Starting /dee2/code/volunteer_pipeline.sh SRR7180071 current disk space = 3058384297984 free memory = 875094860 SRR7180071 SRAfilesize 3c556e2722f9dca00e97fbd709a4af93 SRR7180071.sra SRR7180071.sra file validated SRR7180071 is paired end SRR7180071 is conventional basespace SRR7180071 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7180071_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.32775 33.0 33.0 34.0 32.0 34.0 2 32.998 34.0 33.0 34.0 32.0 34.0 3 32.2435 33.0 33.0 34.0 31.0 34.0 4 32.6995 33.0 33.0 33.0 32.0 34.0 5 33.071 33.0 33.0 34.0 33.0 34.0 6 37.22225 38.0 37.0 38.0 36.0 38.0 7 37.54475 38.0 38.0 38.0 37.0 38.0 8 37.61075 38.0 38.0 38.0 37.0 38.0 9 37.687 38.0 38.0 38.0 38.0 38.0 10-14 37.70605 38.0 38.0 38.0 38.0 38.0 15-19 37.697 38.0 38.0 38.0 38.0 38.0 20-24 37.676750000000006 38.0 38.0 38.0 38.0 38.0 25-29 37.7031 38.0 38.0 38.0 38.0 38.0 30-34 37.63095 38.0 38.0 38.0 38.0 38.0 35-39 37.5978 38.0 38.0 38.0 38.0 38.0 40-44 37.559000000000005 38.0 38.0 38.0 38.0 38.0 45-49 37.5445 38.0 38.0 38.0 38.0 38.0 50-54 37.532399999999996 38.0 38.0 38.0 38.0 38.0 55-59 37.45945 38.0 38.0 38.0 37.2 38.0 60-64 37.47295 38.0 38.0 38.0 37.4 38.0 65-69 37.42325 38.0 38.0 38.0 37.0 38.0 70-74 37.37735 38.0 38.0 38.0 37.0 38.0 75-79 37.37065 38.0 38.0 38.0 37.0 38.0 80-84 37.3028 38.0 38.0 38.0 37.0 38.0 85-89 37.255849999999995 38.0 38.0 38.0 36.8 38.0 90-94 37.21415 38.0 38.0 38.0 36.6 38.0 95-99 37.1143 38.0 38.0 38.0 36.0 38.0 100-104 37.016999999999996 38.0 38.0 38.0 36.0 38.0 105-109 36.885000000000005 38.0 38.0 38.0 35.2 38.0 110-114 36.8263 38.0 38.0 38.0 35.0 38.0 115-119 36.63314999999999 38.0 38.0 38.0 34.6 38.0 120-124 36.54879999999999 38.0 38.0 38.0 34.4 38.0 125-129 36.36385 38.0 38.0 38.0 34.0 38.0 130-134 36.239999999999995 38.0 37.8 38.0 33.8 38.0 135-139 35.988699999999994 38.0 37.4 38.0 33.0 38.0 140-144 35.67645 38.0 36.4 38.0 31.8 38.0 145-149 35.35395 38.0 36.0 38.0 31.8 38.0 150-151 32.552 37.0 33.5 38.0 16.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 1.0 10 1.0 11 0.0 12 0.0 13 0.0 14 0.0 15 1.0 16 1.0 17 3.0 18 1.0 19 1.0 20 1.0 21 2.0 22 3.0 23 2.0 24 3.0 25 9.0 26 10.0 27 10.0 28 10.0 29 18.0 30 23.0 31 36.0 32 35.0 33 64.0 34 84.0 35 189.0 36 482.0 37 3009.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.020073956682516 14.896988906497624 13.312202852614895 37.77073428420496 2 22.1 20.625 37.1 20.175 3 19.425 27.625 27.275 25.674999999999997 4 23.150000000000002 32.975 22.85 21.025 5 21.224999999999998 34.699999999999996 24.65 19.425 6 17.075000000000003 37.0 25.85 20.075000000000003 7 14.399999999999999 21.25 44.275 20.075000000000003 8 18.425 21.85 30.325000000000003 29.4 9 18.45 22.75 31.674999999999997 27.125 10-14 20.465 28.51 26.555 24.47 15-19 20.5 27.24 27.87 24.39 20-24 20.135 27.735 28.075 24.055 25-29 19.53 28.904999999999998 28.265 23.3 30-34 20.51 27.839999999999996 28.435 23.215 35-39 20.165 27.93 28.42 23.485 40-44 20.34 27.650000000000002 28.475 23.535 45-49 21.09 27.85 27.68 23.380000000000003 50-54 20.525 27.725 28.43 23.32 55-59 20.135 28.410000000000004 28.02 23.435 60-64 20.195 27.425 28.26 24.12 65-69 20.395 28.15 28.03 23.425 70-74 20.19 27.92 28.24 23.65 75-79 20.195 27.52 28.544999999999998 23.74 80-84 20.145 28.294999999999998 28.044999999999998 23.515 85-89 20.169999999999998 27.875 27.93 24.025 90-94 19.98 27.99 28.29 23.74 95-99 20.365 27.529999999999998 28.720000000000002 23.385 100-104 20.465 28.565 27.52 23.45 105-109 20.485 27.57 28.43 23.515 110-114 20.54 27.485 28.410000000000004 23.565 115-119 20.765 28.199999999999996 27.345000000000002 23.69 120-124 20.31 27.83 27.77 24.09 125-129 20.9 27.915 27.99 23.195 130-134 21.01 27.744999999999997 27.13 24.115000000000002 135-139 21.165 27.915 27.445000000000004 23.474999999999998 140-144 20.7 28.21 27.48 23.61 145-149 21.075 28.144999999999996 27.33 23.45 150-151 20.8875 27.400000000000002 28.287499999999998 23.425 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.5 23 2.0 24 1.5 25 1.5 26 3.5 27 4.0 28 6.0 29 11.5 30 19.5 31 21.5 32 28.5 33 44.0 34 54.5 35 59.5 36 79.5 37 104.5 38 137.5 39 164.5 40 187.0 41 235.0 42 272.0 43 286.5 44 292.0 45 291.5 46 276.5 47 241.5 48 223.5 49 200.0 50 151.5 51 123.0 52 95.5 53 80.5 54 72.5 55 57.5 56 45.0 57 29.5 58 24.0 59 18.0 60 10.5 61 9.5 62 8.0 63 6.0 64 5.5 65 3.5 66 2.5 67 2.0 68 1.0 69 1.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 5.35 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.325 #Duplication Level Percentage of deduplicated Percentage of total 1 99.345582683111 98.675 2 0.6292474200855777 1.25 3 0.025169896803423106 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0125 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.2 0.0 0.0 0.0 0.0 98-99 0.2 0.0 0.0 0.0 0.0 100-101 0.23750000000000002 0.0 0.0 0.0 0.0 102-103 0.3375 0.0 0.0 0.0 0.0 104-105 0.42500000000000004 0.0 0.0 0.0 0.0 106-107 0.5 0.0 0.0 0.0 0.0 108-109 0.6375 0.0 0.0 0.0 0.0 110-111 0.825 0.0 0.0 0.0 0.0 112-113 0.9375 0.0 0.0 0.0 0.0 114-115 1.125 0.0 0.0 0.0 0.0 116-117 1.375 0.0 0.0 0.0 0.0 118-119 1.55 0.0 0.0 0.0 0.0 120-121 1.75 0.0 0.0 0.0 0.0 122-123 1.875 0.0 0.0 0.0 0.0 124-125 1.95 0.0 0.0 0.0 0.0 126-127 2.2249999999999996 0.0 0.0 0.0 0.0 128-129 2.3875 0.0 0.0 0.0 0.0 130-131 2.7 0.0 0.0 0.0 0.0 132-133 3.0375 0.0 0.0 0.0 0.0 134-135 3.4375 0.0 0.0 0.0 0.0 136-137 3.6500000000000004 0.0 0.0 0.0 0.0 138-139 3.975 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7180071 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7180071_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.2075 33.0 33.0 34.0 33.0 34.0 2 33.15625 34.0 33.0 34.0 33.0 34.0 3 33.2995 34.0 33.0 34.0 33.0 34.0 4 33.2695 34.0 33.0 34.0 33.0 34.0 5 33.297 34.0 33.0 34.0 33.0 34.0 6 37.50175 38.0 38.0 38.0 38.0 38.0 7 37.5465 38.0 38.0 38.0 38.0 38.0 8 37.4595 38.0 38.0 38.0 38.0 38.0 9 37.49175 38.0 38.0 38.0 38.0 38.0 10-14 37.41445 38.0 38.0 38.0 38.0 38.0 15-19 37.43155 38.0 38.0 38.0 37.8 38.0 20-24 37.378949999999996 38.0 38.0 38.0 37.2 38.0 25-29 37.449200000000005 38.0 38.0 38.0 37.8 38.0 30-34 37.397450000000006 38.0 38.0 38.0 37.4 38.0 35-39 37.349199999999996 38.0 38.0 38.0 37.0 38.0 40-44 37.32175 38.0 38.0 38.0 37.0 38.0 45-49 37.32955 38.0 38.0 38.0 37.0 38.0 50-54 37.27125 38.0 38.0 38.0 37.0 38.0 55-59 37.27105 38.0 38.0 38.0 37.0 38.0 60-64 37.19165 38.0 38.0 38.0 36.8 38.0 65-69 37.108850000000004 38.0 38.0 38.0 36.4 38.0 70-74 37.058800000000005 38.0 38.0 38.0 36.0 38.0 75-79 36.98475 38.0 38.0 38.0 36.0 38.0 80-84 36.94760000000001 38.0 38.0 38.0 36.0 38.0 85-89 36.75115 38.0 38.0 38.0 35.2 38.0 90-94 36.680949999999996 38.0 38.0 38.0 35.0 38.0 95-99 36.65805 38.0 38.0 38.0 35.0 38.0 100-104 36.479499999999994 38.0 38.0 38.0 34.2 38.0 105-109 36.228899999999996 38.0 37.8 38.0 33.6 38.0 110-114 36.19325 38.0 37.8 38.0 33.8 38.0 115-119 36.0061 38.0 37.2 38.0 33.2 38.0 120-124 35.7596 38.0 37.0 38.0 32.6 38.0 125-129 35.49905 38.0 36.2 38.0 31.0 38.0 130-134 35.276599999999995 38.0 36.0 38.0 30.0 38.0 135-139 35.04185 38.0 36.0 38.0 28.6 38.0 140-144 34.69785 38.0 35.0 38.0 27.6 38.0 145-149 34.058949999999996 38.0 35.0 38.0 24.6 38.0 150-151 30.12775 35.5 28.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 3.0 4 0.0 5 1.0 6 1.0 7 1.0 8 0.0 9 0.0 10 0.0 11 1.0 12 0.0 13 1.0 14 2.0 15 4.0 16 1.0 17 2.0 18 7.0 19 4.0 20 2.0 21 2.0 22 6.0 23 10.0 24 12.0 25 11.0 26 20.0 27 19.0 28 20.0 29 20.0 30 29.0 31 41.0 32 57.0 33 67.0 34 161.0 35 239.0 36 624.0 37 2631.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.2 16.375 16.775000000000002 29.65 2 24.975 22.45 35.199999999999996 17.375 3 21.85 25.650000000000002 31.1 21.4 4 25.224999999999998 34.375 21.575 18.825 5 23.775 36.65 21.0 18.575 6 18.75 36.875 23.775 20.599999999999998 7 17.525 18.224999999999998 42.65 21.6 8 21.175 22.275 28.199999999999996 28.349999999999998 9 21.45 25.324999999999996 28.449999999999996 24.775 10-14 23.265 28.265 26.08 22.39 15-19 23.13 27.55 27.894999999999996 21.425 20-24 22.564999999999998 28.43 27.54 21.465 25-29 22.7 28.21 27.305 21.785 30-34 22.89 28.439999999999998 27.515 21.154999999999998 35-39 22.615 28.17 27.85 21.365000000000002 40-44 23.494999999999997 28.060000000000002 27.705000000000002 20.74 45-49 22.865 28.075 27.72 21.34 50-54 23.025000000000002 27.639999999999997 28.475 20.86 55-59 23.52 27.675 28.139999999999997 20.665 60-64 23.375 28.17 27.615000000000002 20.84 65-69 22.695 28.92 27.515 20.87 70-74 23.075000000000003 28.595 27.384999999999998 20.945 75-79 23.974999999999998 27.810000000000002 27.215 21.0 80-84 23.880000000000003 28.365000000000002 27.169999999999998 20.585 85-89 23.695 28.310000000000002 27.07 20.925 90-94 23.724999999999998 28.199999999999996 27.73 20.345 95-99 23.735 28.015 27.700000000000003 20.549999999999997 100-104 23.57 28.185 27.3 20.945 105-109 23.419999999999998 27.534999999999997 28.005000000000003 21.04 110-114 23.105 28.255000000000003 27.845 20.794999999999998 115-119 23.935000000000002 28.060000000000002 27.450000000000003 20.555 120-124 24.01 28.005000000000003 27.68 20.305 125-129 24.23 28.565 27.07 20.135 130-134 24.25 28.33 27.029999999999998 20.39 135-139 24.37 28.555000000000003 26.700000000000003 20.375 140-144 24.535 28.860000000000003 26.265 20.34 145-149 24.235 28.575 26.825 20.365 150-151 24.259097161435538 28.410653995248218 26.885081905714642 20.4451669376016 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 0.0 23 1.0 24 2.0 25 1.5 26 1.0 27 2.0 28 4.0 29 7.5 30 8.0 31 7.5 32 18.0 33 30.0 34 35.0 35 50.5 36 65.5 37 88.0 38 136.5 39 175.5 40 208.0 41 239.5 42 256.0 43 275.5 44 303.0 45 307.5 46 281.0 47 261.5 48 228.5 49 194.5 50 182.0 51 145.0 52 113.5 53 93.0 54 68.0 55 55.5 56 46.5 57 31.5 58 18.5 59 14.5 60 12.5 61 8.0 62 5.0 63 6.0 64 4.0 65 2.5 66 2.0 67 0.5 68 0.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0375 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.225 #Duplication Level Percentage of deduplicated Percentage of total 1 99.31972789115646 98.55000000000001 2 0.6046863189720333 1.2 3 0.05039052658100278 0.15 4 0.02519526329050139 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0125 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.2 0.0 0.0 0.0 0.0 98-99 0.2 0.0 0.0 0.0 0.0 100-101 0.23750000000000002 0.0 0.0 0.0 0.0 102-103 0.3375 0.0 0.0 0.0 0.0 104-105 0.42500000000000004 0.0 0.0 0.0 0.0 106-107 0.5 0.0 0.0 0.0 0.0 108-109 0.6375 0.0 0.0 0.0 0.0 110-111 0.8 0.0 0.0 0.0 0.0 112-113 0.9125 0.0 0.0 0.0 0.0 114-115 1.1125 0.0 0.0 0.0 0.0 116-117 1.375 0.0 0.0 0.0 0.0 118-119 1.5375 0.0 0.0 0.0 0.0 120-121 1.7375 0.0 0.0 0.0 0.0 122-123 1.85 0.0 0.0 0.0 0.0 124-125 1.925 0.0 0.0 0.0 0.0 126-127 2.2 0.0 0.0 0.0 0.0 128-129 2.3625 0.0 0.0 0.0 0.0 130-131 2.6875 0.0 0.0 0.0 0.0 132-133 3.0375 0.0 0.0 0.0 0.0 134-135 3.4625 0.0 0.0 0.0 0.0 136-137 3.675 0.0 0.0 0.0 0.0 138-139 4.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGTCTCG 10 0.006830828 145.0 145 TATTGGA 20 3.5877043E-4 108.75 5 >>END_MODULE Read 739990 spots for SRR7180071.sra Written 739990 spots for SRR7180071.sra Read 739990 spots for SRR7180071.sra Written 739990 spots for SRR7180071.sra Read 739990 spots for SRR7180071.sra Written 739990 spots for SRR7180071.sra Read 739990 spots for SRR7180071.sra Written 739990 spots for SRR7180071.sra Read 739990 spots for SRR7180071.sra Written 739990 spots for SRR7180071.sra Read 739990 spots for SRR7180071.sra Written 739990 spots for SRR7180071.sra Read 739990 spots for SRR7180071.sra Written 739990 spots for SRR7180071.sra Read 739990 spots for SRR7180071.sra Written 739990 spots for SRR7180071.sra Read 739990 spots for SRR7180071.sra Written 739990 spots for SRR7180071.sra Read 739990 spots for SRR7180071.sra Written 739990 spots for SRR7180071.sra Read 739990 spots for SRR7180071.sra Written 739990 spots for SRR7180071.sra Read 739990 spots for SRR7180071.sra Written 739990 spots for SRR7180071.sra Read 739990 spots for SRR7180071.sra Written 739990 spots for SRR7180071.sra Read 739990 spots for SRR7180071.sra Written 739990 spots for SRR7180071.sra Read 739990 spots for SRR7180071.sra Written 739990 spots for SRR7180071.sra Read 739990 spots for SRR7180071.sra Written 739990 spots for SRR7180071.sra Read 739990 spots for SRR7180071.sra Written 739990 spots for SRR7180071.sra Read 739990 spots for SRR7180071.sra Written 739990 spots for SRR7180071.sra Read 739990 spots for SRR7180071.sra Written 739990 spots for SRR7180071.sra Read 740006 spots for SRR7180071.sra Written 740006 spots for SRR7180071.sra SRR ids: ['SRR7180071.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_y7f62hgv SRR7180071.sra spots: 14799816 blocks: [[1, 739990], [739991, 1479980], [1479981, 2219970], [2219971, 2959960], [2959961, 3699950], [3699951, 4439940], [4439941, 5179930], [5179931, 5919920], [5919921, 6659910], [6659911, 7399900], [7399901, 8139890], [8139891, 8879880], [8879881, 9619870], [9619871, 10359860], [10359861, 11099850], [11099851, 11839840], [11839841, 12579830], [12579831, 13319820], [13319821, 14059810], [14059811, 14799816]] SRR7180071 file size 4993471 SRR7180071 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7180071 SRR7180071_1.fastq SRR7180071_2.fastq Input file: SRR7180071_1.fastq Paired file: SRR7180071_2.fastq trimmed: SRR7180071-trimmed-pair1.fastq, SRR7180071-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 16:44:46 2025 >> started Mon Feb 10 16:45:10 2025 >> done (23.997s) 14799816 read pairs processed; of these: 9359 ( 0.06%) short read pairs filtered out after trimming by size control 7796 ( 0.05%) empty read pairs filtered out after trimming by size control 14782661 (99.88%) read pairs available; of these: 4991989 (33.77%) trimmed read pairs available after processing 9790672 (66.23%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 1 0.00% 20 2 0.00% 21 2 0.00% 22 4 0.00% 23 2 0.00% 24 2 0.00% 25 5 0.00% 26 0 0.00% 27 3 0.00% 28 2 0.00% 29 3 0.00% 30 4 0.00% 31 1 0.00% 32 1 0.00% 33 3 0.00% 34 6 0.00% 35 1 0.00% 36 5 0.00% 37 2 0.00% 38 4 0.00% 39 7 0.00% 40 6 0.00% 41 1 0.00% 42 7 0.00% 43 6 0.00% 44 8 0.00% 45 9 0.00% 46 6 0.00% 47 25 0.00% 48 13 0.00% 49 10 0.00% 50 28 0.00% 51 27 0.00% 52 27 0.00% 53 60 0.00% 54 37 0.00% 55 26 0.00% 56 38 0.00% 57 30 0.00% 58 50 0.00% 59 46 0.00% 60 50 0.00% 61 79 0.00% 62 91 0.00% 63 65 0.00% 64 89 0.00% 65 112 0.00% 66 116 0.00% 67 134 0.00% 68 151 0.00% 69 163 0.00% 70 175 0.00% 71 188 0.00% 72 258 0.00% 73 360 0.00% 74 318 0.00% 75 359 0.00% 76 466 0.00% 77 526 0.00% 78 557 0.00% 79 679 0.00% 80 686 0.00% 81 768 0.01% 82 927 0.01% 83 1088 0.01% 84 1649 0.01% 85 2090 0.01% 86 2301 0.02% 87 2711 0.02% 88 2840 0.02% 89 2921 0.02% 90 3131 0.02% 91 3419 0.02% 92 3658 0.02% 93 3773 0.03% 94 4131 0.03% 95 4376 0.03% 96 4648 0.03% 97 5115 0.03% 98 5394 0.04% 99 5694 0.04% 100 6101 0.04% 101 6415 0.04% 102 6843 0.05% 103 7403 0.05% 104 7835 0.05% 105 8454 0.06% 106 8915 0.06% 107 9407 0.06% 108 10024 0.07% 109 10560 0.07% 110 11064 0.07% 111 11637 0.08% 112 12255 0.08% 113 13023 0.09% 114 13837 0.09% 115 14376 0.10% 116 15155 0.10% 117 15925 0.11% 118 16931 0.11% 119 17772 0.12% 120 18821 0.13% 121 20078 0.14% 122 20125 0.14% 123 20929 0.14% 124 21372 0.14% 125 22426 0.15% 126 23400 0.16% 127 24264 0.16% 128 25397 0.17% 129 26490 0.18% 130 27630 0.19% 131 29314 0.20% 132 31027 0.21% 133 32463 0.22% 134 34041 0.23% 135 35889 0.24% 136 37966 0.26% 137 40405 0.27% 138 43019 0.29% 139 46016 0.31% 140 49222 0.33% 141 54122 0.37% 142 58988 0.40% 143 65238 0.44% 144 75140 0.51% 145 87861 0.59% 146 108182 0.73% 147 143418 0.97% 148 218537 1.48% 149 445574 3.01% 150 2813926 19.04% 151 9790672 66.23% 14782661 reads passed initial QC criterion=sequence-density sequence-density=0.37 sequence-density-rank=1 fanout-score=4.04 fanout-score-rank=21 prefix-density=0.85 prefix-fanout=1.7 sequence=TTCTCAGCACCGAAGTCCATCTCAGACCTCTCATAGAACATCTTAACTGGTGCAACACCTGCAATGATTGTCTCAGTTGTGGTGTTCTCTGAGAAACCTAAGTCAGGGTACATGCCACATTTGCAGCCACTGCCACACTTGCA criterion=fanout-score sequence-density=0.03 sequence-density-rank=37 fanout-score=210.81 fanout-score-rank=1 prefix-density=0.26 prefix-fanout=20.0 sequence=ATCATCAACTCCACATAGTTCAAGTTTCCAAGCATACATGAAAACACCTTGAAAGTTGAAGCAGCCAACAAAGCAGTGACGCGTACACAAGACAAAGGATTTATAGGAACCCTTTGCTGTTTATTATTATTTAACAACAAGCACCATTATACAAACATGAGCTGACCAACTGATAGATTAACTACTGCTTTGTTGGAACCATGTCCATGTGTCCTCATTTGCAGGAGCATGGATCACAGGTGCAGTTTGATCCACACTTGCAGCCATTCTCAGCACC criterion=sequence-density sequence-density=0.39 sequence-density-rank=1 fanout-score=3.82 fanout-score-rank=24 prefix-density=0.48 prefix-fanout=3.1 sequence=TGCAAGTGCGGCAGTG criterion=fanout-score sequence-density=0.01 sequence-density-rank=36 fanout-score=118.33 fanout-score-rank=1 prefix-density=0.17 prefix-fanout=3.8 sequence=TCTTTGAGAGTGCATAGATTTGTGTTGATATAGAAAACAATGGCACTACATGGAAAGATTGAGACAACATTAGAACTCAAGTCCTCCGCAGAGAAGTTCTACAAAGTGTGGAGGAGCCAGTCCTTCCATGTTCCCAAACATGCTTCCAAGCATATCCAAGGAGTTGATATACATGCAGGTGACTGGGAGACTGCGGGCTCTATCAGGATTTGGCAGTACACAATCGGAGGGAAAGCCGGGGTCTTTAAAGAGGAGGTTTCC SRR7180071 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 16:46:10 Started mapping on | Feb 10 16:46:11 Finished on | Feb 10 16:49:32 Mapping speed, Million of reads per hour | 264.76 Number of input reads | 14782661 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 13149142 Uniquely mapped reads % | 88.95% Average mapped length | 296.96 Number of splices: Total | 13139449 Number of splices: Annotated (sjdb) | 12891850 Number of splices: GT/AG | 12921065 Number of splices: GC/AG | 174449 Number of splices: AT/AC | 9826 Number of splices: Non-canonical | 34109 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.03% Deletion average length | 2.61 Insertion rate per base | 0.02% Insertion average length | 2.62 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 319931 % of reads mapped to multiple loci | 2.16% Number of reads mapped to too many loci | 26565 % of reads mapped to too many loci | 0.18% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 8.65% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1323573 1323573 1323573 N_multimapping 319931 319931 319931 N_noFeature 327210 13032759 377332 N_ambiguous 132639 1061 65540 UnstrandedReadsAssigned:12689293 PositiveStrandReadsAssigned:115322 NegativeStrandReadsAssigned:12706270 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7180071 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7180071-trimmed-pair1.fastq SRR7180071-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,782,661 reads, 12,597,161 reads pseudoaligned [quant] estimated average fragment length: 259.042 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,082 rounds 52401 SRR7180071.ke.tsv 34699 SRR7180071.se.tsv 87100 total ==> SRR7180071.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1759.96 1216 53.9855 Potri.005G024800.1.v4.1 1035 776.958 219 22.0238 Potri.004G059700.1.v4.1 961 702.986 3 0.333442 Potri.007G009000.2.v4.1 1416 1157.96 0 0 Potri.003G141000.2.v4.1 2943 2684.96 508 14.7833 Potri.016G087400.1.v4.1 270 71.8884 635 690.178 Potri.015G069301.1.v4.1 564 311.073 0 0 Potri.010G195200.1.v4.1 1773 1514.96 617 31.8222 Potri.012G127500.1.v4.1 977 718.975 5946 646.186 ==> SRR7180071.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 35 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 385 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 978 SRR7180071 completed mapping pipeline successfully