Starting /dee2/code/volunteer_pipeline.sh SRR7180070 current disk space = 3057810640896 free memory = 1573832088 SRR7180070 SRAfilesize aadbadd9528d59bf646720ef3d281195 SRR7180070.sra SRR7180070.sra file validated SRR7180070 is paired end SRR7180070 is conventional basespace SRR7180070 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7180070_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 28.54175 33.0 25.0 33.0 18.0 34.0 2 30.281 31.0 29.0 33.0 25.0 34.0 3 31.85725 33.0 31.0 33.0 28.0 34.0 4 32.109 33.0 31.0 33.0 30.0 34.0 5 32.994 33.0 33.0 34.0 32.0 34.0 6 36.82375 38.0 37.0 38.0 35.0 38.0 7 37.09575 38.0 38.0 38.0 35.0 38.0 8 37.5315 38.0 38.0 38.0 37.0 38.0 9 37.65825 38.0 38.0 38.0 38.0 38.0 10-14 37.65025 38.0 38.0 38.0 38.0 38.0 15-19 37.6814 38.0 38.0 38.0 38.0 38.0 20-24 37.6554 38.0 38.0 38.0 38.0 38.0 25-29 37.63595 38.0 38.0 38.0 38.0 38.0 30-34 37.595150000000004 38.0 38.0 38.0 38.0 38.0 35-39 37.54865 38.0 38.0 38.0 38.0 38.0 40-44 37.54395 38.0 38.0 38.0 38.0 38.0 45-49 37.5465 38.0 38.0 38.0 38.0 38.0 50-54 37.491400000000006 38.0 38.0 38.0 37.8 38.0 55-59 37.4945 38.0 38.0 38.0 37.6 38.0 60-64 37.40105 38.0 38.0 38.0 37.0 38.0 65-69 37.41005 38.0 38.0 38.0 37.0 38.0 70-74 37.36809999999999 38.0 38.0 38.0 37.0 38.0 75-79 37.2847 38.0 38.0 38.0 37.0 38.0 80-84 37.1996 38.0 38.0 38.0 36.6 38.0 85-89 37.17555 38.0 38.0 38.0 36.2 38.0 90-94 37.107949999999995 38.0 38.0 38.0 36.0 38.0 95-99 36.998949999999994 38.0 38.0 38.0 36.0 38.0 100-104 36.9242 38.0 38.0 38.0 35.8 38.0 105-109 36.80035 38.0 38.0 38.0 35.2 38.0 110-114 36.712 38.0 38.0 38.0 35.0 38.0 115-119 36.607800000000005 38.0 38.0 38.0 34.8 38.0 120-124 36.49695 38.0 38.0 38.0 34.2 38.0 125-129 36.3994 38.0 38.0 38.0 34.0 38.0 130-134 36.1096 38.0 37.8 38.0 33.2 38.0 135-139 35.94755 38.0 37.2 38.0 33.0 38.0 140-144 35.756449999999994 38.0 36.4 38.0 33.0 38.0 145-149 35.3921 38.0 36.0 38.0 31.8 38.0 150-151 32.428125 37.0 33.5 38.0 16.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 2.0 13 0.0 14 1.0 15 1.0 16 0.0 17 2.0 18 1.0 19 4.0 20 0.0 21 6.0 22 4.0 23 2.0 24 4.0 25 11.0 26 5.0 27 10.0 28 19.0 29 14.0 30 22.0 31 33.0 32 59.0 33 57.0 34 103.0 35 187.0 36 513.0 37 2940.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 32.594767752269085 15.563267485317672 15.269620928990923 36.572343833422316 2 20.375469336670836 21.151439299123904 36.77096370463079 21.70212765957447 3 19.05 28.525 26.700000000000003 25.724999999999998 4 21.675 34.25 22.125 21.95 5 19.925 36.775000000000006 25.025 18.275 6 17.599999999999998 34.599999999999994 25.900000000000002 21.9 7 13.175 21.25 45.45 20.125 8 18.3 23.0 30.15 28.549999999999997 9 18.325 21.7 33.300000000000004 26.674999999999997 10-14 20.555 28.310000000000002 26.834999999999997 24.3 15-19 19.79 28.395 27.994999999999997 23.82 20-24 19.36 27.905 28.904999999999998 23.830000000000002 25-29 19.005 28.79 28.075 24.13 30-34 19.675 28.345 28.27 23.71 35-39 19.765 28.74 27.575 23.919999999999998 40-44 19.735 28.315 28.095 23.855 45-49 20.365 28.139999999999997 28.37 23.125 50-54 20.165 28.605000000000004 27.650000000000002 23.580000000000002 55-59 19.830000000000002 28.165000000000003 27.950000000000003 24.055 60-64 19.985 27.939999999999998 28.110000000000003 23.965 65-69 19.84 28.000000000000004 27.965 24.195 70-74 20.169999999999998 27.63 28.62 23.580000000000002 75-79 20.48 27.884999999999998 27.77 23.865 80-84 20.205000000000002 28.134999999999998 27.91 23.75 85-89 20.14 28.255000000000003 27.85 23.755000000000003 90-94 20.44 27.525 28.665000000000003 23.369999999999997 95-99 20.06 27.750000000000004 28.64 23.549999999999997 100-104 20.345 28.444999999999997 28.285 22.925 105-109 20.465 28.015 27.775 23.745 110-114 20.14 27.88 27.975 24.005000000000003 115-119 20.645 27.93 28.025 23.400000000000002 120-124 20.79 28.42 27.41 23.380000000000003 125-129 20.974999999999998 28.725 26.529999999999998 23.77 130-134 20.84 28.384999999999998 27.18 23.595 135-139 21.22 28.415000000000003 27.105 23.26 140-144 20.919999999999998 28.849999999999998 26.419999999999998 23.810000000000002 145-149 20.815 28.18 26.790000000000003 24.215 150-151 21.055270083970424 27.497180097756612 27.233989221706985 24.213560596565987 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 1.0 17 0.5 18 0.0 19 0.5 20 0.5 21 0.5 22 0.5 23 0.0 24 0.5 25 1.5 26 2.5 27 5.5 28 11.0 29 14.0 30 17.0 31 23.0 32 31.5 33 39.0 34 43.5 35 59.0 36 82.0 37 101.5 38 134.5 39 169.5 40 199.5 41 245.0 42 286.0 43 287.0 44 296.0 45 302.0 46 278.5 47 255.0 48 225.5 49 186.0 50 158.5 51 138.5 52 103.5 53 77.0 54 55.5 55 42.5 56 29.5 57 23.0 58 20.5 59 12.5 60 11.0 61 7.0 62 4.5 63 4.0 64 2.5 65 2.0 66 1.5 67 1.5 68 1.5 69 0.5 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 6.35 2 0.125 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.2625 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67394030599448 99.35000000000001 2 0.32605969400551793 0.65 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.0875 0.0 0.0 0.0 0.0 90-91 0.16249999999999998 0.0 0.0 0.0 0.0 92-93 0.2375 0.0 0.0 0.0 0.0 94-95 0.3125 0.0 0.0 0.0 0.0 96-97 0.4625 0.0 0.0 0.0 0.0 98-99 0.675 0.0 0.0 0.0 0.0 100-101 0.85 0.0 0.0 0.0 0.0 102-103 0.975 0.0 0.0 0.0 0.0 104-105 1.1875 0.0 0.0 0.0 0.0 106-107 1.3125 0.0 0.0 0.0 0.0 108-109 1.45 0.0 0.0 0.0 0.0 110-111 1.6875 0.0 0.0 0.0 0.0 112-113 2.1375 0.0 0.0 0.0 0.0 114-115 2.4875 0.0 0.0 0.0 0.0 116-117 2.8875 0.0 0.0 0.0 0.0 118-119 3.3375 0.0 0.0 0.0 0.0 120-121 3.6875 0.0 0.0 0.0 0.0 122-123 4.1375 0.0 0.0 0.0 0.0 124-125 4.637499999999999 0.0 0.0 0.0 0.0 126-127 5.325 0.0 0.0 0.0 0.0 128-129 5.9375 0.0 0.0 0.0 0.0 130-131 6.6625 0.0 0.0 0.0 0.0 132-133 7.125 0.0 0.0 0.0 0.0 134-135 7.8125 0.0 0.0 0.0 0.0 136-137 8.325 0.0 0.0 0.0 0.0 138-139 9.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CGGAGAG 10 0.005853838 152.57895 1 CCAGCAG 15 1.1427032E-4 144.95001 8 GTATCCT 10 0.0068378756 144.95 145 TTGAGTC 10 0.0068378756 144.95 2 GTTCAGC 10 0.0068378756 144.95 6 GTCCAGC 10 0.0068378756 144.95 6 TGAGTCC 10 0.0068378756 144.95 3 GAGTCCA 20 3.592631E-4 108.7125 4 >>END_MODULE SRR7180070 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7180070_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.03475 33.0 33.0 34.0 32.0 34.0 2 33.21275 34.0 33.0 34.0 33.0 34.0 3 33.276 34.0 33.0 34.0 33.0 34.0 4 33.2185 34.0 33.0 34.0 33.0 34.0 5 33.1895 34.0 33.0 34.0 33.0 34.0 6 37.25625 38.0 38.0 38.0 38.0 38.0 7 37.38975 38.0 38.0 38.0 38.0 38.0 8 37.43575 38.0 38.0 38.0 38.0 38.0 9 37.35275 38.0 38.0 38.0 38.0 38.0 10-14 37.4304 38.0 38.0 38.0 38.0 38.0 15-19 37.306799999999996 38.0 38.0 38.0 37.6 38.0 20-24 37.303 38.0 38.0 38.0 38.0 38.0 25-29 37.29755 38.0 38.0 38.0 37.8 38.0 30-34 37.241200000000006 38.0 38.0 38.0 37.6 38.0 35-39 37.14254999999999 38.0 38.0 38.0 37.0 38.0 40-44 37.11445 38.0 38.0 38.0 37.0 38.0 45-49 37.21515 38.0 38.0 38.0 37.0 38.0 50-54 37.250249999999994 38.0 38.0 38.0 37.0 38.0 55-59 37.18105 38.0 38.0 38.0 37.0 38.0 60-64 37.17485 38.0 38.0 38.0 37.0 38.0 65-69 37.031549999999996 38.0 38.0 38.0 36.2 38.0 70-74 37.081050000000005 38.0 38.0 38.0 36.4 38.0 75-79 37.05195 38.0 38.0 38.0 36.2 38.0 80-84 36.969 38.0 38.0 38.0 36.0 38.0 85-89 36.84985 38.0 38.0 38.0 35.6 38.0 90-94 36.7597 38.0 38.0 38.0 35.6 38.0 95-99 36.74025 38.0 38.0 38.0 35.4 38.0 100-104 36.58685 38.0 38.0 38.0 35.0 38.0 105-109 36.427099999999996 38.0 38.0 38.0 34.0 38.0 110-114 36.38045 38.0 38.0 38.0 34.0 38.0 115-119 36.1363 38.0 38.0 38.0 33.8 38.0 120-124 36.033550000000005 38.0 38.0 38.0 33.6 38.0 125-129 35.7933 38.0 37.0 38.0 32.4 38.0 130-134 35.5642 38.0 36.6 38.0 31.2 38.0 135-139 35.1007 38.0 36.0 38.0 29.2 38.0 140-144 34.8703 38.0 35.6 38.0 28.6 38.0 145-149 34.1872 38.0 34.8 38.0 25.4 38.0 150-151 30.661875000000002 36.5 29.0 38.0 8.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 3.0 4 2.0 5 2.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 2.0 12 0.0 13 0.0 14 3.0 15 3.0 16 4.0 17 2.0 18 4.0 19 3.0 20 6.0 21 4.0 22 11.0 23 4.0 24 8.0 25 10.0 26 20.0 27 20.0 28 18.0 29 26.0 30 28.0 31 39.0 32 62.0 33 83.0 34 111.0 35 210.0 36 525.0 37 2784.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.91029817088449 14.883487847657229 17.764971185166626 29.441242796291654 2 25.275 21.85 33.85 19.025 3 23.625 25.775 31.1 19.5 4 24.65 34.25 22.400000000000002 18.7 5 23.9 36.525 22.175 17.4 6 18.854713678419603 38.359589897474365 23.1807951987997 19.604901225306325 7 17.81336002001501 17.7633224918689 44.283212409306984 20.140105078809107 8 20.43064596895343 23.234852278417627 27.516274411617424 28.818227341011514 9 21.675 25.474999999999998 28.675 24.175 10-14 23.336166808340415 28.431421571078552 26.491324566228315 21.741087054352718 15-19 23.45258944208156 27.830873154866147 27.88091068301226 20.83562672004003 20-24 22.51277427111512 28.138463079851718 27.762749223524697 21.586013425508465 25-29 23.11973525872443 28.564981949458485 27.672482952266346 20.642799839550744 30-34 22.88195141537844 28.77434250150572 27.94619554306364 20.3975105400522 35-39 22.7053625225949 28.68547901184977 28.178349066077523 20.430809399477805 40-44 22.96530601998293 28.38278857257619 28.191996786664657 20.459908620776222 45-49 22.91875626880642 28.510531594784354 28.425275827482448 20.145436308926783 50-54 23.60450563204005 28.340425531914892 27.554443053817273 20.500625782227786 55-59 23.212497496495093 28.394752653715198 28.154416182655716 20.238333667133986 60-64 22.947621191655408 29.241082595427486 27.17494622042123 20.636349992495873 65-69 23.400210136588782 28.323410216640816 27.34277280232151 20.93360684444889 70-74 23.639455782312925 28.59643857543017 27.62605042016807 20.138055222088834 75-79 24.206210310515523 27.65638281914096 27.86639331966598 20.271013550677534 80-84 23.345505477464858 28.582862288029613 27.56240308138662 20.509229153118905 85-89 23.96 28.134999999999998 27.715 20.19 90-94 23.29 28.965000000000003 27.310000000000002 20.435 95-99 23.330000000000002 28.345 28.194999999999997 20.13 100-104 24.025 28.155 27.755000000000003 20.064999999999998 105-109 24.12 28.305000000000003 27.465 20.11 110-114 23.785 28.205000000000002 28.095 19.915 115-119 24.345 28.560000000000002 27.389999999999997 19.705000000000002 120-124 24.515 28.765 26.69 20.03 125-129 24.111205560278016 28.131406570328515 27.826391319565978 19.930996549827494 130-134 25.405 27.994999999999997 26.75 19.85 135-139 25.474999999999998 28.065 26.72 19.74 140-144 25.180000000000003 27.505000000000003 27.634999999999998 19.68 145-149 26.119999999999997 28.4 26.46 19.02 150-151 25.895212966453073 28.169368011056665 26.837542404824728 19.097876617665534 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 1.0 19 1.0 20 1.0 21 2.0 22 1.0 23 0.5 24 1.5 25 3.5 26 4.0 27 4.5 28 6.5 29 9.5 30 11.0 31 14.5 32 18.5 33 26.0 34 37.5 35 59.5 36 76.0 37 110.0 38 150.5 39 169.5 40 203.5 41 242.0 42 279.0 43 300.0 44 308.0 45 297.5 46 276.0 47 268.5 48 232.0 49 190.0 50 179.0 51 137.0 52 93.5 53 71.5 54 48.0 55 34.5 56 28.0 57 24.0 58 18.0 59 14.5 60 13.5 61 10.0 62 6.0 63 4.0 64 2.5 65 2.5 66 2.0 67 1.0 68 0.0 69 0.0 70 1.0 71 1.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.22499999999999998 2 0.0 3 0.0 4 0.0 5 0.0 6 0.025 7 0.075 8 0.15 9 0.0 10-14 0.005 15-19 0.075 20-24 0.19 25-29 0.27999999999999997 30-34 0.38 35-39 0.42 40-44 0.415 45-49 0.3 50-54 0.125 55-59 0.13999999999999999 60-64 0.055 65-69 0.065 70-74 0.04 75-79 0.005 80-84 0.045 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.005 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.5125000000000001 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64850615114236 99.225 2 0.3263871453678132 0.65 3 0.0 0.0 4 0.0 0.0 5 0.025106703489831784 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCTTGAGCAAATTCAGTTTCTAAGCAAAAGCTTTCCAGGCCCCTTTATCC 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.0875 0.0 0.0 0.0 0.0 90-91 0.16249999999999998 0.0 0.0 0.0 0.0 92-93 0.2625 0.0 0.0 0.0 0.0 94-95 0.3375 0.0 0.0 0.0 0.0 96-97 0.48750000000000004 0.0 0.0 0.0 0.0 98-99 0.7 0.0 0.0 0.0 0.0 100-101 0.875 0.0 0.0 0.0 0.0 102-103 1.0 0.0 0.0 0.0 0.0 104-105 1.225 0.0 0.0 0.0 0.0 106-107 1.375 0.0 0.0 0.0 0.0 108-109 1.525 0.0 0.0 0.0 0.0 110-111 1.7625 0.0 0.0 0.0 0.0 112-113 2.2375 0.0 0.0 0.0 0.0 114-115 2.5875000000000004 0.0 0.0 0.0 0.0 116-117 2.9875 0.0 0.0 0.0 0.0 118-119 3.4375 0.0 0.0 0.0 0.0 120-121 3.7875 0.0 0.0 0.0 0.0 122-123 4.2125 0.0 0.0 0.0 0.0 124-125 4.7125 0.0 0.0 0.0 0.0 126-127 5.4375 0.0 0.0 0.0 0.0 128-129 6.0125 0.0 0.0 0.0 0.0 130-131 6.75 0.0 0.0 0.0 0.0 132-133 7.225 0.0 0.0 0.0 0.0 134-135 7.9125 0.0 0.0 0.0 0.0 136-137 8.425 0.0 0.0 0.0 0.0 138-139 9.1 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TACAGAT 10 0.006830828 145.0 1 AACTTGC 10 0.006830828 145.0 3 >>END_MODULE Read 929048 spots for SRR7180070.sra Written 929048 spots for SRR7180070.sra Read 929048 spots for SRR7180070.sra Written 929048 spots for SRR7180070.sra Read 929048 spots for SRR7180070.sra Written 929048 spots for SRR7180070.sra Read 929048 spots for SRR7180070.sra Written 929048 spots for SRR7180070.sra Read 929048 spots for SRR7180070.sra Written 929048 spots for SRR7180070.sra Read 929048 spots for SRR7180070.sra Written 929048 spots for SRR7180070.sra Read 929048 spots for SRR7180070.sra Written 929048 spots for SRR7180070.sra Read 929048 spots for SRR7180070.sra Written 929048 spots for SRR7180070.sra Read 929048 spots for SRR7180070.sra Written 929048 spots for SRR7180070.sra Read 929048 spots for SRR7180070.sra Written 929048 spots for SRR7180070.sra Read 929048 spots for SRR7180070.sra Written 929048 spots for SRR7180070.sra Read 929048 spots for SRR7180070.sra Written 929048 spots for SRR7180070.sra Read 929048 spots for SRR7180070.sra Written 929048 spots for SRR7180070.sra Read 929048 spots for SRR7180070.sra Written 929048 spots for SRR7180070.sra Read 929048 spots for SRR7180070.sra Written 929048 spots for SRR7180070.sra Read 929048 spots for SRR7180070.sra Written 929048 spots for SRR7180070.sra Read 929048 spots for SRR7180070.sra Written 929048 spots for SRR7180070.sra Read 929048 spots for SRR7180070.sra Written 929048 spots for SRR7180070.sra Read 929056 spots for SRR7180070.sra Written 929056 spots for SRR7180070.sra Read 929048 spots for SRR7180070.sra Written 929048 spots for SRR7180070.sra SRR ids: ['SRR7180070.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_zsnahiwg SRR7180070.sra spots: 18580968 blocks: [[1, 929048], [929049, 1858096], [1858097, 2787144], [2787145, 3716192], [3716193, 4645240], [4645241, 5574288], [5574289, 6503336], [6503337, 7432384], [7432385, 8361432], [8361433, 9290480], [9290481, 10219528], [10219529, 11148576], [11148577, 12077624], [12077625, 13006672], [13006673, 13935720], [13935721, 14864768], [14864769, 15793816], [15793817, 16722864], [16722865, 17651912], [17651913, 18580968]] SRR7180070 file size 6274779 SRR7180070 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7180070 SRR7180070_1.fastq SRR7180070_2.fastq Input file: SRR7180070_1.fastq Paired file: SRR7180070_2.fastq trimmed: SRR7180070-trimmed-pair1.fastq, SRR7180070-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 18:06:40 2025 >> started Mon Feb 10 18:06:59 2025 >> done (19.226s) 18580968 read pairs processed; of these: 12467 ( 0.07%) short read pairs filtered out after trimming by size control 9528 ( 0.05%) empty read pairs filtered out after trimming by size control 18558973 (99.88%) read pairs available; of these: 7314426 (39.41%) trimmed read pairs available after processing 11244547 (60.59%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 2 0.00% 20 0 0.00% 21 1 0.00% 22 5 0.00% 23 4 0.00% 24 1 0.00% 25 3 0.00% 26 3 0.00% 27 0 0.00% 28 4 0.00% 29 2 0.00% 30 4 0.00% 31 2 0.00% 32 3 0.00% 33 4 0.00% 34 1 0.00% 35 3 0.00% 36 3 0.00% 37 4 0.00% 38 10 0.00% 39 4 0.00% 40 5 0.00% 41 6 0.00% 42 10 0.00% 43 9 0.00% 44 12 0.00% 45 10 0.00% 46 19 0.00% 47 19 0.00% 48 19 0.00% 49 23 0.00% 50 24 0.00% 51 38 0.00% 52 31 0.00% 53 35 0.00% 54 46 0.00% 55 50 0.00% 56 57 0.00% 57 84 0.00% 58 86 0.00% 59 115 0.00% 60 123 0.00% 61 137 0.00% 62 182 0.00% 63 167 0.00% 64 243 0.00% 65 247 0.00% 66 309 0.00% 67 384 0.00% 68 423 0.00% 69 454 0.00% 70 526 0.00% 71 662 0.00% 72 760 0.00% 73 976 0.01% 74 1027 0.01% 75 1261 0.01% 76 1404 0.01% 77 1600 0.01% 78 1810 0.01% 79 2065 0.01% 80 2359 0.01% 81 2741 0.01% 82 3164 0.02% 83 3533 0.02% 84 4485 0.02% 85 5325 0.03% 86 6005 0.03% 87 6753 0.04% 88 7313 0.04% 89 7831 0.04% 90 8561 0.05% 91 9448 0.05% 92 10394 0.06% 93 11100 0.06% 94 12242 0.07% 95 13060 0.07% 96 13954 0.08% 97 15128 0.08% 98 16259 0.09% 99 17067 0.09% 100 18595 0.10% 101 19348 0.10% 102 20934 0.11% 103 22503 0.12% 104 23861 0.13% 105 25373 0.14% 106 26717 0.14% 107 28263 0.15% 108 29718 0.16% 109 31184 0.17% 110 32274 0.17% 111 33965 0.18% 112 35336 0.19% 113 36782 0.20% 114 38517 0.21% 115 40413 0.22% 116 42033 0.23% 117 43603 0.23% 118 45309 0.24% 119 47116 0.25% 120 49607 0.27% 121 50897 0.27% 122 52330 0.28% 123 52691 0.28% 124 55232 0.30% 125 56174 0.30% 126 58256 0.31% 127 60238 0.32% 128 61521 0.33% 129 63571 0.34% 130 65457 0.35% 131 68767 0.37% 132 70314 0.38% 133 72999 0.39% 134 74381 0.40% 135 77354 0.42% 136 79897 0.43% 137 83167 0.45% 138 86108 0.46% 139 89585 0.48% 140 93408 0.50% 141 99488 0.54% 142 106199 0.57% 143 114005 0.61% 144 124864 0.67% 145 139333 0.75% 146 161765 0.87% 147 204321 1.10% 148 291155 1.57% 149 558614 3.01% 150 3258639 17.56% 151 11244547 60.59% 18558973 reads passed initial QC criterion=sequence-density sequence-density=0.27 sequence-density-rank=1 fanout-score=1.95 fanout-score-rank=33 prefix-density=0.25 prefix-fanout=1.9 sequence=CGACACCATCAT criterion=fanout-score sequence-density=0.10 sequence-density-rank=18 fanout-score=29.47 fanout-score-rank=1 prefix-density=0.43 prefix-fanout=6.8 sequence=ATCTCCTTCCAAACCATTAAGAGTTATGATCTTGTTCTCATCATCGAAGGAAACCTCCTCTTTAAAGACCCCGGCTTTCCCTCCGATTGTGTACTGCCAAATCCTGATAGAGCCCGCAGTCTCCCAGTCACCTGCATGTATATCAACTCCTTGGATATGCTTGGAAGCATGTTTGGGAACATGGAAGGACTGGCTCCTCCACACTTTGTAGAACTTCTCTGCGGAGGACTTGAGTTCTAATGTTGTCTCAATCTTTCCATGTAGTGCCATTGTTTTCTATATCAACACAAATCTATGCACT criterion=sequence-density sequence-density=0.35 sequence-density-rank=1 fanout-score=2.33 fanout-score-rank=33 prefix-density=0.37 prefix-fanout=2.2 sequence=GGCAGTGGCTGCAAATGTGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=34 fanout-score=79.81 fanout-score-rank=1 prefix-density=0.17 prefix-fanout=5.2 sequence=TCTTTGAGAGTGCATAGATTTGTGTTGATATAGAAAACAATGGCACTACATGGAAAGATTGAGACAACATTAGAACTCAAGTCCTCCGCAGAGAAGTTCTACAAAGTGTGGAGGAGCCAGTCCTTCCATGTTCCCAAACATGCTTCCAAGCATATCCAAGGAGTTGATATACATGCAGGTGACTGGGAGACTGCGGGCTCTATCAGGATTTGGCAGTACACAATCGGAGGGAAAGCCGGGGTCTTTAAAGAGGAGGTTTCC SRR7180070 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 18:08:12 Started mapping on | Feb 10 18:08:12 Finished on | Feb 10 18:10:29 Mapping speed, Million of reads per hour | 487.68 Number of input reads | 18558973 Average input read length | 289 UNIQUE READS: Uniquely mapped reads number | 15636054 Uniquely mapped reads % | 84.25% Average mapped length | 290.36 Number of splices: Total | 16128213 Number of splices: Annotated (sjdb) | 15815392 Number of splices: GT/AG | 15859937 Number of splices: GC/AG | 208847 Number of splices: AT/AC | 12155 Number of splices: Non-canonical | 47274 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.53 Insertion rate per base | 0.02% Insertion average length | 2.64 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 382862 % of reads mapped to multiple loci | 2.06% Number of reads mapped to too many loci | 49740 % of reads mapped to too many loci | 0.27% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 13.37% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2551342 2551342 2551342 N_multimapping 382862 382862 382862 N_noFeature 369671 15500958 433171 N_ambiguous 234411 1835 161688 UnstrandedReadsAssigned:15031972 PositiveStrandReadsAssigned:133261 NegativeStrandReadsAssigned:15041195 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7180070 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7180070-trimmed-pair1.fastq SRR7180070-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,558,973 reads, 16,527,137 reads pseudoaligned [quant] estimated average fragment length: 225.935 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,163 rounds 52401 SRR7180070.ke.tsv 34699 SRR7180070.se.tsv 87100 total ==> SRR7180070.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1793.07 1540 54.3509 Potri.005G024800.1.v4.1 1035 810.065 230 17.9676 Potri.004G059700.1.v4.1 961 736.096 24 2.06328 Potri.007G009000.2.v4.1 1416 1191.07 0 0 Potri.003G141000.2.v4.1 2943 2718.07 517 12.0368 Potri.016G087400.1.v4.1 270 90.6333 1097 765.951 Potri.015G069301.1.v4.1 564 343.023 0 0 Potri.010G195200.1.v4.1 1773 1548.07 509.552 20.8296 Potri.012G127500.1.v4.1 977 752.086 10433 877.857 ==> SRR7180070.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 44 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 395 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 809 SRR7180070 completed mapping pipeline successfully