Starting /dee2/code/volunteer_pipeline.sh SRR7180069 current disk space = 3057994375168 free memory = 1576892260 SRR7180069 SRAfilesize dc13b02d9edc8af6ca3224cc7ab72861 SRR7180069.sra SRR7180069.sra file validated SRR7180069 is paired end SRR7180069 is conventional basespace SRR7180069 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7180069_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.12525 33.0 32.0 34.0 18.0 34.0 2 32.44325 33.0 33.0 34.0 28.0 34.0 3 32.913 34.0 33.0 34.0 32.0 34.0 4 32.98225 34.0 33.0 34.0 31.0 34.0 5 33.208 34.0 33.0 34.0 33.0 34.0 6 36.8735 38.0 37.0 38.0 35.0 38.0 7 37.16475 38.0 38.0 38.0 36.0 38.0 8 37.46425 38.0 38.0 38.0 37.0 38.0 9 37.56875 38.0 38.0 38.0 37.0 38.0 10-14 37.56385 38.0 38.0 38.0 37.6 38.0 15-19 37.5827 38.0 38.0 38.0 38.0 38.0 20-24 37.521699999999996 38.0 38.0 38.0 37.6 38.0 25-29 37.52475 38.0 38.0 38.0 38.0 38.0 30-34 37.5 38.0 38.0 38.0 37.8 38.0 35-39 37.49405 38.0 38.0 38.0 37.8 38.0 40-44 37.49085 38.0 38.0 38.0 37.8 38.0 45-49 37.42685 38.0 38.0 38.0 37.0 38.0 50-54 37.35080000000001 38.0 38.0 38.0 37.0 38.0 55-59 37.309850000000004 38.0 38.0 38.0 37.0 38.0 60-64 37.27205 38.0 38.0 38.0 37.0 38.0 65-69 37.25939999999999 38.0 38.0 38.0 37.0 38.0 70-74 37.179 38.0 38.0 38.0 36.4 38.0 75-79 37.1435 38.0 38.0 38.0 36.2 38.0 80-84 37.0615 38.0 38.0 38.0 36.0 38.0 85-89 37.011900000000004 38.0 38.0 38.0 36.0 38.0 90-94 37.017399999999995 38.0 38.0 38.0 36.0 38.0 95-99 36.93105 38.0 38.0 38.0 36.0 38.0 100-104 36.81185000000001 38.0 38.0 38.0 35.0 38.0 105-109 36.721500000000006 38.0 38.0 38.0 34.8 38.0 110-114 36.55835 38.0 38.0 38.0 34.2 38.0 115-119 36.48045 38.0 38.0 38.0 34.2 38.0 120-124 36.323 38.0 38.0 38.0 34.0 38.0 125-129 36.1531 38.0 37.8 38.0 33.6 38.0 130-134 35.96515000000001 38.0 37.6 38.0 33.0 38.0 135-139 35.727500000000006 38.0 36.8 38.0 32.0 38.0 140-144 35.52395 38.0 36.2 38.0 31.2 38.0 145-149 35.15285 38.0 36.0 38.0 31.0 38.0 150-151 32.298375 36.5 33.5 38.0 16.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 1.0 10 0.0 11 2.0 12 1.0 13 1.0 14 1.0 15 1.0 16 2.0 17 2.0 18 1.0 19 1.0 20 1.0 21 3.0 22 4.0 23 9.0 24 5.0 25 7.0 26 5.0 27 17.0 28 26.0 29 27.0 30 30.0 31 36.0 32 46.0 33 72.0 34 112.0 35 200.0 36 488.0 37 2899.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.17001338688086 13.360107095046855 12.530120481927712 34.93975903614458 2 20.95 17.875 37.8 23.375 3 19.55 25.45 26.3 28.7 4 22.55 31.374999999999996 22.35 23.724999999999998 5 21.7 32.7 25.05 20.549999999999997 6 18.775 33.650000000000006 25.324999999999996 22.25 7 15.2 21.45 42.699999999999996 20.65 8 17.299999999999997 24.325 30.525000000000002 27.85 9 17.95 22.975 32.45 26.625 10-14 19.82 28.02 27.33 24.83 15-19 20.0 28.000000000000004 28.050000000000004 23.95 20-24 19.625 27.82 28.050000000000004 24.505 25-29 20.169999999999998 28.194999999999997 28.1 23.535 30-34 20.155 27.169999999999998 28.849999999999998 23.825 35-39 20.025000000000002 27.405 28.255000000000003 24.315 40-44 20.195 27.389999999999997 28.299999999999997 24.115000000000002 45-49 20.51 27.185 28.37 23.935000000000002 50-54 20.61 27.36 28.26 23.77 55-59 20.235 27.57 28.52 23.674999999999997 60-64 20.225 27.589999999999996 27.92 24.265 65-69 20.855 27.389999999999997 27.77 23.985 70-74 20.09 27.589999999999996 28.299999999999997 24.02 75-79 20.244999999999997 27.650000000000002 28.134999999999998 23.97 80-84 20.665 27.74 27.735 23.86 85-89 19.86 27.66 27.85 24.63 90-94 20.815 27.694999999999997 27.515 23.974999999999998 95-99 20.195 27.55 27.98 24.275 100-104 20.745 27.779999999999998 27.43 24.044999999999998 105-109 20.72 26.96 27.839999999999996 24.48 110-114 20.575 28.435 27.084999999999997 23.905 115-119 20.745 28.18 27.195000000000004 23.880000000000003 120-124 21.095 27.650000000000002 27.615000000000002 23.64 125-129 20.794999999999998 27.29 27.794999999999998 24.12 130-134 21.035 27.41 27.384999999999998 24.169999999999998 135-139 20.605 28.26 27.35 23.785 140-144 21.224999999999998 27.675 26.840000000000003 24.26 145-149 21.18 27.565 26.974999999999998 24.279999999999998 150-151 20.7125 27.85 26.625 24.8125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 1.0 5 1.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.5 20 1.0 21 1.5 22 1.0 23 0.5 24 1.0 25 1.0 26 2.0 27 6.5 28 9.0 29 6.5 30 8.5 31 19.0 32 24.0 33 25.5 34 31.0 35 40.0 36 69.0 37 106.0 38 139.0 39 156.0 40 177.0 41 221.5 42 255.0 43 260.5 44 274.5 45 303.0 46 299.0 47 270.5 48 244.5 49 218.5 50 189.5 51 147.5 52 111.5 53 93.0 54 70.5 55 55.5 56 43.0 57 32.0 58 19.5 59 10.0 60 9.5 61 9.0 62 8.5 63 6.5 64 7.0 65 5.5 66 2.0 67 1.0 68 1.0 69 0.5 70 0.0 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 6.625 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.825 #Duplication Level Percentage of deduplicated Percentage of total 1 99.82469321312296 99.65 2 0.1753067868770348 0.35000000000000003 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.1375 0.0 0.0 0.0 0.0 86-87 0.1875 0.0 0.0 0.0 0.0 88-89 0.21250000000000002 0.0 0.0 0.0 0.0 90-91 0.275 0.0 0.0 0.0 0.0 92-93 0.3125 0.0 0.0 0.0 0.0 94-95 0.4375 0.0 0.0 0.0 0.0 96-97 0.5 0.0 0.0 0.0 0.0 98-99 0.625 0.0 0.0 0.0 0.0 100-101 0.7749999999999999 0.0 0.0 0.0 0.0 102-103 0.95 0.0 0.0 0.0 0.0 104-105 1.1124999999999998 0.0 0.0 0.0 0.0 106-107 1.325 0.0 0.0 0.0 0.0 108-109 1.4625 0.0 0.0 0.0 0.0 110-111 1.6125 0.0 0.0 0.0 0.0 112-113 1.8625 0.0 0.0 0.0 0.0 114-115 2.275 0.0 0.0 0.0 0.0 116-117 2.6375 0.0 0.0 0.0 0.0 118-119 3.0125 0.0 0.0 0.0 0.0 120-121 3.4625 0.0 0.0 0.0 0.0 122-123 3.8499999999999996 0.0 0.0 0.0 0.0 124-125 4.175 0.0 0.0 0.0 0.0 126-127 4.4875 0.0 0.0 0.0 0.0 128-129 4.875 0.0 0.0 0.0 0.0 130-131 5.4875 0.0 0.0 0.0 0.0 132-133 6.112500000000001 0.0 0.0 0.0 0.0 134-135 6.6 0.0 0.0 0.0 0.0 136-137 7.2625 0.0 0.0 0.0 0.0 138-139 7.9375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CGAATTA 10 0.006836113 144.9625 2 >>END_MODULE SRR7180069 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7180069_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.846 33.0 33.0 34.0 32.0 34.0 2 32.93975 34.0 33.0 34.0 32.0 34.0 3 33.03325 34.0 33.0 34.0 32.0 34.0 4 33.00925 34.0 33.0 34.0 33.0 34.0 5 32.887 34.0 33.0 34.0 32.0 34.0 6 37.13975 38.0 38.0 38.0 37.0 38.0 7 37.065 38.0 38.0 38.0 37.0 38.0 8 37.1285 38.0 38.0 38.0 37.0 38.0 9 37.06325 38.0 38.0 38.0 37.0 38.0 10-14 37.13045 38.0 38.0 38.0 37.0 38.0 15-19 37.11405 38.0 38.0 38.0 37.0 38.0 20-24 37.11 38.0 38.0 38.0 37.0 38.0 25-29 37.06085 38.0 38.0 38.0 37.0 38.0 30-34 36.989149999999995 38.0 38.0 38.0 37.0 38.0 35-39 36.95185 38.0 38.0 38.0 36.6 38.0 40-44 36.9495 38.0 38.0 38.0 36.8 38.0 45-49 36.95765 38.0 38.0 38.0 36.8 38.0 50-54 36.9647 38.0 38.0 38.0 36.6 38.0 55-59 36.9243 38.0 38.0 38.0 36.4 38.0 60-64 36.85785 38.0 38.0 38.0 36.0 38.0 65-69 36.8015 38.0 38.0 38.0 36.0 38.0 70-74 36.758 38.0 38.0 38.0 36.0 38.0 75-79 36.74465 38.0 38.0 38.0 36.0 38.0 80-84 36.671549999999996 38.0 38.0 38.0 35.8 38.0 85-89 36.55165 38.0 38.0 38.0 35.0 38.0 90-94 36.48505 38.0 38.0 38.0 35.0 38.0 95-99 36.36045 38.0 38.0 38.0 34.0 38.0 100-104 36.26495 38.0 38.0 38.0 34.0 38.0 105-109 36.12 38.0 38.0 38.0 33.8 38.0 110-114 36.130950000000006 38.0 38.0 38.0 34.0 38.0 115-119 35.9721 38.0 38.0 38.0 33.6 38.0 120-124 35.767700000000005 38.0 37.4 38.0 32.6 38.0 125-129 35.49435 38.0 37.0 38.0 31.4 38.0 130-134 35.295100000000005 38.0 36.0 38.0 31.0 38.0 135-139 35.1129 38.0 36.0 38.0 30.4 38.0 140-144 34.817750000000004 38.0 36.0 38.0 28.2 38.0 145-149 34.179050000000004 38.0 35.0 38.0 25.2 38.0 150-151 30.662375 36.5 29.0 38.0 8.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 8.0 3 8.0 4 2.0 5 1.0 6 5.0 7 4.0 8 0.0 9 1.0 10 4.0 11 1.0 12 2.0 13 1.0 14 0.0 15 8.0 16 1.0 17 2.0 18 6.0 19 2.0 20 3.0 21 9.0 22 10.0 23 8.0 24 5.0 25 11.0 26 10.0 27 20.0 28 20.0 29 37.0 30 45.0 31 45.0 32 58.0 33 71.0 34 114.0 35 219.0 36 548.0 37 2711.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.5 17.0 14.924999999999999 26.575 2 25.124999999999996 24.175 32.675 18.025 3 21.425 28.849999999999998 30.275000000000002 19.45 4 24.8 33.900000000000006 22.175 19.125 5 24.725 36.6 21.775 16.900000000000002 6 19.3 36.7 24.5 19.5 7 19.950000000000003 17.825 39.875 22.35 8 22.45 24.5 26.200000000000003 26.85 9 22.475 25.5 28.425 23.599999999999998 10-14 23.905 27.810000000000002 26.14 22.145 15-19 23.02 27.715 27.905 21.36 20-24 23.328499274891236 28.22423363504526 27.064059608941342 21.38320748112217 25-29 23.03421368547419 28.461384553821528 27.010804321728692 21.49359743897559 30-34 23.30296355626752 28.594313175810974 27.26271525830997 20.840008009611534 35-39 23.44164622240024 28.383317478596105 26.691032894407453 21.484003404596205 40-44 23.871032342044657 28.431961550015018 27.090217282467204 20.606788825473117 45-49 23.897169150745224 28.123437031109333 27.243172951885562 20.736220866259877 50-54 23.94739473947395 28.052805280528055 27.21272127212721 20.787078707870787 55-59 23.715 28.355000000000004 27.205000000000002 20.724999999999998 60-64 23.87 28.78 26.43 20.919999999999998 65-69 24.169999999999998 27.685 27.36 20.785 70-74 23.9 27.58 27.725 20.794999999999998 75-79 23.74 27.66 27.155 21.445 80-84 23.5 28.32 27.150000000000002 21.029999999999998 85-89 23.549999999999997 28.215 27.505000000000003 20.73 90-94 23.935000000000002 28.765 26.31 20.990000000000002 95-99 23.674999999999997 28.405 27.589999999999996 20.330000000000002 100-104 24.044999999999998 27.800000000000004 27.265 20.89 105-109 24.145 27.834999999999997 27.205000000000002 20.815 110-114 24.05 28.04 26.63 21.279999999999998 115-119 24.785 27.815 27.405 19.994999999999997 120-124 24.46 27.71 26.91 20.919999999999998 125-129 24.6 28.599999999999998 26.279999999999998 20.52 130-134 24.895 29.04 25.825 20.24 135-139 25.275 27.99 26.99 19.744999999999997 140-144 25.525 28.16 26.195 20.119999999999997 145-149 25.105 28.360000000000003 26.965 19.57 150-151 24.878109763720467 27.97849731216402 26.090761345168147 21.052631578947366 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 1.0 24 2.0 25 2.5 26 1.5 27 1.0 28 3.0 29 5.0 30 9.0 31 12.5 32 14.0 33 16.5 34 21.0 35 40.5 36 66.5 37 85.5 38 116.0 39 154.0 40 183.5 41 223.0 42 259.0 43 279.5 44 303.0 45 314.0 46 300.0 47 275.0 48 259.0 49 226.0 50 184.0 51 150.5 52 114.0 53 92.5 54 73.0 55 52.0 56 40.0 57 32.5 58 22.5 59 14.5 60 13.0 61 8.5 62 6.5 63 8.5 64 5.5 65 2.0 66 0.5 67 1.0 68 2.0 69 1.5 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.015 25-29 0.04 30-34 0.12 35-39 0.135 40-44 0.13 45-49 0.03 50-54 0.01 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.775 #Duplication Level Percentage of deduplicated Percentage of total 1 99.77449260836883 99.55000000000001 2 0.22550739163117012 0.44999999999999996 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.1375 0.0 0.0 0.0 0.0 86-87 0.1875 0.0 0.0 0.0 0.0 88-89 0.21250000000000002 0.0 0.0 0.0 0.0 90-91 0.275 0.0 0.0 0.0 0.0 92-93 0.3125 0.0 0.0 0.0 0.0 94-95 0.4375 0.0 0.0 0.0 0.0 96-97 0.5 0.0 0.0 0.0 0.0 98-99 0.6375 0.0 0.0 0.0 0.0 100-101 0.7875 0.0 0.0 0.0 0.0 102-103 0.95 0.0 0.0 0.0 0.0 104-105 1.1124999999999998 0.0 0.0 0.0 0.0 106-107 1.3 0.0 0.0 0.0 0.0 108-109 1.4375 0.0 0.0 0.0 0.0 110-111 1.5875 0.0 0.0 0.0 0.0 112-113 1.8375 0.0 0.0 0.0 0.0 114-115 2.25 0.0 0.0 0.0 0.0 116-117 2.625 0.0 0.0 0.0 0.0 118-119 3.0 0.0 0.0 0.0 0.0 120-121 3.45 0.0 0.0 0.0 0.0 122-123 3.8625 0.0 0.0 0.0 0.0 124-125 4.2 0.0 0.0 0.0 0.0 126-127 4.5125 0.0 0.0 0.0 0.0 128-129 4.8875 0.0 0.0 0.0 0.0 130-131 5.475 0.0 0.0 0.0 0.0 132-133 6.0625 0.0 0.0 0.0 0.0 134-135 6.5375 0.0 0.0 0.0 0.0 136-137 7.1875 0.0 0.0 0.0 0.0 138-139 7.875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TATTGAA 10 0.006830828 145.0 2 >>END_MODULE Read 1017281 spots for SRR7180069.sra Written 1017281 spots for SRR7180069.sra Read 1017281 spots for SRR7180069.sra Written 1017281 spots for SRR7180069.sra Read 1017281 spots for SRR7180069.sra Written 1017281 spots for SRR7180069.sra Read 1017281 spots for SRR7180069.sra Written 1017281 spots for SRR7180069.sra Read 1017281 spots for SRR7180069.sra Written 1017281 spots for SRR7180069.sra Read 1017281 spots for SRR7180069.sra Written 1017281 spots for SRR7180069.sra Read 1017281 spots for SRR7180069.sra Written 1017281 spots for SRR7180069.sra Read 1017281 spots for SRR7180069.sra Written 1017281 spots for SRR7180069.sra Read 1017281 spots for SRR7180069.sra Written 1017281 spots for SRR7180069.sra Read 1017281 spots for SRR7180069.sra Written 1017281 spots for SRR7180069.sra Read 1017281 spots for SRR7180069.sra Written 1017281 spots for SRR7180069.sra Read 1017281 spots for SRR7180069.sra Written 1017281 spots for SRR7180069.sra Read 1017281 spots for SRR7180069.sra Written 1017281 spots for SRR7180069.sra Read 1017281 spots for SRR7180069.sra Written 1017281 spots for SRR7180069.sra Read 1017281 spots for SRR7180069.sra Written 1017281 spots for SRR7180069.sra Read 1017281 spots for SRR7180069.sra Written 1017281 spots for SRR7180069.sra Read 1017281 spots for SRR7180069.sra Written 1017281 spots for SRR7180069.sra Read 1017281 spots for SRR7180069.sra Written 1017281 spots for SRR7180069.sra Read 1017294 spots for SRR7180069.sra Written 1017294 spots for SRR7180069.sra Read 1017281 spots for SRR7180069.sra Written 1017281 spots for SRR7180069.sra SRR ids: ['SRR7180069.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_fqn9ugid SRR7180069.sra spots: 20345633 blocks: [[1, 1017281], [1017282, 2034562], [2034563, 3051843], [3051844, 4069124], [4069125, 5086405], [5086406, 6103686], [6103687, 7120967], [7120968, 8138248], [8138249, 9155529], [9155530, 10172810], [10172811, 11190091], [11190092, 12207372], [12207373, 13224653], [13224654, 14241934], [14241935, 15259215], [15259216, 16276496], [16276497, 17293777], [17293778, 18311058], [18311059, 19328339], [19328340, 20345633]] SRR7180069 file size 6872767 SRR7180069 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7180069 SRR7180069_1.fastq SRR7180069_2.fastq Input file: SRR7180069_1.fastq Paired file: SRR7180069_2.fastq trimmed: SRR7180069-trimmed-pair1.fastq, SRR7180069-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 17:58:12 2025 >> started Mon Feb 10 17:58:33 2025 >> done (21.290s) 20345633 read pairs processed; of these: 39026 ( 0.19%) short read pairs filtered out after trimming by size control 24893 ( 0.12%) empty read pairs filtered out after trimming by size control 20281714 (99.69%) read pairs available; of these: 7734316 (38.13%) trimmed read pairs available after processing 12547398 (61.87%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 2 0.00% 20 5 0.00% 21 4 0.00% 22 5 0.00% 23 5 0.00% 24 8 0.00% 25 6 0.00% 26 17 0.00% 27 8 0.00% 28 6 0.00% 29 3 0.00% 30 13 0.00% 31 6 0.00% 32 7 0.00% 33 5 0.00% 34 3 0.00% 35 8 0.00% 36 3 0.00% 37 11 0.00% 38 9 0.00% 39 10 0.00% 40 11 0.00% 41 9 0.00% 42 15 0.00% 43 20 0.00% 44 13 0.00% 45 17 0.00% 46 23 0.00% 47 21 0.00% 48 18 0.00% 49 29 0.00% 50 24 0.00% 51 28 0.00% 52 45 0.00% 53 43 0.00% 54 57 0.00% 55 56 0.00% 56 69 0.00% 57 89 0.00% 58 75 0.00% 59 98 0.00% 60 114 0.00% 61 138 0.00% 62 153 0.00% 63 176 0.00% 64 201 0.00% 65 200 0.00% 66 242 0.00% 67 279 0.00% 68 345 0.00% 69 381 0.00% 70 449 0.00% 71 548 0.00% 72 605 0.00% 73 755 0.00% 74 810 0.00% 75 979 0.00% 76 1221 0.01% 77 1318 0.01% 78 1495 0.01% 79 1702 0.01% 80 1959 0.01% 81 2211 0.01% 82 2501 0.01% 83 3008 0.01% 84 4825 0.02% 85 6244 0.03% 86 6640 0.03% 87 7347 0.04% 88 7784 0.04% 89 8046 0.04% 90 8560 0.04% 91 9125 0.04% 92 9628 0.05% 93 10512 0.05% 94 11045 0.05% 95 11851 0.06% 96 12940 0.06% 97 13704 0.07% 98 14487 0.07% 99 15448 0.08% 100 16626 0.08% 101 17411 0.09% 102 18621 0.09% 103 20035 0.10% 104 20848 0.10% 105 22516 0.11% 106 24098 0.12% 107 25346 0.12% 108 27040 0.13% 109 28230 0.14% 110 29861 0.15% 111 31143 0.15% 112 32692 0.16% 113 34284 0.17% 114 35753 0.18% 115 37725 0.19% 116 39552 0.20% 117 41967 0.21% 118 43687 0.22% 119 45705 0.23% 120 48515 0.24% 121 49898 0.25% 122 50986 0.25% 123 52885 0.26% 124 54980 0.27% 125 56718 0.28% 126 58967 0.29% 127 60898 0.30% 128 62863 0.31% 129 65097 0.32% 130 68125 0.34% 131 70188 0.35% 132 73366 0.36% 133 76743 0.38% 134 79576 0.39% 135 82573 0.41% 136 85923 0.42% 137 89052 0.44% 138 93890 0.46% 139 98598 0.49% 140 103141 0.51% 141 110137 0.54% 142 118338 0.58% 143 128179 0.63% 144 142449 0.70% 145 159757 0.79% 146 186067 0.92% 147 236530 1.17% 148 335062 1.65% 149 608793 3.00% 150 3452000 17.02% 151 12547398 61.87% 20281714 reads passed initial QC criterion=sequence-density sequence-density=0.39 sequence-density-rank=1 fanout-score=3.57 fanout-score-rank=19 prefix-density=0.43 prefix-fanout=3.2 sequence=CCACATTTGCAGCCA criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=77.40 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=8.5 sequence=CTTTAGCTTCTACTTTTATTTAATAGTTTTATAGATTACACAAAGGAAATACAACACAAGATCTCCCCACAAATCACACACATTGATGCAGTACTGAACTCGTTGCACGAAAGCGCTTAGATATATATTATACAAGTACTAGCATGATCACAAACATGTGATGCTTATTGGTCGAGATCGATGACCCCTTCTATTACTCCGTGCTAAGGGCTTCGTCGATGTCTTTAGTCATATGAACCATAAGATCAACATAAATCTCTGGAACCGGGACTTCAGGATGGAGTTTTTCGTATTCAATGGTCAGTTTTGCCAAGCAGCCCGAGCCTTTTGGTGTAAGCTGCCAGACGGGCCTATAGACCTTGTAAATTTTCATGACATCTCCTTCCAAACCATTAAGAGTTATGATCTTGTTCTCATCATCGAAGGAAACCTCCTCTTTAAAGACCCCGGCTTTCCCTCCGATTGTGTACTGCCAAATCCTGATAGAGCCCGCAGTCTCCCAGTCACCTGC criterion=sequence-density sequence-density=0.49 sequence-density-rank=1 fanout-score=2.27 fanout-score-rank=29 prefix-density=0.52 prefix-fanout=2.2 sequence=GGCAGTGGCTGCAAATGTGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=64.70 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=5.9 sequence=TTTTCTTTGAGAGTGCATAGATTTGTGTTGATATAGAAAACAATGGCACTACATGGAAAGATTGAGACAACATTAGAACTCAAGTCCTCCGCAGAGAAGTTCTACAAAGTGTGGAGGAGCCAGTCCTTCCATGTTCCCAAACATGCTTCCAAGCATATCCAAGGAGTTGATATACATGCAGGTGACTGGGAGACTGCGGGCTCTATCAGGATTTGGCAGTACACAATCGGAGGGAAAGCCGGGGTCTTTAAAGAGGAGGTTTCCTTCGATGATGAGAACAAGATCATAACTCTTAATGGTTTGGAAGGAGATGTCATGAAAATTTACAAGGTCTATAGGCCCGTCTGGCAGCTTACACCAAAAGGCTCGGGCTGCTTGGCAAAACTGACCATTGAATACGAAAAACTCCATCCTGAAGTCCCGGTTCCAGAGATTTATGTTGATCTTATGGTTCATATGACTAAAGACATCGACGAAGCCCTTAGCACGGAGTAATAGAAGGGGTCATCGA SRR7180069 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 17:59:18 Started mapping on | Feb 10 17:59:18 Finished on | Feb 10 18:01:31 Mapping speed, Million of reads per hour | 548.98 Number of input reads | 20281714 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 18803691 Uniquely mapped reads % | 92.71% Average mapped length | 293.72 Number of splices: Total | 19094082 Number of splices: Annotated (sjdb) | 18752713 Number of splices: GT/AG | 18792137 Number of splices: GC/AG | 240535 Number of splices: AT/AC | 14048 Number of splices: Non-canonical | 47362 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.03% Deletion average length | 2.72 Insertion rate per base | 0.02% Insertion average length | 2.64 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 504958 % of reads mapped to multiple loci | 2.49% Number of reads mapped to too many loci | 39503 % of reads mapped to too many loci | 0.19% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.55% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1007819 1007819 1007819 N_multimapping 504958 504958 504958 N_noFeature 394189 18625194 477533 N_ambiguous 185026 1421 88905 UnstrandedReadsAssigned:18224476 PositiveStrandReadsAssigned:177076 NegativeStrandReadsAssigned:18237253 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7180069 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7180069-trimmed-pair1.fastq SRR7180069-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 20,281,714 reads, 18,130,545 reads pseudoaligned [quant] estimated average fragment length: 229.235 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,053 rounds 52401 SRR7180069.ke.tsv 34699 SRR7180069.se.tsv 87100 total ==> SRR7180069.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1789.77 1457 42.8573 Potri.005G024800.1.v4.1 1035 806.765 306 19.968 Potri.004G059700.1.v4.1 961 732.778 24 1.72425 Potri.007G009000.2.v4.1 1416 1187.77 0 0 Potri.003G141000.2.v4.1 2943 2714.77 725 14.0594 Potri.016G087400.1.v4.1 270 84.7134 1617 1004.89 Potri.015G069301.1.v4.1 564 339.031 0 0 Potri.010G195200.1.v4.1 1773 1544.77 480 16.3584 Potri.012G127500.1.v4.1 977 748.771 5710 401.465 ==> SRR7180069.se.tsv <== Potri.001G166300.v4.1 5 Potri.001G448400.v4.1 68 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 545 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 364 SRR7180069 completed mapping pipeline successfully