Starting /dee2/code/volunteer_pipeline.sh SRR7180068 current disk space = 3058449854464 free memory = 1410106824 SRR7180068 SRAfilesize fadb131dec71b72335d6d1b30a11c370 SRR7180068.sra SRR7180068.sra file validated SRR7180068 is paired end SRR7180068 is conventional basespace SRR7180068 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7180068_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 42 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 28.097 33.0 18.0 33.0 18.0 34.0 2 30.08425 31.0 28.0 33.0 25.0 34.0 3 31.80825 33.0 31.0 33.0 29.0 34.0 4 32.61525 33.0 33.0 34.0 31.0 34.0 5 32.97525 33.0 33.0 34.0 32.0 34.0 6 37.14625 38.0 37.0 38.0 36.0 38.0 7 37.339 38.0 38.0 38.0 36.0 38.0 8 37.49 38.0 38.0 38.0 37.0 38.0 9 37.67075 38.0 38.0 38.0 38.0 38.0 10-14 37.6128 38.0 38.0 38.0 38.0 38.0 15-19 37.6034 38.0 38.0 38.0 38.0 38.0 20-24 37.53959999999999 38.0 38.0 38.0 38.0 38.0 25-29 37.52745 38.0 38.0 38.0 38.0 38.0 30-34 37.49055 38.0 38.0 38.0 38.0 38.0 35-39 37.3827 38.0 38.0 38.0 38.0 38.0 40-44 37.351099999999995 38.0 38.0 38.0 37.4 38.0 45-49 37.327299999999994 38.0 38.0 38.0 37.6 38.0 50-54 37.2771 38.0 38.0 38.0 37.0 38.0 55-59 37.23895 38.0 38.0 38.0 37.0 38.0 60-64 37.181549999999994 38.0 38.0 38.0 37.0 38.0 65-69 37.1744 38.0 38.0 38.0 37.0 38.0 70-74 37.14575000000001 38.0 38.0 38.0 37.0 38.0 75-79 37.089600000000004 38.0 38.0 38.0 37.0 38.0 80-84 36.999649999999995 38.0 38.0 38.0 36.2 38.0 85-89 36.97234999999999 38.0 38.0 38.0 36.2 38.0 90-94 36.89045 38.0 38.0 38.0 36.0 38.0 95-99 36.780150000000006 38.0 38.0 38.0 36.0 38.0 100-104 36.68085 38.0 38.0 38.0 35.6 38.0 105-109 36.57365 38.0 38.0 38.0 34.8 38.0 110-114 36.44775 38.0 38.0 38.0 34.4 38.0 115-119 36.3625 38.0 38.0 38.0 34.0 38.0 120-124 36.1665 38.0 38.0 38.0 34.0 38.0 125-129 36.0856 38.0 38.0 38.0 33.8 38.0 130-134 35.82469999999999 38.0 37.6 38.0 33.2 38.0 135-139 35.57885 38.0 37.2 38.0 31.6 38.0 140-144 35.43515 38.0 36.2 38.0 31.4 38.0 145-149 35.11764999999999 38.0 36.0 38.0 31.0 38.0 150-151 32.381125 37.0 33.5 38.0 16.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 5 1.0 6 0.0 7 2.0 8 2.0 9 3.0 10 2.0 11 1.0 12 1.0 13 3.0 14 0.0 15 3.0 16 3.0 17 3.0 18 1.0 19 4.0 20 5.0 21 7.0 22 8.0 23 7.0 24 10.0 25 5.0 26 18.0 27 9.0 28 19.0 29 26.0 30 34.0 31 29.0 32 43.0 33 58.0 34 103.0 35 163.0 36 460.0 37 2967.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 32.95483870967742 16.154838709677417 13.883870967741935 37.00645161290323 2 18.71871871871872 18.66866866866867 38.26326326326326 24.34934934934935 3 18.375 24.275 27.55 29.799999999999997 4 20.549999999999997 33.275 22.650000000000002 23.525 5 20.125 33.900000000000006 26.474999999999998 19.5 6 18.0 36.3 27.625 18.075 7 12.45 26.875 42.125 18.55 8 17.5 26.35 31.7 24.45 9 16.7 26.25 34.4 22.650000000000002 10-14 18.709999999999997 32.295 27.405 21.59 15-19 18.834999999999997 31.45 27.54 22.175 20-24 18.725 31.665 27.04 22.57 25-29 19.21 31.314999999999998 27.224999999999998 22.25 30-34 18.490000000000002 30.745 28.165000000000003 22.6 35-39 18.685 30.659999999999997 27.845 22.81 40-44 19.285 30.305 27.985 22.425 45-49 19.225 30.475 27.13 23.169999999999998 50-54 19.634999999999998 30.5 26.995 22.869999999999997 55-59 18.7 30.005 28.4 22.895 60-64 18.94 30.285 27.584999999999997 23.189999999999998 65-69 19.57 29.285 27.525 23.62 70-74 19.195 30.014999999999997 27.575 23.215 75-79 19.3 29.709999999999997 27.744999999999997 23.244999999999997 80-84 19.405 29.880000000000003 27.365000000000002 23.35 85-89 19.335 30.375000000000004 27.175 23.115 90-94 18.93 29.685 27.88 23.505000000000003 95-99 20.03 29.275000000000002 27.565 23.13 100-104 19.35 29.304999999999996 27.860000000000003 23.485 105-109 19.830000000000002 29.404999999999998 27.015 23.75 110-114 19.515 29.45 27.455000000000002 23.580000000000002 115-119 20.27 29.75 26.795 23.185 120-124 20.06 29.75 26.71 23.48 125-129 20.330000000000002 28.84 27.42 23.41 130-134 20.48 29.759999999999998 26.240000000000002 23.52 135-139 20.39 29.115000000000002 26.71 23.785 140-144 20.685000000000002 28.98 26.979999999999997 23.355 145-149 20.54 29.165000000000003 26.534999999999997 23.76 150-151 21.07769423558897 28.045112781954888 25.977443609022554 24.899749373433583 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 8.0 1 4.0 2 1.0 3 1.0 4 0.5 5 1.0 6 1.0 7 1.0 8 0.5 9 0.5 10 1.5 11 1.0 12 0.5 13 0.5 14 1.0 15 2.0 16 1.5 17 0.5 18 0.5 19 1.5 20 2.5 21 3.0 22 3.0 23 3.5 24 7.0 25 12.0 26 13.0 27 10.0 28 13.5 29 26.5 30 41.0 31 55.5 32 73.5 33 80.0 34 87.5 35 117.0 36 136.5 37 155.5 38 187.5 39 190.0 40 202.5 41 230.5 42 243.5 43 243.5 44 242.0 45 230.0 46 206.0 47 191.5 48 171.5 49 161.5 50 138.0 51 111.0 52 95.0 53 67.0 54 55.5 55 47.5 56 30.0 57 23.0 58 15.0 59 11.0 60 12.0 61 7.0 62 5.5 63 4.5 64 4.0 65 4.5 66 1.0 67 0.0 68 0.5 69 1.5 70 1.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.125 2 0.1 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.25 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.275 #Duplication Level Percentage of deduplicated Percentage of total 1 99.44598337950139 98.725 2 0.503651473180559 1.0 3 0.02518257365902795 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.02518257365902795 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 8 0.2 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.1125 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.16249999999999998 0.0 0.0 0.0 0.0 92-93 0.3 0.0 0.0 0.0 0.0 94-95 0.4125 0.0 0.0 0.0 0.0 96-97 0.475 0.0 0.0 0.0 0.0 98-99 0.5375000000000001 0.0 0.0 0.0 0.0 100-101 0.6375 0.0 0.0 0.0 0.0 102-103 0.75 0.0 0.0 0.0 0.0 104-105 0.825 0.0 0.0 0.0 0.0 106-107 1.0125000000000002 0.0 0.0 0.0 0.0 108-109 1.225 0.0 0.0 0.0 0.0 110-111 1.3875 0.0 0.0 0.0 0.0 112-113 1.6124999999999998 0.0 0.0 0.0 0.0 114-115 1.95 0.0 0.0 0.0 0.0 116-117 2.1875 0.0 0.0 0.0 0.0 118-119 2.6624999999999996 0.0 0.0 0.0 0.0 120-121 3.0250000000000004 0.0 0.0 0.0 0.0 122-123 3.5250000000000004 0.0 0.0 0.0 0.0 124-125 4.125 0.0 0.0 0.0 0.0 126-127 4.7375 0.0 0.0 0.0 0.0 128-129 5.175000000000001 0.0 0.0 0.0 0.0 130-131 5.5875 0.0 0.0 0.0 0.0 132-133 6.2875 0.0 0.0 0.0 0.0 134-135 7.112500000000001 0.0 0.0 0.0 0.0 136-137 7.8125 0.0 0.0 0.0 0.0 138-139 8.4375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGCAGCT 10 0.0068378756 144.95 7 ATTTGCA 10 0.0068378756 144.95 6 >>END_MODULE SRR7180068 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7180068_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.95775 33.0 33.0 34.0 32.0 34.0 2 32.994 34.0 33.0 34.0 32.0 34.0 3 33.00925 34.0 33.0 34.0 33.0 34.0 4 32.98025 34.0 33.0 34.0 33.0 34.0 5 33.0135 34.0 33.0 34.0 33.0 34.0 6 37.0595 38.0 38.0 38.0 37.0 38.0 7 37.09075 38.0 38.0 38.0 37.0 38.0 8 37.101 38.0 38.0 38.0 37.0 38.0 9 37.055 38.0 38.0 38.0 37.0 38.0 10-14 37.07855 38.0 38.0 38.0 37.2 38.0 15-19 36.9927 38.0 38.0 38.0 37.0 38.0 20-24 36.982099999999996 38.0 38.0 38.0 37.0 38.0 25-29 36.9319 38.0 38.0 38.0 37.0 38.0 30-34 36.91625 38.0 38.0 38.0 37.0 38.0 35-39 36.80440000000001 38.0 38.0 38.0 37.0 38.0 40-44 36.799699999999994 38.0 38.0 38.0 37.0 38.0 45-49 36.7911 38.0 38.0 38.0 36.2 38.0 50-54 36.8572 38.0 38.0 38.0 36.2 38.0 55-59 36.8196 38.0 38.0 38.0 36.2 38.0 60-64 36.752599999999994 38.0 38.0 38.0 36.0 38.0 65-69 36.61885 38.0 38.0 38.0 36.0 38.0 70-74 36.635200000000005 38.0 38.0 38.0 35.8 38.0 75-79 36.62245 38.0 38.0 38.0 35.8 38.0 80-84 36.57935 38.0 38.0 38.0 35.8 38.0 85-89 36.380399999999995 38.0 38.0 38.0 35.0 38.0 90-94 36.28475 38.0 38.0 38.0 34.6 38.0 95-99 36.31675 38.0 38.0 38.0 34.8 38.0 100-104 36.08845 38.0 38.0 38.0 34.0 38.0 105-109 35.93625 38.0 38.0 38.0 34.0 38.0 110-114 35.8241 38.0 38.0 38.0 33.4 38.0 115-119 35.681650000000005 38.0 38.0 38.0 32.8 38.0 120-124 35.45555 38.0 37.2 38.0 31.4 38.0 125-129 35.19425 38.0 36.6 38.0 31.0 38.0 130-134 34.93235 38.0 36.0 38.0 28.6 38.0 135-139 34.58025 38.0 35.8 38.0 27.0 38.0 140-144 34.228049999999996 38.0 35.0 38.0 25.2 38.0 145-149 33.70025 38.0 34.6 38.0 21.0 38.0 150-151 29.9985 36.5 28.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 18.0 3 6.0 4 5.0 5 2.0 6 0.0 7 3.0 8 3.0 9 3.0 10 4.0 11 5.0 12 3.0 13 3.0 14 5.0 15 5.0 16 1.0 17 6.0 18 8.0 19 7.0 20 9.0 21 7.0 22 10.0 23 7.0 24 7.0 25 11.0 26 14.0 27 16.0 28 21.0 29 23.0 30 40.0 31 40.0 32 62.0 33 75.0 34 114.0 35 225.0 36 517.0 37 2715.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.83883883883884 16.24124124124124 16.74174174174174 28.178178178178175 2 23.025000000000002 24.925 34.525 17.525 3 21.2 27.125 30.8 20.875 4 25.025 33.625 22.625 18.725 5 24.15 35.6 23.625 16.625 6 20.724999999999998 34.699999999999996 26.025 18.55 7 19.529882470617654 19.904976244061015 40.51012753188297 20.05501375343836 8 22.9672254190643 23.492619464598448 28.14610958218664 25.39404553415061 9 22.775000000000002 26.325 27.925 22.975 10-14 23.895 28.645 26.229999999999997 21.23 15-19 23.667100130039014 28.363509052715813 27.808342502750826 20.161048314494348 20-24 23.742555427656274 28.256844001801714 27.76137330463941 20.239227265902606 25-29 23.7284741690028 28.15879054865839 27.798358029635562 20.314377252703245 30-34 23.85247544598116 28.262176788935662 27.470434956905194 20.41491280817799 35-39 23.6869826937547 27.840481565086534 27.153248056182594 21.319287684976175 40-44 23.678403049453305 28.352893971311065 27.425017554418694 20.543685424816932 45-49 24.316474712068104 27.68652979469204 27.691537305958942 20.305458187280923 50-54 24.161913339337538 27.664365055538877 28.249774842389673 19.923946762733912 55-59 24.447112979085357 27.73941759231462 28.23976783748624 19.573701591113778 60-64 24.20105026256564 27.446861715428856 28.197049262315577 20.155038759689923 65-69 23.83214964489347 27.808342502750826 28.283485045513657 20.076022806842055 70-74 23.642364236423642 28.28782878287829 27.792779277927792 20.27702770277028 75-79 24.48 27.22 28.235 20.064999999999998 80-84 23.80095023755939 28.252063015753937 28.267066766691674 19.679919979995 85-89 23.265 27.445000000000004 28.88 20.41 90-94 23.52 28.15 28.43 19.900000000000002 95-99 23.189999999999998 27.97 29.185 19.655 100-104 23.525 27.634999999999998 28.92 19.919999999999998 105-109 23.995 27.42 29.03 19.555 110-114 23.385 27.375 29.349999999999998 19.89 115-119 23.244999999999997 27.595 29.220000000000002 19.939999999999998 120-124 24.29 28.035 28.625 19.05 125-129 24.206210310515523 27.50637531876594 28.921446072303613 19.36596829841492 130-134 24.695 27.650000000000002 28.299999999999997 19.355 135-139 24.4 27.29 29.354999999999997 18.955 140-144 24.085 28.365000000000002 28.57 18.98 145-149 25.6 28.32 27.389999999999997 18.69 150-151 25.273344225210508 28.377529219555107 27.17104436345356 19.17808219178082 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 1.0 13 1.0 14 0.0 15 0.5 16 1.5 17 1.5 18 2.0 19 2.5 20 2.5 21 2.0 22 3.0 23 2.5 24 0.0 25 2.0 26 3.5 27 5.0 28 7.5 29 8.5 30 12.0 31 17.0 32 19.0 33 27.0 34 39.5 35 59.5 36 83.5 37 102.5 38 128.0 39 163.0 40 192.0 41 231.5 42 268.5 43 268.0 44 281.0 45 302.0 46 295.0 47 273.5 48 234.0 49 197.0 50 173.5 51 142.0 52 102.5 53 77.0 54 66.5 55 55.5 56 37.0 57 24.0 58 18.0 59 12.0 60 12.5 61 9.5 62 8.0 63 6.0 64 3.0 65 3.5 66 2.0 67 0.5 68 1.0 69 1.5 70 0.5 71 0.0 72 1.0 73 1.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.1 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.025 8 0.075 9 0.0 10-14 0.0 15-19 0.03 20-24 0.095 25-29 0.12 30-34 0.22 35-39 0.325 40-44 0.31 45-49 0.15 50-54 0.06999999999999999 55-59 0.06999999999999999 60-64 0.025 65-69 0.03 70-74 0.01 75-79 0.0 80-84 0.025 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.005 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.5375 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.25 #Duplication Level Percentage of deduplicated Percentage of total 1 99.3198992443325 98.575 2 0.6297229219143577 1.25 3 0.025188916876574305 0.075 4 0.025188916876574305 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.1125 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.16249999999999998 0.0 0.0 0.0 0.0 92-93 0.3 0.0 0.0 0.0 0.0 94-95 0.4125 0.0 0.0 0.0 0.0 96-97 0.475 0.0 0.0 0.0 0.0 98-99 0.5375000000000001 0.0 0.0 0.0 0.0 100-101 0.6375 0.0 0.0 0.0 0.0 102-103 0.75 0.0 0.0 0.0 0.0 104-105 0.825 0.0 0.0 0.0 0.0 106-107 0.9875 0.0 0.0 0.0 0.0 108-109 1.1749999999999998 0.0 0.0 0.0 0.0 110-111 1.325 0.0 0.0 0.0 0.0 112-113 1.5375 0.0 0.0 0.0 0.0 114-115 1.875 0.0 0.0 0.0 0.0 116-117 2.0875 0.0 0.0 0.0 0.0 118-119 2.5125 0.0 0.0 0.0 0.0 120-121 2.875 0.0 0.0 0.0 0.0 122-123 3.3875 0.0 0.0 0.0 0.0 124-125 3.9875000000000003 0.0 0.0 0.0 0.0 126-127 4.575 0.0 0.0 0.0 0.0 128-129 5.050000000000001 0.0 0.0 0.0 0.0 130-131 5.5125 0.0 0.0 0.0 0.0 132-133 6.175 0.0 0.0 0.0 0.0 134-135 6.925000000000001 0.0 0.0 0.0 0.0 136-137 7.6375 0.0 0.0 0.0 0.0 138-139 8.2375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTCGAAT 10 0.006830828 145.0 2 >>END_MODULE Read 427199 spots for SRR7180068.sra Written 427199 spots for SRR7180068.sra Read 427199 spots for SRR7180068.sra Written 427199 spots for SRR7180068.sra Read 427199 spots for SRR7180068.sra Written 427199 spots for SRR7180068.sra Read 427199 spots for SRR7180068.sra Written 427199 spots for SRR7180068.sra Read 427199 spots for SRR7180068.sra Written 427199 spots for SRR7180068.sra Read 427199 spots for SRR7180068.sra Written 427199 spots for SRR7180068.sra Read 427199 spots for SRR7180068.sra Written 427199 spots for SRR7180068.sra Read 427199 spots for SRR7180068.sra Written 427199 spots for SRR7180068.sra Read 427199 spots for SRR7180068.sra Written 427199 spots for SRR7180068.sra Read 427199 spots for SRR7180068.sra Written 427199 spots for SRR7180068.sra Read 427199 spots for SRR7180068.sra Written 427199 spots for SRR7180068.sra Read 427199 spots for SRR7180068.sra Written 427199 spots for SRR7180068.sra Read 427199 spots for SRR7180068.sra Written 427199 spots for SRR7180068.sra Read 427199 spots for SRR7180068.sra Written 427199 spots for SRR7180068.sra Read 427199 spots for SRR7180068.sra Written 427199 spots for SRR7180068.sra Read 427199 spots for SRR7180068.sra Written 427199 spots for SRR7180068.sra Read 427199 spots for SRR7180068.sra Written 427199 spots for SRR7180068.sra Read 427216 spots for SRR7180068.sra Written 427216 spots for SRR7180068.sra Read 427199 spots for SRR7180068.sra Written 427199 spots for SRR7180068.sra Read 427199 spots for SRR7180068.sra Written 427199 spots for SRR7180068.sra SRR ids: ['SRR7180068.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_yd1ayo4m SRR7180068.sra spots: 8543997 blocks: [[1, 427199], [427200, 854398], [854399, 1281597], [1281598, 1708796], [1708797, 2135995], [2135996, 2563194], [2563195, 2990393], [2990394, 3417592], [3417593, 3844791], [3844792, 4271990], [4271991, 4699189], [4699190, 5126388], [5126389, 5553587], [5553588, 5980786], [5980787, 6407985], [6407986, 6835184], [6835185, 7262383], [7262384, 7689582], [7689583, 8116781], [8116782, 8543997]] SRR7180068 file size 2876423 SRR7180068 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7180068 SRR7180068_1.fastq SRR7180068_2.fastq Input file: SRR7180068_1.fastq Paired file: SRR7180068_2.fastq trimmed: SRR7180068-trimmed-pair1.fastq, SRR7180068-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 16:22:55 2025 >> started Mon Feb 10 16:23:10 2025 >> done (14.586s) 8543997 read pairs processed; of these: 25755 ( 0.30%) short read pairs filtered out after trimming by size control 20645 ( 0.24%) empty read pairs filtered out after trimming by size control 8497597 (99.46%) read pairs available; of these: 3391252 (39.91%) trimmed read pairs available after processing 5106345 (60.09%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 5 0.00% 20 5 0.00% 21 8 0.00% 22 10 0.00% 23 12 0.00% 24 12 0.00% 25 19 0.00% 26 21 0.00% 27 22 0.00% 28 23 0.00% 29 18 0.00% 30 26 0.00% 31 19 0.00% 32 20 0.00% 33 18 0.00% 34 17 0.00% 35 16 0.00% 36 24 0.00% 37 19 0.00% 38 16 0.00% 39 20 0.00% 40 17 0.00% 41 18 0.00% 42 22 0.00% 43 25 0.00% 44 24 0.00% 45 25 0.00% 46 23 0.00% 47 44 0.00% 48 35 0.00% 49 31 0.00% 50 42 0.00% 51 39 0.00% 52 39 0.00% 53 58 0.00% 54 65 0.00% 55 67 0.00% 56 66 0.00% 57 83 0.00% 58 85 0.00% 59 98 0.00% 60 123 0.00% 61 121 0.00% 62 131 0.00% 63 119 0.00% 64 145 0.00% 65 160 0.00% 66 164 0.00% 67 175 0.00% 68 206 0.00% 69 258 0.00% 70 281 0.00% 71 252 0.00% 72 340 0.00% 73 389 0.00% 74 409 0.00% 75 441 0.01% 76 631 0.01% 77 625 0.01% 78 665 0.01% 79 747 0.01% 80 810 0.01% 81 969 0.01% 82 1026 0.01% 83 1404 0.02% 84 2443 0.03% 85 3404 0.04% 86 3825 0.05% 87 4626 0.05% 88 5143 0.06% 89 5291 0.06% 90 5261 0.06% 91 5466 0.06% 92 5802 0.07% 93 5742 0.07% 94 5754 0.07% 95 5967 0.07% 96 6135 0.07% 97 6356 0.07% 98 6699 0.08% 99 7089 0.08% 100 7843 0.09% 101 8141 0.10% 102 8983 0.11% 103 9587 0.11% 104 10288 0.12% 105 11027 0.13% 106 11542 0.14% 107 12124 0.14% 108 12757 0.15% 109 13656 0.16% 110 14418 0.17% 111 15265 0.18% 112 16128 0.19% 113 16855 0.20% 114 18267 0.21% 115 18937 0.22% 116 19658 0.23% 117 20502 0.24% 118 21444 0.25% 119 21911 0.26% 120 23224 0.27% 121 23723 0.28% 122 25364 0.30% 123 25759 0.30% 124 26753 0.31% 125 27613 0.32% 126 28288 0.33% 127 29485 0.35% 128 30123 0.35% 129 30884 0.36% 130 32063 0.38% 131 33748 0.40% 132 34660 0.41% 133 36359 0.43% 134 37785 0.44% 135 39104 0.46% 136 41012 0.48% 137 41793 0.49% 138 43706 0.51% 139 44455 0.52% 140 46594 0.55% 141 48811 0.57% 142 52371 0.62% 143 56461 0.66% 144 61505 0.72% 145 68741 0.81% 146 78168 0.92% 147 96595 1.14% 148 132632 1.56% 149 244534 2.88% 150 1462752 17.21% 151 5106345 60.09% 8497597 reads passed initial QC criterion=sequence-density sequence-density=0.79 sequence-density-rank=1 fanout-score=3.09 fanout-score-rank=19 prefix-density=1.15 prefix-fanout=2.1 sequence=CACTTGCAGCCATTCTCAGCACC criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=171.11 fanout-score-rank=1 prefix-density=0.30 prefix-fanout=7.9 sequence=AGAAAAACATTACGATTATTACATTACATGCGCAATTGGGATAAAAAGGCCCTTGAAGAAATACACGTCACTGTTATAGCACGCGCTTACTTATAGGTACAAATGCACAAAAGGCCAACACGGAGAAAATGGAACAAACTGGGCTTGATTTTCATCTTTAATACATCATCAAATGGCCAAAAGTAAAGCATCACAATCATCACTTCTTGAAAGGAATGGCTCT criterion=sequence-density sequence-density=0.88 sequence-density-rank=1 fanout-score=2.69 fanout-score-rank=26 prefix-density=0.89 prefix-fanout=2.7 sequence=ATGTACCCTGACTTAGGTTTCTCAGA criterion=fanout-score sequence-density=0.12 sequence-density-rank=22 fanout-score=17.45 fanout-score-rank=1 prefix-density=0.79 prefix-fanout=2.6 sequence=GCAAATGAGGAAACATGGGCATGGTTCCAA SRR7180068 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 16:24:09 Started mapping on | Feb 10 16:24:10 Finished on | Feb 10 16:25:41 Mapping speed, Million of reads per hour | 336.17 Number of input reads | 8497597 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 7907685 Uniquely mapped reads % | 93.06% Average mapped length | 292.84 Number of splices: Total | 6137713 Number of splices: Annotated (sjdb) | 5988554 Number of splices: GT/AG | 6026112 Number of splices: GC/AG | 80460 Number of splices: AT/AC | 5106 Number of splices: Non-canonical | 26035 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.04% Deletion average length | 2.78 Insertion rate per base | 0.03% Insertion average length | 2.47 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 207701 % of reads mapped to multiple loci | 2.44% Number of reads mapped to too many loci | 37604 % of reads mapped to too many loci | 0.44% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.95% % of reads unmapped: other | 0.10% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 412334 412334 412334 N_multimapping 207701 207701 207701 N_noFeature 239678 7804482 272376 N_ambiguous 109988 579 39278 UnstrandedReadsAssigned:7558019 PositiveStrandReadsAssigned:102624 NegativeStrandReadsAssigned:7596031 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7180068 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7180068-trimmed-pair1.fastq SRR7180068-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 8,497,597 reads, 7,574,169 reads pseudoaligned [quant] estimated average fragment length: 215.684 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,200 rounds 52401 SRR7180068.ke.tsv 34699 SRR7180068.se.tsv 87100 total ==> SRR7180068.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1803.32 610 34.7907 Potri.005G024800.1.v4.1 1035 820.316 268 33.6015 Potri.004G059700.1.v4.1 961 746.32 7 0.964667 Potri.007G009000.2.v4.1 1416 1201.32 0 0 Potri.003G141000.2.v4.1 2943 2728.32 338 12.7417 Potri.016G087400.1.v4.1 270 85.1849 650 784.793 Potri.015G069301.1.v4.1 564 350.603 0 0 Potri.010G195200.1.v4.1 1773 1558.32 321 21.1862 Potri.012G127500.1.v4.1 977 762.32 3719 501.757 ==> SRR7180068.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 14 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 560 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 267 SRR7180068 completed mapping pipeline successfully