Starting /dee2/code/volunteer_pipeline.sh SRR7180072 current disk space = 3058329812992 free memory = 1143903976 SRR7180072 SRAfilesize 211623297c0f4d75a06b6f99537a871d SRR7180072.sra SRR7180072.sra file validated SRR7180072 is paired end SRR7180072 is conventional basespace SRR7180072 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7180072_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.69825 33.0 33.0 34.0 32.0 34.0 2 32.5595 33.0 33.0 34.0 31.0 34.0 3 31.98625 33.0 31.0 33.0 29.0 34.0 4 32.68825 33.0 33.0 34.0 31.0 34.0 5 31.9345 33.0 31.0 33.0 31.0 34.0 6 36.34275 38.0 36.0 38.0 33.0 38.0 7 37.4025 38.0 38.0 38.0 37.0 38.0 8 37.58925 38.0 38.0 38.0 37.0 38.0 9 37.61325 38.0 38.0 38.0 38.0 38.0 10-14 37.66785 38.0 38.0 38.0 38.0 38.0 15-19 37.6799 38.0 38.0 38.0 38.0 38.0 20-24 37.675200000000004 38.0 38.0 38.0 38.0 38.0 25-29 37.6455 38.0 38.0 38.0 38.0 38.0 30-34 37.623900000000006 38.0 38.0 38.0 38.0 38.0 35-39 37.6237 38.0 38.0 38.0 38.0 38.0 40-44 37.59815 38.0 38.0 38.0 38.0 38.0 45-49 37.619150000000005 38.0 38.0 38.0 38.0 38.0 50-54 37.5473 38.0 38.0 38.0 37.8 38.0 55-59 37.479 38.0 38.0 38.0 37.6 38.0 60-64 37.47165 38.0 38.0 38.0 37.0 38.0 65-69 37.410000000000004 38.0 38.0 38.0 37.0 38.0 70-74 37.3903 38.0 38.0 38.0 37.0 38.0 75-79 37.354 38.0 38.0 38.0 37.0 38.0 80-84 37.30585 38.0 38.0 38.0 37.0 38.0 85-89 37.22430000000001 38.0 38.0 38.0 36.8 38.0 90-94 37.18635 38.0 38.0 38.0 36.0 38.0 95-99 37.13345 38.0 38.0 38.0 36.0 38.0 100-104 36.9932 38.0 38.0 38.0 36.0 38.0 105-109 36.8797 38.0 38.0 38.0 35.4 38.0 110-114 36.78125 38.0 38.0 38.0 35.0 38.0 115-119 36.73225 38.0 38.0 38.0 35.0 38.0 120-124 36.5743 38.0 38.0 38.0 34.0 38.0 125-129 36.44955 38.0 38.0 38.0 34.0 38.0 130-134 36.219550000000005 38.0 37.6 38.0 33.6 38.0 135-139 36.0296 38.0 37.2 38.0 33.2 38.0 140-144 35.840999999999994 38.0 36.6 38.0 33.0 38.0 145-149 35.399249999999995 38.0 36.0 38.0 31.6 38.0 150-151 32.76325 37.0 33.5 38.0 16.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 0.0 10 0.0 11 0.0 12 0.0 13 2.0 14 0.0 15 0.0 16 2.0 17 0.0 18 0.0 19 2.0 20 4.0 21 4.0 22 3.0 23 3.0 24 7.0 25 2.0 26 3.0 27 9.0 28 10.0 29 18.0 30 22.0 31 31.0 32 43.0 33 56.0 34 94.0 35 186.0 36 526.0 37 2972.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 33.437663015127804 18.440271257172665 9.337506520605112 38.78455920709442 2 17.65 22.575 32.9 26.875 3 18.224999999999998 28.000000000000004 26.900000000000002 26.875 4 21.75 34.050000000000004 22.75 21.45 5 22.275 35.35 23.375 19.0 6 17.0 35.699999999999996 25.6 21.7 7 13.625000000000002 23.35 42.975 20.05 8 17.275 23.35 30.025000000000002 29.349999999999998 9 16.85 23.0 33.15 27.0 10-14 19.99 28.939999999999998 26.255 24.815 15-19 19.15 28.199999999999996 28.59 24.060000000000002 20-24 20.43 28.525 27.495000000000005 23.549999999999997 25-29 19.495 28.24 28.52 23.745 30-34 19.77 28.42 28.410000000000004 23.400000000000002 35-39 19.615 28.59 27.905 23.89 40-44 19.945 28.08 28.28 23.695 45-49 19.919999999999998 28.144999999999996 27.67 24.265 50-54 19.775000000000002 28.08 28.07 24.075 55-59 20.135 28.549999999999997 27.694999999999997 23.62 60-64 19.21 28.685 28.34 23.765 65-69 20.225 28.515 27.55 23.71 70-74 19.99 28.265 27.650000000000002 24.095 75-79 20.34 28.249999999999996 27.644999999999996 23.765 80-84 19.905 27.91 28.194999999999997 23.990000000000002 85-89 19.41 28.305000000000003 28.095 24.19 90-94 20.07 28.139999999999997 27.584999999999997 24.205 95-99 19.79 28.050000000000004 27.950000000000003 24.21 100-104 19.625 28.4 27.685 24.29 105-109 20.44 28.16 27.605 23.794999999999998 110-114 20.3 28.439999999999998 27.98 23.28 115-119 20.415 27.839999999999996 28.07 23.674999999999997 120-124 20.175 28.035 27.944999999999997 23.845 125-129 20.745 28.08 27.74 23.435 130-134 20.44 28.035 27.71 23.815 135-139 20.724999999999998 28.24 27.52 23.515 140-144 20.34 28.165000000000003 27.605 23.89 145-149 20.825 28.105000000000004 27.150000000000002 23.919999999999998 150-151 20.125 27.4125 27.400000000000002 25.0625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 1.0 22 1.0 23 0.5 24 2.5 25 8.0 26 7.0 27 1.5 28 6.5 29 10.5 30 13.0 31 20.5 32 30.0 33 39.5 34 46.0 35 71.5 36 95.0 37 112.5 38 141.0 39 156.0 40 193.0 41 238.5 42 259.0 43 284.5 44 300.5 45 279.5 46 269.5 47 261.0 48 220.0 49 185.5 50 163.0 51 139.0 52 102.0 53 79.0 54 72.5 55 52.5 56 34.5 57 23.0 58 20.5 59 17.0 60 7.5 61 7.5 62 8.5 63 6.0 64 3.0 65 2.5 66 2.0 67 1.5 68 1.0 69 0.0 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.15 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.75 #Duplication Level Percentage of deduplicated Percentage of total 1 99.74937343358395 99.5 2 0.2506265664160401 0.5 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0125 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.037500000000000006 0.0 0.0 0.0 0.0 90-91 0.0625 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.11249999999999999 0.0 0.0 0.0 0.0 96-97 0.1875 0.0 0.0 0.0 0.0 98-99 0.2375 0.0 0.0 0.0 0.0 100-101 0.275 0.0 0.0 0.0 0.0 102-103 0.4125 0.0 0.0 0.0 0.0 104-105 0.5375000000000001 0.0 0.0 0.0 0.0 106-107 0.6125 0.0 0.0 0.0 0.0 108-109 0.6625 0.0 0.0 0.0 0.0 110-111 0.8 0.0 0.0 0.0 0.0 112-113 0.95 0.0 0.0 0.0 0.0 114-115 1.1124999999999998 0.0 0.0 0.0 0.0 116-117 1.325 0.0 0.0 0.0 0.0 118-119 1.6625 0.0 0.0 0.0 0.0 120-121 1.925 0.0 0.0 0.0 0.0 122-123 2.2 0.0 0.0 0.0 0.0 124-125 2.5375 0.0 0.0 0.0 0.0 126-127 2.9 0.0 0.0 0.0 0.0 128-129 3.3 0.0 0.0 0.0 0.0 130-131 3.6500000000000004 0.0 0.0 0.0 0.0 132-133 3.9875 0.0 0.0 0.0 0.0 134-135 4.449999999999999 0.0 0.0 0.0 0.0 136-137 4.8125 0.0 0.0 0.0 0.0 138-139 5.175 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7180072 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7180072_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.10825 33.0 33.0 34.0 33.0 34.0 2 33.1605 34.0 33.0 34.0 33.0 34.0 3 33.16425 34.0 33.0 34.0 33.0 34.0 4 33.1675 34.0 33.0 34.0 33.0 34.0 5 33.2225 34.0 33.0 34.0 33.0 34.0 6 37.3525 38.0 38.0 38.0 38.0 38.0 7 37.37625 38.0 38.0 38.0 37.0 38.0 8 37.2525 38.0 38.0 38.0 37.0 38.0 9 37.3085 38.0 38.0 38.0 37.0 38.0 10-14 37.292 38.0 38.0 38.0 37.0 38.0 15-19 37.277750000000005 38.0 38.0 38.0 37.0 38.0 20-24 37.23975 38.0 38.0 38.0 37.0 38.0 25-29 37.1956 38.0 38.0 38.0 37.0 38.0 30-34 37.13725 38.0 38.0 38.0 36.8 38.0 35-39 37.1183 38.0 38.0 38.0 37.0 38.0 40-44 37.0527 38.0 38.0 38.0 37.0 38.0 45-49 37.08165 38.0 38.0 38.0 36.6 38.0 50-54 37.0342 38.0 38.0 38.0 36.4 38.0 55-59 36.9514 38.0 38.0 38.0 36.0 38.0 60-64 36.8687 38.0 38.0 38.0 36.0 38.0 65-69 36.810249999999996 38.0 38.0 38.0 35.8 38.0 70-74 36.78365 38.0 38.0 38.0 35.6 38.0 75-79 36.766200000000005 38.0 38.0 38.0 35.4 38.0 80-84 36.67325 38.0 38.0 38.0 35.0 38.0 85-89 36.574250000000006 38.0 38.0 38.0 35.0 38.0 90-94 36.472150000000006 38.0 38.0 38.0 34.0 38.0 95-99 36.33355 38.0 38.0 38.0 34.0 38.0 100-104 36.038450000000005 38.0 37.8 38.0 33.0 38.0 105-109 35.9583 38.0 37.2 38.0 33.0 38.0 110-114 35.8977 38.0 37.0 38.0 32.6 38.0 115-119 35.83145 38.0 37.0 38.0 32.6 38.0 120-124 35.54735 38.0 36.6 38.0 31.2 38.0 125-129 35.39015 38.0 36.0 38.0 30.6 38.0 130-134 34.9411 38.0 35.8 38.0 28.2 38.0 135-139 34.765 38.0 35.0 38.0 27.8 38.0 140-144 34.31115 38.0 35.0 38.0 25.6 38.0 145-149 33.583000000000006 38.0 34.8 38.0 20.8 38.0 150-151 29.584875000000004 36.0 27.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 6.0 3 5.0 4 3.0 5 0.0 6 2.0 7 0.0 8 1.0 9 0.0 10 3.0 11 0.0 12 1.0 13 3.0 14 3.0 15 5.0 16 4.0 17 1.0 18 4.0 19 4.0 20 3.0 21 5.0 22 8.0 23 6.0 24 10.0 25 9.0 26 20.0 27 13.0 28 22.0 29 25.0 30 31.0 31 47.0 32 63.0 33 102.0 34 174.0 35 277.0 36 754.0 37 2386.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.775 16.950000000000003 15.6 25.674999999999997 2 24.4 22.650000000000002 35.475 17.474999999999998 3 23.025000000000002 24.975 31.724999999999998 20.275000000000002 4 25.35 32.225 22.55 19.875 5 23.65 37.724999999999994 21.224999999999998 17.4 6 18.479619904976243 38.18454613653413 22.980745186296573 20.355088772193046 7 18.12953238309577 18.579644911227806 41.66041510377595 21.630407601900476 8 20.424999999999997 23.474999999999998 27.200000000000003 28.9 9 21.45 26.05 28.000000000000004 24.5 10-14 23.819763952790556 28.190638127625522 26.605321064212845 21.384276855371073 15-19 22.495623905976494 28.072018004501125 27.881970492623154 21.550387596899228 20-24 23.23555911502653 28.576434077485235 27.20993092401642 20.97807588347182 25-29 23.375062593890835 29.42413620430646 27.055583375062593 20.14521782674011 30-34 23.279575277972555 28.187919463087248 27.827306420915555 20.705198838024643 35-39 23.206412825651302 28.181362725450903 27.82565130260521 20.786573146292586 40-44 23.48697394789579 28.36673346693387 27.62024048096192 20.526052104208418 45-49 23.405107661492238 28.42263395092639 27.265898848272407 20.906359539308962 50-54 23.614518147684606 28.780976220275345 27.389236545682106 20.21526908635795 55-59 23.549727213574254 27.568947394764503 28.084488713148808 20.796836678512438 60-64 23.45728442019919 28.912466843501328 27.215855062309192 20.41439367399029 65-69 23.399889906420455 27.943752189360954 27.713556523044584 20.942801381173997 70-74 23.36219408438016 28.166758420499477 27.97657774886142 20.494469746258943 75-79 23.53559101595718 27.807513381021458 28.362763243459554 20.294132359561804 80-84 23.280952857571815 28.29046141527375 27.925132619357424 20.503453107797018 85-89 23.90695347673837 28.544272136068034 27.388694347173587 20.16008004002001 90-94 23.614722944588916 27.790558111622328 27.860572114422883 20.734146829365873 95-99 23.437343734373435 28.852885288528853 27.35273527352735 20.357035703570357 100-104 24.49489897979596 28.11562312462493 27.490498099619927 19.898979795959193 105-109 24.031201560078003 28.116405820291014 28.111405570278514 19.74098704935247 110-114 23.985 28.610000000000003 27.275 20.13 115-119 23.92858928839326 28.22423363504526 27.689153373005954 20.158023703555532 120-124 23.995998999749936 27.82195548887222 28.00200050012503 20.180045011252815 125-129 24.137068534267133 28.544272136068034 27.18359179589795 20.135067533766886 130-134 24.037018509254626 27.838919459729865 27.423711855927962 20.700350175087546 135-139 23.72093023255814 28.802200550137535 27.696924231057764 19.779944986246562 140-144 24.76619154788697 27.431857964491122 27.81695423855964 19.984996249062263 145-149 25.358875606462263 27.999799929975495 27.019456809883458 19.621867653678787 150-151 25.053184832937053 28.019021399073957 27.143035915404827 19.784757852584157 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.5 14 0.5 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.5 21 1.0 22 0.5 23 1.0 24 1.5 25 3.0 26 4.0 27 4.0 28 5.5 29 7.0 30 7.5 31 12.5 32 15.0 33 21.5 34 44.5 35 61.5 36 75.0 37 97.0 38 132.5 39 176.5 40 220.0 41 245.5 42 255.0 43 273.5 44 303.5 45 287.5 46 263.5 47 253.5 48 243.0 49 222.0 50 174.0 51 146.5 52 116.5 53 80.5 54 59.5 55 47.0 56 34.5 57 23.5 58 15.0 59 14.5 60 14.0 61 10.5 62 6.5 63 4.0 64 3.0 65 2.0 66 2.0 67 1.0 68 0.5 69 1.0 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.025 7 0.025 8 0.0 9 0.0 10-14 0.02 15-19 0.025 20-24 0.11 25-29 0.15 30-34 0.16999999999999998 35-39 0.2 40-44 0.2 45-49 0.15 50-54 0.125 55-59 0.105 60-64 0.095 65-69 0.08499999999999999 70-74 0.095 75-79 0.045 80-84 0.09 85-89 0.05 90-94 0.02 95-99 0.01 100-104 0.02 105-109 0.005 110-114 0.0 115-119 0.015 120-124 0.025 125-129 0.05 130-134 0.05 135-139 0.025 140-144 0.025 145-149 0.034999999999999996 150-151 0.11249999999999999 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69902182091799 99.375 2 0.27589666415851516 0.5499999999999999 3 0.025081514923501375 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.037500000000000006 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.0625 0.0 0.0 0.0 0.0 90-91 0.0875 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.125 0.0 0.0 0.0 0.0 96-97 0.21250000000000002 0.0 0.0 0.0 0.0 98-99 0.2625 0.0 0.0 0.0 0.0 100-101 0.30000000000000004 0.0 0.0 0.0 0.0 102-103 0.45 0.0 0.0 0.0 0.0 104-105 0.5874999999999999 0.0 0.0 0.0 0.0 106-107 0.6625000000000001 0.0 0.0 0.0 0.0 108-109 0.7125 0.0 0.0 0.0 0.0 110-111 0.8500000000000001 0.0 0.0 0.0 0.0 112-113 1.0 0.0 0.0 0.0 0.0 114-115 1.1625 0.0 0.0 0.0 0.0 116-117 1.375 0.0 0.0 0.0 0.0 118-119 1.7 0.0 0.0 0.0 0.0 120-121 1.95 0.0 0.0 0.0 0.0 122-123 2.2249999999999996 0.0 0.0 0.0 0.0 124-125 2.5625 0.0 0.0 0.0 0.0 126-127 2.925 0.0 0.0 0.0 0.0 128-129 3.2875 0.0 0.0 0.0 0.0 130-131 3.625 0.0 0.0 0.0 0.0 132-133 3.9875 0.0 0.0 0.0 0.0 134-135 4.5 0.0 0.0 0.0 0.0 136-137 4.875 0.0 0.0 0.0 0.0 138-139 5.275 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATTAGTG 10 0.006830828 145.0 5 CCATGGC 10 0.006830828 145.0 9 AGTGTCG 10 0.006830828 145.0 145 TATTAGT 10 0.006830828 145.0 4 >>END_MODULE Read 816503 spots for SRR7180072.sra Written 816503 spots for SRR7180072.sra Read 816503 spots for SRR7180072.sra Written 816503 spots for SRR7180072.sra Read 816503 spots for SRR7180072.sra Written 816503 spots for SRR7180072.sra Read 816503 spots for SRR7180072.sra Written 816503 spots for SRR7180072.sra Read 816503 spots for SRR7180072.sra Written 816503 spots for SRR7180072.sra Read 816503 spots for SRR7180072.sra Written 816503 spots for SRR7180072.sra Read 816503 spots for SRR7180072.sra Written 816503 spots for SRR7180072.sra Read 816503 spots for SRR7180072.sra Written 816503 spots for SRR7180072.sra Read 816511 spots for SRR7180072.sra Written 816511 spots for SRR7180072.sra Read 816503 spots for SRR7180072.sra Written 816503 spots for SRR7180072.sra Read 816503 spots for SRR7180072.sra Written 816503 spots for SRR7180072.sra Read 816503 spots for SRR7180072.sra Written 816503 spots for SRR7180072.sra Read 816503 spots for SRR7180072.sra Written 816503 spots for SRR7180072.sra Read 816503 spots for SRR7180072.sra Written 816503 spots for SRR7180072.sra Read 816503 spots for SRR7180072.sra Written 816503 spots for SRR7180072.sra Read 816503 spots for SRR7180072.sra Written 816503 spots for SRR7180072.sra Read 816503 spots for SRR7180072.sra Written 816503 spots for SRR7180072.sra Read 816503 spots for SRR7180072.sra Written 816503 spots for SRR7180072.sra Read 816503 spots for SRR7180072.sra Written 816503 spots for SRR7180072.sra Read 816503 spots for SRR7180072.sra Written 816503 spots for SRR7180072.sra SRR ids: ['SRR7180072.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_m6ekiwdb SRR7180072.sra spots: 16330068 blocks: [[1, 816503], [816504, 1633006], [1633007, 2449509], [2449510, 3266012], [3266013, 4082515], [4082516, 4899018], [4899019, 5715521], [5715522, 6532024], [6532025, 7348527], [7348528, 8165030], [8165031, 8981533], [8981534, 9798036], [9798037, 10614539], [10614540, 11431042], [11431043, 12247545], [12247546, 13064048], [13064049, 13880551], [13880552, 14697054], [14697055, 15513557], [15513558, 16330068]] SRR7180072 file size 5512023 SRR7180072 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7180072 SRR7180072_1.fastq SRR7180072_2.fastq Input file: SRR7180072_1.fastq Paired file: SRR7180072_2.fastq trimmed: SRR7180072-trimmed-pair1.fastq, SRR7180072-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 16:48:01 2025 >> started Mon Feb 10 16:48:19 2025 >> done (17.936s) 16330068 read pairs processed; of these: 19819 ( 0.12%) short read pairs filtered out after trimming by size control 11054 ( 0.07%) empty read pairs filtered out after trimming by size control 16299195 (99.81%) read pairs available; of these: 5981239 (36.70%) trimmed read pairs available after processing 10317956 (63.30%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 3 0.00% 20 3 0.00% 21 1 0.00% 22 5 0.00% 23 3 0.00% 24 3 0.00% 25 5 0.00% 26 6 0.00% 27 3 0.00% 28 3 0.00% 29 2 0.00% 30 4 0.00% 31 7 0.00% 32 3 0.00% 33 4 0.00% 34 4 0.00% 35 6 0.00% 36 29 0.00% 37 14 0.00% 38 6 0.00% 39 5 0.00% 40 31 0.00% 41 19 0.00% 42 15 0.00% 43 5 0.00% 44 11 0.00% 45 57 0.00% 46 46 0.00% 47 57 0.00% 48 41 0.00% 49 58 0.00% 50 45 0.00% 51 102 0.00% 52 23 0.00% 53 35 0.00% 54 45 0.00% 55 114 0.00% 56 43 0.00% 57 44 0.00% 58 40 0.00% 59 76 0.00% 60 84 0.00% 61 94 0.00% 62 110 0.00% 63 107 0.00% 64 117 0.00% 65 133 0.00% 66 156 0.00% 67 163 0.00% 68 199 0.00% 69 247 0.00% 70 308 0.00% 71 337 0.00% 72 428 0.00% 73 462 0.00% 74 549 0.00% 75 586 0.00% 76 697 0.00% 77 773 0.00% 78 840 0.01% 79 1020 0.01% 80 1093 0.01% 81 1256 0.01% 82 1542 0.01% 83 1704 0.01% 84 2906 0.02% 85 3635 0.02% 86 3734 0.02% 87 3831 0.02% 88 4354 0.03% 89 4435 0.03% 90 4548 0.03% 91 5093 0.03% 92 5334 0.03% 93 5707 0.04% 94 6190 0.04% 95 6632 0.04% 96 7028 0.04% 97 7401 0.05% 98 7984 0.05% 99 8357 0.05% 100 8789 0.05% 101 9454 0.06% 102 10258 0.06% 103 10938 0.07% 104 11490 0.07% 105 12272 0.08% 106 12969 0.08% 107 13939 0.09% 108 14597 0.09% 109 15224 0.09% 110 16098 0.10% 111 16839 0.10% 112 18408 0.11% 113 19064 0.12% 114 19948 0.12% 115 20978 0.13% 116 22126 0.14% 117 23241 0.14% 118 24382 0.15% 119 25566 0.16% 120 26718 0.16% 121 28447 0.17% 122 29442 0.18% 123 30298 0.19% 124 31359 0.19% 125 32371 0.20% 126 34067 0.21% 127 34973 0.21% 128 36255 0.22% 129 38098 0.23% 130 39555 0.24% 131 41394 0.25% 132 43044 0.26% 133 45508 0.28% 134 47610 0.29% 135 50466 0.31% 136 52946 0.32% 137 55344 0.34% 138 58407 0.36% 139 62008 0.38% 140 65509 0.40% 141 70398 0.43% 142 77582 0.48% 143 85737 0.53% 144 96018 0.59% 145 111094 0.68% 146 132990 0.82% 147 173574 1.06% 148 256187 1.57% 149 511486 3.14% 150 3154573 19.35% 151 10317956 63.30% 16299195 reads passed initial QC criterion=sequence-density sequence-density=0.35 sequence-density-rank=1 fanout-score=3.10 fanout-score-rank=25 prefix-density=0.39 prefix-fanout=2.8 sequence=CCACATTTGCAGCCACTGCCACACTTGCA criterion=fanout-score sequence-density=0.01 sequence-density-rank=34 fanout-score=49.81 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=6.3 sequence=CTTTAGCTTCTACTTTTATTTAATAGTTTTATAGATTACACAAAGGAAATACAACACAAGATCTCCCCACAAATCACACACATTGATGCAGTACTGAACTCGTTGCACGAAAGCGCTTAGATATATATTATACAAGTACTAGCATGATCACAAACATGTGATGCTTATTGGTCGAGATCGATGACCCCTTCTATTACTCCGTGCTAAGGGCTTCGTCGATGTCTTTAGTCATATGAACCATAAGATCAACATAAATCTCTGGAACCGGGACTTCAGGATGGAGTTTTTCGTATTCAATGGTCAGTTTTGCCAAGCAGCCCGAGCCTTTTGGTGTAAGCTGCCAGACGGGCCTATAGACCTTGTAAATTTTCATGACATCTCCTTCCAAACCATTAAGAGTTATGATCTTGTTCTCATCATCGAAGGAAACCTCCTCTTTAAAGACCCCGGCTTTCCCTCCGATTGTGTACTGCCAAATCCTGATAGAGCCCGCAGTCTCCCAGTCACCTGC criterion=sequence-density sequence-density=0.28 sequence-density-rank=1 fanout-score=5.37 fanout-score-rank=22 prefix-density=0.79 prefix-fanout=1.9 sequence=CTGCAAGTGCGGCAGTG criterion=fanout-score sequence-density=0.01 sequence-density-rank=37 fanout-score=348.87 fanout-score-rank=1 prefix-density=0.20 prefix-fanout=15.6 sequence=TTTCTTTGAGAGTGCATAGATTTGTGTTGATATAGAAAACAATGGCACTACATGGAAAGATTGAGACAACATTAGAACTCAAGTCCTCCGCAGAGAAGTTCTACAAAGTGTGGAGGAGCCAGTCCTTCCATGTTCCCAAACATGCTTCCAAGCATATCCAAGGAGTTGATATACATGCAGGTGACTGGGAGACTGCGGGCTCTATCAGGATTTGGCAGTACACAATCGGAGGGAAAGCCGGGGTCTTTAAAGAGGAGGTTTCCTTCGATGATGAGAACAAGATCATAACTCTTAATGGTTTGGAAGGAGATGTCATGAAAATTTACAAGGTCTATAGGCCCGTCTGGCAGCTTACACCAAAAGGCTCGGGCTGCTTGGCAAAACTGACCATTGAATACGAAAAACTCCATCCTGAAGTCCCGGTTCCAGAGATTTATGTTGATCTTATGGTTCATATGACTAAAGACATCGACGAAGCCCTTAGCACGGAGTAATAGAAGGGGTCATCGAT SRR7180072 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 16:49:07 Started mapping on | Feb 10 16:49:07 Finished on | Feb 10 16:51:01 Mapping speed, Million of reads per hour | 514.71 Number of input reads | 16299195 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 15102760 Uniquely mapped reads % | 92.66% Average mapped length | 295.58 Number of splices: Total | 14348541 Number of splices: Annotated (sjdb) | 14031929 Number of splices: GT/AG | 14111095 Number of splices: GC/AG | 183779 Number of splices: AT/AC | 12205 Number of splices: Non-canonical | 41462 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.03% Deletion average length | 2.68 Insertion rate per base | 0.02% Insertion average length | 2.55 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 382144 % of reads mapped to multiple loci | 2.34% Number of reads mapped to too many loci | 40975 % of reads mapped to too many loci | 0.25% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.68% % of reads unmapped: other | 0.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 831885 831885 831885 N_multimapping 382144 382144 382144 N_noFeature 433534 14959365 497995 N_ambiguous 161351 979 82021 UnstrandedReadsAssigned:14507875 PositiveStrandReadsAssigned:142416 NegativeStrandReadsAssigned:14522744 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7180072 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7180072-trimmed-pair1.fastq SRR7180072-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,299,195 reads, 14,409,687 reads pseudoaligned [quant] estimated average fragment length: 240.462 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,133 rounds 52401 SRR7180072.ke.tsv 34699 SRR7180072.se.tsv 87100 total ==> SRR7180072.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1778.54 3189 124.7 Potri.005G024800.1.v4.1 1035 795.538 1162 101.583 Potri.004G059700.1.v4.1 961 721.56 33 3.18066 Potri.007G009000.2.v4.1 1416 1176.54 0 0 Potri.003G141000.2.v4.1 2943 2703.54 822.253 21.1519 Potri.016G087400.1.v4.1 270 78.0203 754 672.109 Potri.015G069301.1.v4.1 564 327.837 0 0 Potri.010G195200.1.v4.1 1773 1533.54 380 17.2332 Potri.012G127500.1.v4.1 977 737.549 10857 1023.75 ==> SRR7180072.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 47 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 377 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 463 SRR7180072 completed mapping pipeline successfully