0.0 0.0 0.0 124-125 3.7125 0.0 0.0 0.0 0.0 126-127 4.0875 0.0 0.0 0.0 0.0 128-129 4.550000000000001 0.0 0.0 0.0 0.0 130-131 5.125 0.0 0.0 0.0 0.0 132-133 5.475 0.0 0.0 0.0 0.0 134-135 5.9375 0.0 0.0 0.0 0.0 136-137 6.6375 0.0 0.0 0.0 0.0 138-139 7.074999999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGGGTAG 10 0.006830828 145.0 9 AAGGGTA 10 0.006830828 145.0 8 TGTTAGA 10 0.006830828 145.0 145 >>END_MODULE Read 633752 spots for SRR7180066.sra Written 633752 spots for SRR7180066.sra Read 633752 spots for SRR7180066.sra Written 633752 spots for SRR7180066.sra Read 633752 spots for SRR7180066.sra Written 633752 spots for SRR7180066.sra Read 633752 spots for SRR7180066.sra Written 633752 spots for SRR7180066.sra Read 633752 spots for SRR7180066.sra Written 633752 spots for SRR7180066.sra Read 633752 spots for SRR7180066.sra Written 633752 spots for SRR7180066.sra Read 633752 spots for SRR7180066.sra Written 633752 spots for SRR7180066.sra Read 633752 spots for SRR7180066.sra Written 633752 spots for SRR7180066.sra Read 633752 spots for SRR7180066.sra Written 633752 spots for SRR7180066.sra Read 633752 spots for SRR7180066.sra Written 633752 spots for SRR7180066.sra Read 633752 spots for SRR7180066.sra Written 633752 spots for SRR7180066.sra Read 633752 spots for SRR7180066.sra Written 633752 spots for SRR7180066.sra Read 633752 spots for SRR7180066.sra Written 633752 spots for SRR7180066.sra Read 633752 spots for SRR7180066.sra Written 633752 spots for SRR7180066.sra Read 633753 spots for SRR7180066.sra Written 633753 spots for SRR7180066.sra Read 633752 spots for SRR7180066.sra Written 633752 spots for SRR7180066.sra Read 633752 spots for SRR7180066.sra Written 633752 spots for SRR7180066.sra Read 633752 spots for SRR7180066.sra Written 633752 spots for SRR7180066.sra Read 633752 spots for SRR7180066.sra Written 633752 spots for SRR7180066.sra Read 633752 spots for SRR7180066.sra Written 633752 spots for SRR7180066.sra SRR ids: ['SRR7180066.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_j3o6clvs SRR7180066.sra spots: 12675041 blocks: [[1, 633752], [633753, 1267504], [1267505, 1901256], [1901257, 2535008], [2535009, 3168760], [3168761, 3802512], [3802513, 4436264], [4436265, 5070016], [5070017, 5703768], [5703769, 6337520], [6337521, 6971272], [6971273, 7605024], [7605025, 8238776], [8238777, 8872528], [8872529, 9506280], [9506281, 10140032], [10140033, 10773784], [10773785, 11407536], [11407537, 12041288], [12041289, 12675041]] SRR7180066 file size 4273455 SRR7180066 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7180066 SRR7180066_1.fastq SRR7180066_2.fastq Input file: SRR7180066_1.fastq Paired file: SRR7180066_2.fastq trimmed: SRR7180066-trimmed-pair1.fastq, SRR7180066-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 17:44:47 2025 >> started Mon Feb 10 17:45:06 2025 >> done (19.621s) 12675041 read pairs processed; of these: 20744 ( 0.16%) short read pairs filtered out after trimming by size control 13227 ( 0.10%) empty read pairs filtered out after trimming by size control 12641070 (99.73%) read pairs available; of these: 4652971 (36.81%) trimmed read pairs available after processing 7988099 (63.19%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 3 0.00% 20 4 0.00% 21 4 0.00% 22 6 0.00% 23 11 0.00% 24 6 0.00% 25 8 0.00% 26 11 0.00% 27 11 0.00% 28 7 0.00% 29 9 0.00% 30 7 0.00% 31 9 0.00% 32 12 0.00% 33 13 0.00% 34 13 0.00% 35 13 0.00% 36 6 0.00% 37 9 0.00% 38 5 0.00% 39 10 0.00% 40 12 0.00% 41 11 0.00% 42 10 0.00% 43 6 0.00% 44 9 0.00% 45 8 0.00% 46 6 0.00% 47 15 0.00% 48 17 0.00% 49 16 0.00% 50 22 0.00% 51 23 0.00% 52 33 0.00% 53 30 0.00% 54 43 0.00% 55 41 0.00% 56 50 0.00% 57 59 0.00% 58 72 0.00% 59 80 0.00% 60 100 0.00% 61 113 0.00% 62 119 0.00% 63 121 0.00% 64 162 0.00% 65 124 0.00% 66 177 0.00% 67 199 0.00% 68 203 0.00% 69 245 0.00% 70 301 0.00% 71 304 0.00% 72 369 0.00% 73 468 0.00% 74 510 0.00% 75 623 0.00% 76 770 0.01% 77 778 0.01% 78 865 0.01% 79 1018 0.01% 80 1150 0.01% 81 1289 0.01% 82 1506 0.01% 83 1761 0.01% 84 2707 0.02% 85 3610 0.03% 86 4039 0.03% 87 4644 0.04% 88 4911 0.04% 89 4975 0.04% 90 5245 0.04% 91 5593 0.04% 92 5747 0.05% 93 5929 0.05% 94 6332 0.05% 95 6762 0.05% 96 7192 0.06% 97 7566 0.06% 98 7944 0.06% 99 8560 0.07% 100 8999 0.07% 101 9493 0.08% 102 10243 0.08% 103 10838 0.09% 104 11573 0.09% 105 12616 0.10% 106 13230 0.10% 107 13850 0.11% 108 14337 0.11% 109 15075 0.12% 110 16176 0.13% 111 16868 0.13% 112 18031 0.14% 113 18868 0.15% 114 20037 0.16% 115 21277 0.17% 116 21761 0.17% 117 22588 0.18% 118 23788 0.19% 119 24898 0.20% 120 26315 0.21% 121 26670 0.21% 122 28202 0.22% 123 28653 0.23% 124 30433 0.24% 125 30867 0.24% 126 32473 0.26% 127 33380 0.26% 128 34419 0.27% 129 35558 0.28% 130 36626 0.29% 131 38548 0.30% 132 40410 0.32% 133 41885 0.33% 134 44293 0.35% 135 45658 0.36% 136 47394 0.37% 137 49294 0.39% 138 51919 0.41% 139 54460 0.43% 140 57564 0.46% 141 61014 0.48% 142 65408 0.52% 143 70762 0.56% 144 78656 0.62% 145 88993 0.70% 146 104442 0.83% 147 130943 1.04% 148 188372 1.49% 149 365969 2.90% 150 2253073 17.82% 151 7988099 63.19% 12641070 reads passed initial QC criterion=sequence-density sequence-density=0.98 sequence-density-rank=1 fanout-score=3.02 fanout-score-rank=14 prefix-density=1.44 prefix-fanout=2.0 sequence=CACTTGCAGCCATTCTCAGCACC criterion=fanout-score sequence-density=0.14 sequence-density-rank=18 fanout-score=29.58 fanout-score-rank=1 prefix-density=0.45 prefix-fanout=9.2 sequence=CCTTCCTTGTCCTGGATCTT criterion=sequence-density sequence-density=1.26 sequence-density-rank=1 fanout-score=2.46 fanout-score-rank=13 prefix-density=1.28 prefix-fanout=2.4 sequence=ATGTACCCTGACTT criterion=fanout-score sequence-density=0.13 sequence-density-rank=20 fanout-score=23.95 fanout-score-rank=1 prefix-density=1.28 prefix-fanout=2.5 sequence=TGTACCCTGACATGAGCTCCTCAGAGACGATCACCAACGAAACTCTGGTTCTTGGTGTGGCACCAGAGAAGGGTCACTTTGCGGGAGCTGCTGAGACGGTCGTGGGAGCCGAGAATGGCTG SRR7180066 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 17:45:54 Started mapping on | Feb 10 17:45:55 Finished on | Feb 10 17:47:05 Mapping speed, Million of reads per hour | 650.11 Number of input reads | 12641070 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 11900472 Uniquely mapped reads % | 94.14% Average mapped length | 294.43 Number of splices: Total | 11100728 Number of splices: Annotated (sjdb) | 10889036 Number of splices: GT/AG | 10918626 Number of splices: GC/AG | 143218 Number of splices: AT/AC | 8730 Number of splices: Non-canonical | 30154 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.04% Deletion average length | 2.81 Insertion rate per base | 0.02% Insertion average length | 2.55 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 319451 % of reads mapped to multiple loci | 2.53% Number of reads mapped to too many loci | 21353 % of reads mapped to too many loci | 0.17% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.12% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 443974 443974 443974 N_multimapping 319451 319451 319451 N_noFeature 290475 11765079 337151 N_ambiguous 143241 806 54260 UnstrandedReadsAssigned:11466756 PositiveStrandReadsAssigned:134587 NegativeStrandReadsAssigned:11509061 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7180066 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7180066-trimmed-pair1.fastq SRR7180066-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,641,070 reads, 11,382,146 reads pseudoaligned [quant] estimated average fragment length: 227.855 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,111 rounds 52401 SRR7180066.ke.tsv 34699 SRR7180066.se.tsv 87100 total ==> SRR7180066.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1791.14 1092 41.0594 Potri.005G024800.1.v4.1 1035 808.145 380 31.6676 Potri.004G059700.1.v4.1 961 734.145 25 2.2934 Potri.007G009000.2.v4.1 1416 1189.14 0 0 Potri.003G141000.2.v4.1 2943 2716.14 549.274 13.6194 Potri.016G087400.1.v4.1 270 81.3615 996 824.444 Potri.015G069301.1.v4.1 564 339.157 0 0 Potri.010G195200.1.v4.1 1773 1546.14 454 19.7755 Potri.012G127500.1.v4.1 977 750.145 1640 147.238 ==> SRR7180066.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 16 Potri.001G233950.v4.1 3 Potri.001G122700.v4.1 674 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 4 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 232 SRR7180066 completed mapping pipeline successfully