Starting /dee2/code/volunteer_pipeline.sh SRR7180067 current disk space = 3058299666432 free memory = 1302699268 SRR7180067 SRAfilesize f399627b133a83775efcc894b46303f2 SRR7180067.sra SRR7180067.sra file validated SRR7180067 is paired end SRR7180067 is conventional basespace SRR7180067 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7180067_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 28.519 33.0 27.0 33.0 18.0 34.0 2 31.43575 33.0 31.0 33.0 27.0 34.0 3 31.718 33.0 31.0 33.0 27.0 34.0 4 32.4815 33.0 33.0 33.0 32.0 34.0 5 32.458 33.0 33.0 33.0 31.0 34.0 6 36.88425 38.0 37.0 38.0 35.0 38.0 7 37.445 38.0 38.0 38.0 37.0 38.0 8 37.59525 38.0 38.0 38.0 37.0 38.0 9 37.66225 38.0 38.0 38.0 38.0 38.0 10-14 37.6693 38.0 38.0 38.0 38.0 38.0 15-19 37.661449999999995 38.0 38.0 38.0 38.0 38.0 20-24 37.6507 38.0 38.0 38.0 38.0 38.0 25-29 37.6312 38.0 38.0 38.0 38.0 38.0 30-34 37.58075 38.0 38.0 38.0 38.0 38.0 35-39 37.570899999999995 38.0 38.0 38.0 38.0 38.0 40-44 37.5691 38.0 38.0 38.0 38.0 38.0 45-49 37.544700000000006 38.0 38.0 38.0 38.0 38.0 50-54 37.479150000000004 38.0 38.0 38.0 37.6 38.0 55-59 37.432249999999996 38.0 38.0 38.0 37.0 38.0 60-64 37.431 38.0 38.0 38.0 37.0 38.0 65-69 37.33655 38.0 38.0 38.0 37.0 38.0 70-74 37.32925 38.0 38.0 38.0 37.0 38.0 75-79 37.226150000000004 38.0 38.0 38.0 36.6 38.0 80-84 37.2436 38.0 38.0 38.0 36.6 38.0 85-89 37.17565 38.0 38.0 38.0 36.0 38.0 90-94 37.05459999999999 38.0 38.0 38.0 36.0 38.0 95-99 37.06849999999999 38.0 38.0 38.0 36.0 38.0 100-104 36.8409 38.0 38.0 38.0 35.4 38.0 105-109 36.799 38.0 38.0 38.0 35.2 38.0 110-114 36.6665 38.0 38.0 38.0 34.8 38.0 115-119 36.62405 38.0 38.0 38.0 34.2 38.0 120-124 36.55935 38.0 38.0 38.0 34.4 38.0 125-129 36.520300000000006 38.0 38.0 38.0 34.0 38.0 130-134 36.23745 38.0 38.0 38.0 34.0 38.0 135-139 35.981049999999996 38.0 37.0 38.0 33.0 38.0 140-144 35.7543 38.0 36.2 38.0 32.6 38.0 145-149 35.388400000000004 38.0 36.0 38.0 31.4 38.0 150-151 32.571625 36.5 33.5 38.0 16.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 1.0 10 1.0 11 0.0 12 2.0 13 0.0 14 0.0 15 2.0 16 0.0 17 0.0 18 0.0 19 1.0 20 2.0 21 2.0 22 2.0 23 3.0 24 5.0 25 9.0 26 9.0 27 10.0 28 12.0 29 22.0 30 26.0 31 39.0 32 51.0 33 59.0 34 97.0 35 177.0 36 522.0 37 2946.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.1458829759068 15.70029123643103 13.794016415144295 33.35980937251787 2 21.75 21.4 35.425000000000004 21.425 3 19.975 27.800000000000004 27.175 25.05 4 22.55 33.75 23.75 19.950000000000003 5 21.55 35.425000000000004 24.099999999999998 18.925 6 18.175 35.5 25.324999999999996 21.0 7 13.275 21.475 45.125 20.125 8 17.25 22.025 29.599999999999998 31.125000000000004 9 19.2 22.35 31.3 27.150000000000002 10-14 20.599999999999998 28.444999999999997 26.52 24.435000000000002 15-19 19.97 27.255000000000003 28.71 24.065 20-24 20.075000000000003 28.249999999999996 28.16 23.515 25-29 19.68 28.105000000000004 28.255000000000003 23.96 30-34 20.195 28.22 28.64 22.945 35-39 19.93 27.98 28.095 23.995 40-44 20.205000000000002 27.994999999999997 28.28 23.52 45-49 20.225 27.705000000000002 28.249999999999996 23.82 50-54 19.925 28.610000000000003 27.675 23.79 55-59 20.275000000000002 28.21 27.41 24.104999999999997 60-64 19.895 28.199999999999996 27.6 24.305 65-69 19.439999999999998 27.355 29.13 24.075 70-74 20.195 27.810000000000002 28.23 23.765 75-79 20.36 28.42 28.12 23.1 80-84 20.36 28.03 27.85 23.76 85-89 20.44 28.1 27.705000000000002 23.755000000000003 90-94 20.455000000000002 28.634999999999998 27.755000000000003 23.155 95-99 20.665 28.42 27.38 23.535 100-104 20.05 28.355000000000004 28.000000000000004 23.595 105-109 20.095 28.715000000000003 27.98 23.21 110-114 20.95 28.42 27.644999999999996 22.985 115-119 20.955 27.725 27.544999999999998 23.775 120-124 20.865000000000002 28.299999999999997 27.860000000000003 22.975 125-129 20.549999999999997 28.439999999999998 27.365000000000002 23.645 130-134 20.555 28.03 27.925 23.49 135-139 20.735 27.66 27.560000000000002 24.044999999999998 140-144 20.885 28.025 27.250000000000004 23.84 145-149 20.465 28.405 27.395000000000003 23.735 150-151 21.075672295184493 27.754846779237024 27.27954971857411 23.889931207004377 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.5 14 0.5 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 2.0 24 1.5 25 1.0 26 4.0 27 8.5 28 10.5 29 12.5 30 14.5 31 15.5 32 21.5 33 38.5 34 47.5 35 58.5 36 93.0 37 108.0 38 140.0 39 187.5 40 198.5 41 219.5 42 247.5 43 265.0 44 287.5 45 302.0 46 285.5 47 245.5 48 214.0 49 195.0 50 174.0 51 152.0 52 121.5 53 81.5 54 60.0 55 49.0 56 29.0 57 23.5 58 22.5 59 14.5 60 12.0 61 10.0 62 6.0 63 4.0 64 4.5 65 3.0 66 1.5 67 0.5 68 0.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 5.575 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0625 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62358845671268 99.25 2 0.37641154328732745 0.75 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0125 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.1125 0.0 0.0 0.0 0.0 92-93 0.15 0.0 0.0 0.0 0.0 94-95 0.1875 0.0 0.0 0.0 0.0 96-97 0.225 0.0 0.0 0.0 0.0 98-99 0.25 0.0 0.0 0.0 0.0 100-101 0.3125 0.0 0.0 0.0 0.0 102-103 0.375 0.0 0.0 0.0 0.0 104-105 0.4375 0.0 0.0 0.0 0.0 106-107 0.5 0.0 0.0 0.0 0.0 108-109 0.5 0.0 0.0 0.0 0.0 110-111 0.6125 0.0 0.0 0.0 0.0 112-113 0.7625 0.0 0.0 0.0 0.0 114-115 0.775 0.0 0.0 0.0 0.0 116-117 0.7875000000000001 0.0 0.0 0.0 0.0 118-119 1.0375 0.0 0.0 0.0 0.0 120-121 1.2000000000000002 0.0 0.0 0.0 0.0 122-123 1.4875 0.0 0.0 0.0 0.0 124-125 1.75 0.0 0.0 0.0 0.0 126-127 1.95 0.0 0.0 0.0 0.0 128-129 2.2750000000000004 0.0 0.0 0.0 0.0 130-131 2.575 0.0 0.0 0.0 0.0 132-133 2.9625 0.0 0.0 0.0 0.0 134-135 3.175 0.0 0.0 0.0 0.0 136-137 3.5 0.0 0.0 0.0 0.0 138-139 3.75 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCCTAGC 10 0.006843168 144.91249 6 CCTAGCA 10 0.006843168 144.91249 7 >>END_MODULE SRR7180067 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7180067_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.03375 33.0 33.0 34.0 33.0 34.0 2 33.19975 34.0 33.0 34.0 33.0 34.0 3 33.285 34.0 33.0 34.0 33.0 34.0 4 33.28675 34.0 33.0 34.0 33.0 34.0 5 33.25825 34.0 33.0 34.0 33.0 34.0 6 37.42325 38.0 38.0 38.0 38.0 38.0 7 37.4925 38.0 38.0 38.0 38.0 38.0 8 37.41 38.0 38.0 38.0 38.0 38.0 9 37.36 38.0 38.0 38.0 38.0 38.0 10-14 37.414649999999995 38.0 38.0 38.0 37.8 38.0 15-19 37.385400000000004 38.0 38.0 38.0 37.2 38.0 20-24 37.359899999999996 38.0 38.0 38.0 37.0 38.0 25-29 37.4226 38.0 38.0 38.0 37.4 38.0 30-34 37.354 38.0 38.0 38.0 37.8 38.0 35-39 37.26065 38.0 38.0 38.0 37.0 38.0 40-44 37.272600000000004 38.0 38.0 38.0 37.0 38.0 45-49 37.258599999999994 38.0 38.0 38.0 37.0 38.0 50-54 37.25895 38.0 38.0 38.0 37.0 38.0 55-59 37.2063 38.0 38.0 38.0 37.0 38.0 60-64 37.079750000000004 38.0 38.0 38.0 36.6 38.0 65-69 36.97865 38.0 38.0 38.0 36.0 38.0 70-74 37.061699999999995 38.0 38.0 38.0 36.0 38.0 75-79 37.0515 38.0 38.0 38.0 36.0 38.0 80-84 36.898250000000004 38.0 38.0 38.0 36.0 38.0 85-89 36.79895 38.0 38.0 38.0 35.6 38.0 90-94 36.6962 38.0 38.0 38.0 35.0 38.0 95-99 36.65145 38.0 38.0 38.0 34.8 38.0 100-104 36.53765 38.0 38.0 38.0 34.6 38.0 105-109 36.393550000000005 38.0 38.0 38.0 34.0 38.0 110-114 36.3846 38.0 38.0 38.0 34.0 38.0 115-119 36.245450000000005 38.0 38.0 38.0 34.0 38.0 120-124 36.125449999999994 38.0 37.8 38.0 33.8 38.0 125-129 35.75615 38.0 37.0 38.0 32.2 38.0 130-134 35.4632 38.0 36.2 38.0 31.0 38.0 135-139 35.3125 38.0 36.0 38.0 31.0 38.0 140-144 34.84159999999999 38.0 35.6 38.0 28.4 38.0 145-149 34.5135 38.0 35.6 38.0 28.0 38.0 150-151 30.786125 36.5 30.0 38.0 8.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 3 1.0 4 2.0 5 4.0 6 2.0 7 1.0 8 0.0 9 0.0 10 1.0 11 1.0 12 2.0 13 3.0 14 3.0 15 1.0 16 1.0 17 4.0 18 0.0 19 2.0 20 4.0 21 3.0 22 7.0 23 7.0 24 7.0 25 5.0 26 15.0 27 15.0 28 22.0 29 28.0 30 42.0 31 41.0 32 66.0 33 79.0 34 119.0 35 214.0 36 535.0 37 2763.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.4274962368289 15.830406422478676 19.14199698946312 28.6001003512293 2 26.382978723404253 22.252816020025033 33.64205256570713 17.72215269086358 3 19.88991743807856 26.1195896922692 33.274956217162874 20.715536652489366 4 24.275 32.824999999999996 22.875 20.025000000000002 5 23.075000000000003 36.05 22.075 18.8 6 19.075 36.075 23.925 20.925 7 17.974999999999998 17.675 42.85 21.5 8 21.6 22.275 26.825 29.299999999999997 9 21.85 25.974999999999998 27.650000000000002 24.525 10-14 23.105 28.244999999999997 26.35 22.3 15-19 23.14 27.655 28.03 21.175 20-24 22.465 28.4 28.155 20.979999999999997 25-29 22.439999999999998 28.060000000000002 27.725 21.775 30-34 22.42008904006803 28.26271822320044 28.522835275874144 20.794357460857384 35-39 23.164322538665598 28.249662145252515 27.62400520546574 20.96201011061615 40-44 23.371877659308204 28.933273264253888 27.206287230314864 20.48856184612304 45-49 23.14 28.199999999999996 27.82 20.84 50-54 22.505 28.58 27.58 21.335 55-59 23.21 27.6 28.405 20.785 60-64 22.59 27.955000000000002 28.57 20.885 65-69 22.955000000000002 28.285 27.779999999999998 20.979999999999997 70-74 23.415 28.225 27.62 20.74 75-79 23.285 28.139999999999997 27.68 20.895 80-84 23.5 28.055000000000003 27.775 20.669999999999998 85-89 23.575 28.199999999999996 27.685 20.54 90-94 23.25 27.63 28.26 20.86 95-99 23.28 27.639999999999997 28.035 21.044999999999998 100-104 23.485 28.455000000000002 27.395000000000003 20.665 105-109 24.15 27.779999999999998 27.625 20.445 110-114 23.635 28.4 27.625 20.34 115-119 23.84 28.23 27.705000000000002 20.225 120-124 23.95 27.99 27.265 20.794999999999998 125-129 24.335 27.88 27.250000000000004 20.535 130-134 23.895 28.165000000000003 27.700000000000003 20.24 135-139 23.915 28.605000000000004 27.189999999999998 20.29 140-144 24.04 28.07 27.51 20.380000000000003 145-149 24.125 28.235 27.700000000000003 19.939999999999998 150-151 24.473156046161566 28.21123933768189 26.204214751630705 21.11138986452584 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.0 24 0.5 25 1.5 26 3.5 27 2.5 28 3.0 29 7.0 30 9.5 31 12.5 32 14.5 33 26.0 34 44.5 35 64.0 36 81.5 37 111.0 38 162.0 39 181.5 40 195.0 41 233.0 42 272.5 43 289.5 44 284.0 45 285.5 46 265.5 47 245.0 48 227.0 49 197.0 50 170.0 51 140.5 52 110.5 53 79.5 54 65.0 55 61.0 56 43.0 57 26.0 58 20.5 59 14.5 60 12.0 61 9.5 62 7.5 63 6.5 64 3.5 65 4.5 66 3.0 67 0.5 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.35000000000000003 2 0.125 3 0.075 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.045 35-39 0.105 40-44 0.11499999999999999 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.35000000000000003 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.5 #Duplication Level Percentage of deduplicated Percentage of total 1 99.52261306532664 99.02499999999999 2 0.4522613065326633 0.8999999999999999 3 0.02512562814070352 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0125 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.0875 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.1625 0.0 0.0 0.0 0.0 96-97 0.2 0.0 0.0 0.0 0.0 98-99 0.2375 0.0 0.0 0.0 0.0 100-101 0.3125 0.0 0.0 0.0 0.0 102-103 0.375 0.0 0.0 0.0 0.0 104-105 0.4375 0.0 0.0 0.0 0.0 106-107 0.5 0.0 0.0 0.0 0.0 108-109 0.5 0.0 0.0 0.0 0.0 110-111 0.6125 0.0 0.0 0.0 0.0 112-113 0.7625 0.0 0.0 0.0 0.0 114-115 0.775 0.0 0.0 0.0 0.0 116-117 0.7875000000000001 0.0 0.0 0.0 0.0 118-119 1.0375 0.0 0.0 0.0 0.0 120-121 1.2000000000000002 0.0 0.0 0.0 0.0 122-123 1.4625 0.0 0.0 0.0 0.0 124-125 1.725 0.0 0.0 0.0 0.0 126-127 1.925 0.0 0.0 0.0 0.0 128-129 2.25 0.0 0.0 0.0 0.0 130-131 2.55 0.0 0.0 0.0 0.0 132-133 2.9375 0.0 0.0 0.0 0.0 134-135 3.1500000000000004 0.0 0.0 0.0 0.0 136-137 3.5 0.0 0.0 0.0 0.0 138-139 3.75 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTTGGAC 10 0.0066044205 146.62025 1 GAGATCG 10 0.0066044205 146.62025 145 AACATCA 10 0.0068608476 144.78749 6 >>END_MODULE Read 738518 spots for SRR7180067.sra Written 738518 spots for SRR7180067.sra Read 738518 spots for SRR7180067.sra Written 738518 spots for SRR7180067.sra Read 738518 spots for SRR7180067.sra Written 738518 spots for SRR7180067.sra Read 738518 spots for SRR7180067.sra Written 738518 spots for SRR7180067.sra Read 738518 spots for SRR7180067.sra Written 738518 spots for SRR7180067.sra Read 738518 spots for SRR7180067.sra Written 738518 spots for SRR7180067.sra Read 738518 spots for SRR7180067.sra Written 738518 spots for SRR7180067.sra Read 738518 spots for SRR7180067.sra Written 738518 spots for SRR7180067.sra Read 738518 spots for SRR7180067.sra Written 738518 spots for SRR7180067.sra Read 738518 spots for SRR7180067.sra Written 738518 spots for SRR7180067.sra Read 738527 spots for SRR7180067.sra Written 738527 spots for SRR7180067.sra Read 738518 spots for SRR7180067.sra Written 738518 spots for SRR7180067.sra Read 738518 spots for SRR7180067.sra Written 738518 spots for SRR7180067.sra Read 738518 spots for SRR7180067.sra Written 738518 spots for SRR7180067.sra Read 738518 spots for SRR7180067.sra Written 738518 spots for SRR7180067.sra Read 738518 spots for SRR7180067.sra Written 738518 spots for SRR7180067.sra Read 738518 spots for SRR7180067.sra Written 738518 spots for SRR7180067.sra Read 738518 spots for SRR7180067.sra Written 738518 spots for SRR7180067.sra Read 738518 spots for SRR7180067.sra Written 738518 spots for SRR7180067.sra Read 738518 spots for SRR7180067.sra Written 738518 spots for SRR7180067.sra SRR ids: ['SRR7180067.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_q_szpkn0 SRR7180067.sra spots: 14770369 blocks: [[1, 738518], [738519, 1477036], [1477037, 2215554], [2215555, 2954072], [2954073, 3692590], [3692591, 4431108], [4431109, 5169626], [5169627, 5908144], [5908145, 6646662], [6646663, 7385180], [7385181, 8123698], [8123699, 8862216], [8862217, 9600734], [9600735, 10339252], [10339253, 11077770], [11077771, 11816288], [11816289, 12554806], [12554807, 13293324], [13293325, 14031842], [14031843, 14770369]] SRR7180067 file size 4983493 SRR7180067 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7180067 SRR7180067_1.fastq SRR7180067_2.fastq Input file: SRR7180067_1.fastq Paired file: SRR7180067_2.fastq trimmed: SRR7180067-trimmed-pair1.fastq, SRR7180067-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 16:53:14 2025 >> started Mon Feb 10 16:53:29 2025 >> done (15.065s) 14770369 read pairs processed; of these: 10351 ( 0.07%) short read pairs filtered out after trimming by size control 7868 ( 0.05%) empty read pairs filtered out after trimming by size control 14752150 (99.88%) read pairs available; of these: 5127150 (34.76%) trimmed read pairs available after processing 9625000 (65.24%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 1 0.00% 20 5 0.00% 21 3 0.00% 22 0 0.00% 23 3 0.00% 24 2 0.00% 25 3 0.00% 26 2 0.00% 27 2 0.00% 28 4 0.00% 29 3 0.00% 30 4 0.00% 31 2 0.00% 32 2 0.00% 33 2 0.00% 34 2 0.00% 35 4 0.00% 36 4 0.00% 37 6 0.00% 38 10 0.00% 39 40 0.00% 40 9 0.00% 41 5 0.00% 42 20 0.00% 43 8 0.00% 44 6 0.00% 45 30 0.00% 46 7 0.00% 47 13 0.00% 48 10 0.00% 49 12 0.00% 50 14 0.00% 51 11 0.00% 52 11 0.00% 53 24 0.00% 54 35 0.00% 55 99 0.00% 56 117 0.00% 57 54 0.00% 58 29 0.00% 59 37 0.00% 60 59 0.00% 61 81 0.00% 62 104 0.00% 63 83 0.00% 64 73 0.00% 65 89 0.00% 66 80 0.00% 67 119 0.00% 68 141 0.00% 69 155 0.00% 70 169 0.00% 71 191 0.00% 72 224 0.00% 73 246 0.00% 74 319 0.00% 75 381 0.00% 76 429 0.00% 77 483 0.00% 78 619 0.00% 79 718 0.00% 80 667 0.00% 81 791 0.01% 82 873 0.01% 83 1113 0.01% 84 1655 0.01% 85 2101 0.01% 86 2316 0.02% 87 2633 0.02% 88 2824 0.02% 89 2858 0.02% 90 3133 0.02% 91 3466 0.02% 92 3577 0.02% 93 3840 0.03% 94 4092 0.03% 95 4449 0.03% 96 4737 0.03% 97 5198 0.04% 98 5390 0.04% 99 5705 0.04% 100 6122 0.04% 101 6640 0.05% 102 7110 0.05% 103 7452 0.05% 104 8049 0.05% 105 8656 0.06% 106 9258 0.06% 107 9615 0.07% 108 10484 0.07% 109 10831 0.07% 110 11651 0.08% 111 12175 0.08% 112 12918 0.09% 113 13480 0.09% 114 14246 0.10% 115 15529 0.11% 116 16183 0.11% 117 16991 0.12% 118 17767 0.12% 119 19056 0.13% 120 20899 0.14% 121 21590 0.15% 122 20892 0.14% 123 22286 0.15% 124 23634 0.16% 125 24486 0.17% 126 25189 0.17% 127 26327 0.18% 128 27221 0.18% 129 29013 0.20% 130 30519 0.21% 131 31876 0.22% 132 33815 0.23% 133 35636 0.24% 134 36760 0.25% 135 39222 0.27% 136 41519 0.28% 137 44026 0.30% 138 46390 0.31% 139 49736 0.34% 140 53433 0.36% 141 57394 0.39% 142 63767 0.43% 143 70585 0.48% 144 80439 0.55% 145 92609 0.63% 146 111031 0.75% 147 147992 1.00% 148 224319 1.52% 149 455629 3.09% 150 2837863 19.24% 151 9625000 65.24% 14752150 reads passed initial QC criterion=sequence-density sequence-density=0.27 sequence-density-rank=1 fanout-score=2.49 fanout-score-rank=26 prefix-density=0.30 prefix-fanout=2.2 sequence=CAGGTGCAGTTTGATCCACA criterion=fanout-score sequence-density=0.01 sequence-density-rank=28 fanout-score=40.40 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=4.6 sequence=AACAACAAGAGGAGCGGGCCTAACCAGGCTAAAAACAGGGCAGTTAAACCAACATTAATACCACAACTATCTTAATTGCCACTGACTAGCAATAACAACACCCATTTCTAAAGAAAATATCTTATTCTGCAAATCTCAGACTCTTCTCCCTCGTTGTAAACAAGGAAGAGAAGTACTTGAGTTTGACATGTAGCAAATCAAAGTTTCTAGTGGTGCTTGTTTGCAACAGTGCACTGCTTTCTGATCTCACCCTTGGTACCGGTGAGTGGGTTGTTCTCAGAAAGAATGGTGATAGCCCTAGAAAACTCCTTAAAGAAGTAATCCTGACTCTTGGCCATTTTCTTCACGTAAGGCTTAGTTCTCTTGTCAGTGGCTAGTTGGTGATCCACTATCAACAAGCCCTTGTTGTCCAATATGTTTCTGTAGTAGTTGTTGTCTAGAACCATGGGTGTGCCTCTGTCATTCCTCACATATTGGACAGCTTTAGGGTCTGGGATTGAATCAGGGCACT criterion=sequence-density sequence-density=0.38 sequence-density-rank=1 fanout-score=4.63 fanout-score-rank=15 prefix-density=0.54 prefix-fanout=3.3 sequence=CTGCAAATGTGG criterion=fanout-score sequence-density=0.02 sequence-density-rank=26 fanout-score=97.68 fanout-score-rank=1 prefix-density=0.16 prefix-fanout=14.1 sequence=AAGAAAAACAAAAAAGAAATGGATGCCAAAGCTCTCTTCTTCTTTGCCTTGTTGTCCTTCTCAGCTGTGTCGGTCAGGCCGGCATTAGCAGAAAATGAAGAAGACCCTGGTCTTGTTATGAACTTTTACAAGGATACATGCCCTCAAGCTGAGGACATTGTCAAAGAACAAGTTAGACTCCTTTACAAGAGACACAAAAACACTGCATTTTCTTGGCTAAGAAACATCTTCCATGACTGTGCTGTTCAGTCATGTGATGCTTCACTGCTGCTGGACTCAACAAGGAGGACCTTGTCCGAGAAGGAGACAGACAGGAGCTTTGGCCTCAGGAACTTTAGATACTTTGACGATATCAAAGAAGCTGTTGAAAGAGAGTGTCCTGGAGTCGTTTCCTGTGCTGATATTCTTGTCCTGTCTGCTAGAGATGGCATTGTTTCGCTAGGAGGACCTCATATCCCTCTCAAAACTGGAAGAAGGGATGGCAGGAAGAGCAGAGCAGATGTGATCGAGG SRR7180067 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 16:54:17 Started mapping on | Feb 10 16:54:17 Finished on | Feb 10 16:56:36 Mapping speed, Million of reads per hour | 382.07 Number of input reads | 14752150 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 13530589 Uniquely mapped reads % | 91.72% Average mapped length | 296.69 Number of splices: Total | 13298272 Number of splices: Annotated (sjdb) | 13021171 Number of splices: GT/AG | 13078321 Number of splices: GC/AG | 173586 Number of splices: AT/AC | 11100 Number of splices: Non-canonical | 35265 Mismatch rate per base, % | 0.32% Deletion rate per base | 0.03% Deletion average length | 2.63 Insertion rate per base | 0.02% Insertion average length | 2.64 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 357680 % of reads mapped to multiple loci | 2.42% Number of reads mapped to too many loci | 28533 % of reads mapped to too many loci | 0.19% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.58% % of reads unmapped: other | 0.09% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 874446 874446 874446 N_multimapping 357680 357680 357680 N_noFeature 388694 13394112 446075 N_ambiguous 150452 1059 70603 UnstrandedReadsAssigned:12991443 PositiveStrandReadsAssigned:135418 NegativeStrandReadsAssigned:13013911 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7180067 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7180067-trimmed-pair1.fastq SRR7180067-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,752,150 reads, 12,951,431 reads pseudoaligned [quant] estimated average fragment length: 256.258 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,065 rounds 52401 SRR7180067.ke.tsv 34699 SRR7180067.se.tsv 87100 total ==> SRR7180067.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1762.74 1228 53.55 Potri.005G024800.1.v4.1 1035 779.742 270 26.6172 Potri.004G059700.1.v4.1 961 705.8 36 3.92077 Potri.007G009000.2.v4.1 1416 1160.74 0 0 Potri.003G141000.2.v4.1 2943 2687.74 528.399 15.1121 Potri.016G087400.1.v4.1 270 74.7446 705 725.035 Potri.015G069301.1.v4.1 564 315.174 0 0 Potri.010G195200.1.v4.1 1773 1517.74 459 23.2469 Potri.012G127500.1.v4.1 977 721.795 6737 717.468 ==> SRR7180067.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 260 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 419 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 3 Potri.001G452600.v4.1 396 SRR7180067 completed mapping pipeline successfully