Starting /dee2/code/volunteer_pipeline.sh SRR7180073 current disk space = 3058446852096 free memory = 1419499592 SRR7180073 SRAfilesize 9d94a410aa27b9b21b73491b514db474 SRR7180073.sra SRR7180073.sra file validated SRR7180073 is paired end SRR7180073 is conventional basespace SRR7180073 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7180073_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 28.255 32.0 25.0 33.0 18.0 33.0 2 26.27825 28.0 18.0 31.0 18.0 33.0 3 29.8305 31.0 29.0 33.0 27.0 33.0 4 31.80625 33.0 32.0 33.0 30.0 33.0 5 32.68875 33.0 33.0 33.0 32.0 34.0 6 36.7905 38.0 37.0 38.0 34.0 38.0 7 37.37775 38.0 38.0 38.0 36.0 38.0 8 37.51575 38.0 38.0 38.0 37.0 38.0 9 37.66375 38.0 38.0 38.0 38.0 38.0 10-14 37.6832 38.0 38.0 38.0 38.0 38.0 15-19 37.66445 38.0 38.0 38.0 38.0 38.0 20-24 37.674949999999995 38.0 38.0 38.0 38.0 38.0 25-29 37.67335 38.0 38.0 38.0 38.0 38.0 30-34 37.628049999999995 38.0 38.0 38.0 38.0 38.0 35-39 37.61255 38.0 38.0 38.0 38.0 38.0 40-44 37.5788 38.0 38.0 38.0 38.0 38.0 45-49 37.54045 38.0 38.0 38.0 38.0 38.0 50-54 37.52545 38.0 38.0 38.0 38.0 38.0 55-59 37.49835 38.0 38.0 38.0 37.4 38.0 60-64 37.46225 38.0 38.0 38.0 37.2 38.0 65-69 37.42165 38.0 38.0 38.0 37.0 38.0 70-74 37.4132 38.0 38.0 38.0 37.0 38.0 75-79 37.3018 38.0 38.0 38.0 37.0 38.0 80-84 37.28305 38.0 38.0 38.0 37.0 38.0 85-89 37.22425 38.0 38.0 38.0 36.8 38.0 90-94 37.1689 38.0 38.0 38.0 36.2 38.0 95-99 37.11415 38.0 38.0 38.0 36.0 38.0 100-104 36.95975 38.0 38.0 38.0 35.8 38.0 105-109 36.902699999999996 38.0 38.0 38.0 35.6 38.0 110-114 36.86469999999999 38.0 38.0 38.0 35.4 38.0 115-119 36.686699999999995 38.0 38.0 38.0 34.8 38.0 120-124 36.6626 38.0 38.0 38.0 35.0 38.0 125-129 36.52055 38.0 38.0 38.0 34.2 38.0 130-134 36.2894 38.0 38.0 38.0 34.0 38.0 135-139 36.02325 38.0 37.2 38.0 33.2 38.0 140-144 35.815 38.0 37.0 38.0 33.0 38.0 145-149 35.62175 38.0 36.0 38.0 32.4 38.0 150-151 32.795625 36.5 33.5 38.0 17.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 2.0 11 0.0 12 1.0 13 0.0 14 1.0 15 2.0 16 0.0 17 1.0 18 0.0 19 3.0 20 1.0 21 2.0 22 3.0 23 4.0 24 4.0 25 7.0 26 7.0 27 7.0 28 14.0 29 11.0 30 20.0 31 27.0 32 45.0 33 63.0 34 85.0 35 186.0 36 562.0 37 2941.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.50762756443977 13.07206733298264 13.203577064702788 38.2167280378748 2 19.375 19.925 39.225 21.475 3 18.375 26.6 26.6 28.425 4 22.225 35.025 21.775 20.974999999999998 5 21.099999999999998 37.3 23.974999999999998 17.625 6 17.45872936468234 36.39319659829915 25.46273136568284 20.68534267133567 7 13.175 22.175 45.050000000000004 19.6 8 18.075 21.375 30.7 29.849999999999998 9 16.225 23.599999999999998 32.824999999999996 27.35 10-14 20.13 28.71 26.474999999999998 24.685000000000002 15-19 19.759999999999998 28.065 28.28 23.895 20-24 19.650000000000002 28.28 28.134999999999998 23.935000000000002 25-29 19.3 28.78 28.525 23.395 30-34 19.875 28.395 28.025 23.705000000000002 35-39 20.1 28.595 27.96 23.345 40-44 20.415 27.985 27.77 23.830000000000002 45-49 20.095 28.395 27.605 23.905 50-54 20.11 28.595 27.46 23.835 55-59 19.705000000000002 28.535 27.58 24.18 60-64 20.45 28.060000000000002 27.639999999999997 23.849999999999998 65-69 20.085 28.425 27.365000000000002 24.125 70-74 19.81 28.38 27.49 24.32 75-79 20.630000000000003 27.67 28.01 23.69 80-84 19.955000000000002 28.349999999999998 27.79 23.905 85-89 20.165 28.095 27.99 23.75 90-94 20.24 28.000000000000004 27.750000000000004 24.01 95-99 20.29 27.97 28.175 23.565 100-104 20.585 28.249999999999996 27.544999999999998 23.62 105-109 20.575 27.825 27.534999999999997 24.065 110-114 20.21 28.42 27.785 23.585 115-119 21.145 27.815 27.73 23.31 120-124 20.905 28.38 27.735 22.98 125-129 20.62 27.560000000000002 27.435 24.385 130-134 20.965 28.32 27.685 23.03 135-139 21.04 28.499999999999996 27.515 22.945 140-144 20.94 27.495000000000005 27.47 24.095 145-149 20.945 28.16 27.005000000000003 23.89 150-151 21.003252439329497 28.34625969477108 27.107830873154864 23.54265699274456 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.5 20 1.0 21 1.0 22 1.0 23 1.5 24 2.5 25 3.0 26 3.0 27 3.5 28 5.0 29 8.5 30 15.0 31 24.0 32 32.5 33 39.5 34 49.0 35 63.5 36 79.5 37 115.5 38 151.0 39 165.5 40 195.5 41 237.0 42 250.5 43 268.5 44 281.0 45 278.0 46 268.5 47 241.0 48 240.0 49 206.0 50 159.0 51 131.0 52 113.0 53 106.0 54 73.0 55 46.5 56 34.0 57 29.5 58 23.0 59 16.0 60 12.0 61 6.0 62 5.0 63 4.0 64 1.5 65 2.0 66 2.0 67 0.5 68 0.5 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.95 2 0.0 3 0.0 4 0.0 5 0.0 6 0.05 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.075 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67394030599448 99.35000000000001 2 0.32605969400551793 0.65 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1375 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.2 0.0 0.0 0.0 0.0 92-93 0.21250000000000002 0.0 0.0 0.0 0.0 94-95 0.2875 0.0 0.0 0.0 0.0 96-97 0.3125 0.0 0.0 0.0 0.0 98-99 0.4 0.0 0.0 0.0 0.0 100-101 0.4625 0.0 0.0 0.0 0.0 102-103 0.5125 0.0 0.0 0.0 0.0 104-105 0.6 0.0 0.0 0.0 0.0 106-107 0.6625000000000001 0.0 0.0 0.0 0.0 108-109 0.7875000000000001 0.0 0.0 0.0 0.0 110-111 1.025 0.0 0.0 0.0 0.0 112-113 1.2875 0.0 0.0 0.0 0.0 114-115 1.4625 0.0 0.0 0.0 0.0 116-117 1.625 0.0 0.0 0.0 0.0 118-119 1.7375 0.0 0.0 0.0 0.0 120-121 1.9625 0.0 0.0 0.0 0.0 122-123 2.1875 0.0 0.0 0.0 0.0 124-125 2.45 0.0 0.0 0.0 0.0 126-127 2.7 0.0 0.0 0.0 0.0 128-129 3.0125 0.0 0.0 0.0 0.0 130-131 3.375 0.0 0.0 0.0 0.0 132-133 3.775 0.0 0.0 0.0 0.0 134-135 4.1125 0.0 0.0 0.0 0.0 136-137 4.362500000000001 0.0 0.0 0.0 0.0 138-139 4.8375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TAGCAAA 10 0.006836113 144.9625 9 ATCAGAA 10 0.006836113 144.9625 9 CACTTCA 10 0.006836113 144.9625 4 >>END_MODULE SRR7180073 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7180073_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.05725 33.0 33.0 34.0 33.0 34.0 2 33.2745 34.0 33.0 34.0 33.0 34.0 3 33.315 34.0 33.0 34.0 33.0 34.0 4 33.34025 34.0 33.0 34.0 33.0 34.0 5 33.3095 34.0 33.0 34.0 33.0 34.0 6 37.50975 38.0 38.0 38.0 38.0 38.0 7 37.48225 38.0 38.0 38.0 38.0 38.0 8 37.4885 38.0 38.0 38.0 38.0 38.0 9 37.36375 38.0 38.0 38.0 38.0 38.0 10-14 37.513149999999996 38.0 38.0 38.0 38.0 38.0 15-19 37.47115 38.0 38.0 38.0 37.8 38.0 20-24 37.453250000000004 38.0 38.0 38.0 37.8 38.0 25-29 37.4749 38.0 38.0 38.0 38.0 38.0 30-34 37.480000000000004 38.0 38.0 38.0 38.0 38.0 35-39 37.395149999999994 38.0 38.0 38.0 37.4 38.0 40-44 37.3591 38.0 38.0 38.0 37.4 38.0 45-49 37.3882 38.0 38.0 38.0 37.0 38.0 50-54 37.352700000000006 38.0 38.0 38.0 37.0 38.0 55-59 37.3207 38.0 38.0 38.0 37.0 38.0 60-64 37.22725 38.0 38.0 38.0 36.8 38.0 65-69 37.134 38.0 38.0 38.0 36.8 38.0 70-74 37.204449999999994 38.0 38.0 38.0 36.8 38.0 75-79 37.1577 38.0 38.0 38.0 36.2 38.0 80-84 37.128049999999995 38.0 38.0 38.0 36.2 38.0 85-89 36.98715 38.0 38.0 38.0 36.0 38.0 90-94 36.870050000000006 38.0 38.0 38.0 35.6 38.0 95-99 36.866949999999996 38.0 38.0 38.0 35.6 38.0 100-104 36.67614999999999 38.0 38.0 38.0 34.6 38.0 105-109 36.5781 38.0 38.0 38.0 34.4 38.0 110-114 36.49775 38.0 38.0 38.0 34.0 38.0 115-119 36.4165 38.0 38.0 38.0 34.2 38.0 120-124 36.29195 38.0 38.0 38.0 34.0 38.0 125-129 36.012950000000004 38.0 37.2 38.0 33.2 38.0 130-134 35.7782 38.0 36.8 38.0 33.0 38.0 135-139 35.597950000000004 38.0 36.2 38.0 31.4 38.0 140-144 35.22735 38.0 36.0 38.0 30.0 38.0 145-149 34.7688 38.0 35.6 38.0 29.8 38.0 150-151 31.272375 36.5 31.0 38.0 14.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 0.0 4 0.0 5 1.0 6 1.0 7 0.0 8 0.0 9 1.0 10 0.0 11 0.0 12 0.0 13 1.0 14 0.0 15 0.0 16 2.0 17 2.0 18 3.0 19 0.0 20 2.0 21 4.0 22 6.0 23 3.0 24 5.0 25 8.0 26 17.0 27 15.0 28 20.0 29 24.0 30 27.0 31 39.0 32 57.0 33 75.0 34 117.0 35 196.0 36 502.0 37 2868.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.5529352734571 14.877069744104364 16.708479678876067 31.86151530356247 2 23.730932733183295 22.355588897224308 36.18404601150287 17.72943235808952 3 20.4 26.05 32.175 21.375 4 24.525 34.599999999999994 21.5 19.375 5 23.875 36.0 22.650000000000002 17.474999999999998 6 18.525 36.35 23.65 21.475 7 18.625 15.875 43.55 21.95 8 20.025000000000002 23.474999999999998 28.65 27.85 9 21.85 24.65 28.050000000000004 25.45 10-14 23.93 28.08 25.825 22.165000000000003 15-19 23.325000000000003 28.294999999999998 26.939999999999998 21.44 20-24 23.080000000000002 28.505000000000003 27.015 21.4 25-29 22.55 28.625 27.589999999999996 21.235 30-34 22.134999999999998 28.410000000000004 28.035 21.42 35-39 22.81842276341451 28.569285392808926 27.78916837525629 20.823123468520276 40-44 23.0207551887972 28.542135533883474 27.751937984496124 20.685171292823206 45-49 23.745 28.365000000000002 27.22 20.669999999999998 50-54 23.555 28.025 27.595 20.825 55-59 23.155 27.55 28.08 21.215 60-64 23.23 28.205000000000002 27.505000000000003 21.060000000000002 65-69 23.62 28.050000000000004 28.000000000000004 20.330000000000002 70-74 23.544999999999998 28.050000000000004 28.065 20.34 75-79 23.755000000000003 27.455000000000002 28.189999999999998 20.599999999999998 80-84 23.48 27.825 27.474999999999998 21.22 85-89 23.674999999999997 27.810000000000002 27.474999999999998 21.04 90-94 23.115 28.139999999999997 28.28 20.465 95-99 23.5 28.349999999999998 27.560000000000002 20.59 100-104 23.435 27.395000000000003 28.515 20.655 105-109 23.885 27.62 27.915 20.580000000000002 110-114 24.145 28.095 27.74 20.02 115-119 24.779999999999998 28.675 26.91 19.634999999999998 120-124 24.560000000000002 28.275 27.134999999999998 20.03 125-129 24.725 27.634999999999998 27.685 19.955000000000002 130-134 24.11 28.575 27.310000000000002 20.005 135-139 24.635 28.349999999999998 26.93 20.085 140-144 24.505 28.42 27.46 19.615 145-149 24.955 27.87 27.22 19.955000000000002 150-151 25.294560040110305 27.951867635998994 27.174730508899476 19.578841814991225 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 2.0 24 2.0 25 0.0 26 3.0 27 3.5 28 1.5 29 3.0 30 7.0 31 12.5 32 16.0 33 27.5 34 36.0 35 38.0 36 58.5 37 100.5 38 150.5 39 189.0 40 209.5 41 225.5 42 260.5 43 283.0 44 295.5 45 293.5 46 275.0 47 265.0 48 248.0 49 212.5 50 169.0 51 143.5 52 120.5 53 97.0 54 73.0 55 47.5 56 31.5 57 23.5 58 18.0 59 16.0 60 10.5 61 8.0 62 7.5 63 4.5 64 4.0 65 1.5 66 1.5 67 1.5 68 1.0 69 1.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.35000000000000003 2 0.025 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.015 40-44 0.025 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.27499999999999997 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.375 #Duplication Level Percentage of deduplicated Percentage of total 1 99.52201257861634 98.9 2 0.4025157232704402 0.8 3 0.05031446540880503 0.15 4 0.0 0.0 5 0.0 0.0 6 0.025157232704402514 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTTTAATTTGAGACAGAAAACATGAAATCCTCCTACACTTTCTTCATTCT 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1375 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.21250000000000002 0.0 0.0 0.0 0.0 92-93 0.2375 0.0 0.0 0.0 0.0 94-95 0.3125 0.0 0.0 0.0 0.0 96-97 0.3375 0.0 0.0 0.0 0.0 98-99 0.425 0.0 0.0 0.0 0.0 100-101 0.4875 0.0 0.0 0.0 0.0 102-103 0.5375 0.0 0.0 0.0 0.0 104-105 0.625 0.0 0.0 0.0 0.0 106-107 0.6875 0.0 0.0 0.0 0.0 108-109 0.8125 0.0 0.0 0.0 0.0 110-111 1.05 0.0 0.0 0.0 0.0 112-113 1.3125 0.0 0.0 0.0 0.0 114-115 1.4875 0.0 0.0 0.0 0.0 116-117 1.6625 0.0 0.0 0.0 0.0 118-119 1.7875 0.0 0.0 0.0 0.0 120-121 2.0125 0.0 0.0 0.0 0.0 122-123 2.2375 0.0 0.0 0.0 0.0 124-125 2.4875 0.0 0.0 0.0 0.0 126-127 2.7249999999999996 0.0 0.0 0.0 0.0 128-129 3.05 0.0 0.0 0.0 0.0 130-131 3.425 0.0 0.0 0.0 0.0 132-133 3.8 0.0 0.0 0.0 0.0 134-135 4.125 0.0 0.0 0.0 0.0 136-137 4.4 0.0 0.0 0.0 0.0 138-139 4.8875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 740723 spots for SRR7180073.sra Written 740723 spots for SRR7180073.sra Read 740723 spots for SRR7180073.sra Written 740723 spots for SRR7180073.sra Read 740723 spots for SRR7180073.sra Written 740723 spots for SRR7180073.sra Read 740723 spots for SRR7180073.sra Written 740723 spots for SRR7180073.sra Read 740723 spots for SRR7180073.sra Written 740723 spots for SRR7180073.sra Read 740723 spots for SRR7180073.sra Written 740723 spots for SRR7180073.sra Read 740723 spots for SRR7180073.sra Written 740723 spots for SRR7180073.sra Read 740723 spots for SRR7180073.sra Written 740723 spots for SRR7180073.sra Read 740723 spots for SRR7180073.sra Written 740723 spots for SRR7180073.sra Read 740723 spots for SRR7180073.sra Written 740723 spots for SRR7180073.sra Read 740723 spots for SRR7180073.sra Written 740723 spots for SRR7180073.sra Read 740723 spots for SRR7180073.sra Written 740723 spots for SRR7180073.sra Read 740723 spots for SRR7180073.sra Written 740723 spots for SRR7180073.sra Read 740723 spots for SRR7180073.sra Written 740723 spots for SRR7180073.sra Read 740723 spots for SRR7180073.sra Written 740723 spots for SRR7180073.sra Read 740723 spots for SRR7180073.sra Written 740723 spots for SRR7180073.sra Read 740723 spots for SRR7180073.sra Written 740723 spots for SRR7180073.sra Read 740723 spots for SRR7180073.sra Written 740723 spots for SRR7180073.sra Read 740723 spots for SRR7180073.sra Written 740723 spots for SRR7180073.sra Read 740723 spots for SRR7180073.sra Written 740723 spots for SRR7180073.sra SRR ids: ['SRR7180073.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_2nmeb326 SRR7180073.sra spots: 14814460 blocks: [[1, 740723], [740724, 1481446], [1481447, 2222169], [2222170, 2962892], [2962893, 3703615], [3703616, 4444338], [4444339, 5185061], [5185062, 5925784], [5925785, 6666507], [6666508, 7407230], [7407231, 8147953], [8147954, 8888676], [8888677, 9629399], [9629400, 10370122], [10370123, 11110845], [11110846, 11851568], [11851569, 12592291], [12592292, 13333014], [13333015, 14073737], [14073738, 14814460]] SRR7180073 file size 4998434 SRR7180073 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7180073 SRR7180073_1.fastq SRR7180073_2.fastq Input file: SRR7180073_1.fastq Paired file: SRR7180073_2.fastq trimmed: SRR7180073-trimmed-pair1.fastq, SRR7180073-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 16:41:27 2025 >> started Mon Feb 10 16:41:55 2025 >> done (28.435s) 14814460 read pairs processed; of these: 7764 ( 0.05%) short read pairs filtered out after trimming by size control 6175 ( 0.04%) empty read pairs filtered out after trimming by size control 14800521 (99.91%) read pairs available; of these: 5088020 (34.38%) trimmed read pairs available after processing 9712501 (65.62%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 2 0.00% 20 0 0.00% 21 2 0.00% 22 2 0.00% 23 4 0.00% 24 3 0.00% 25 0 0.00% 26 4 0.00% 27 2 0.00% 28 5 0.00% 29 3 0.00% 30 3 0.00% 31 3 0.00% 32 1 0.00% 33 1 0.00% 34 1 0.00% 35 4 0.00% 36 7 0.00% 37 7 0.00% 38 12 0.00% 39 44 0.00% 40 4 0.00% 41 4 0.00% 42 8 0.00% 43 12 0.00% 44 8 0.00% 45 15 0.00% 46 8 0.00% 47 5 0.00% 48 9 0.00% 49 15 0.00% 50 17 0.00% 51 10 0.00% 52 24 0.00% 53 43 0.00% 54 31 0.00% 55 101 0.00% 56 117 0.00% 57 45 0.00% 58 29 0.00% 59 27 0.00% 60 51 0.00% 61 57 0.00% 62 121 0.00% 63 87 0.00% 64 85 0.00% 65 107 0.00% 66 90 0.00% 67 100 0.00% 68 97 0.00% 69 151 0.00% 70 170 0.00% 71 198 0.00% 72 230 0.00% 73 296 0.00% 74 309 0.00% 75 360 0.00% 76 394 0.00% 77 492 0.00% 78 619 0.00% 79 716 0.00% 80 707 0.00% 81 843 0.01% 82 982 0.01% 83 1119 0.01% 84 1572 0.01% 85 1977 0.01% 86 2311 0.02% 87 2478 0.02% 88 2715 0.02% 89 2844 0.02% 90 2941 0.02% 91 3343 0.02% 92 3590 0.02% 93 3796 0.03% 94 4162 0.03% 95 4488 0.03% 96 4783 0.03% 97 5216 0.04% 98 5701 0.04% 99 5983 0.04% 100 6352 0.04% 101 6861 0.05% 102 7191 0.05% 103 7983 0.05% 104 8446 0.06% 105 8961 0.06% 106 9855 0.07% 107 10574 0.07% 108 10991 0.07% 109 11735 0.08% 110 12370 0.08% 111 12864 0.09% 112 13896 0.09% 113 14506 0.10% 114 15358 0.10% 115 16331 0.11% 116 17579 0.12% 117 17954 0.12% 118 19017 0.13% 119 20485 0.14% 120 21699 0.15% 121 23005 0.16% 122 22180 0.15% 123 23929 0.16% 124 25087 0.17% 125 25933 0.18% 126 27104 0.18% 127 27974 0.19% 128 29737 0.20% 129 31087 0.21% 130 32848 0.22% 131 34208 0.23% 132 36287 0.25% 133 37657 0.25% 134 39172 0.26% 135 41752 0.28% 136 43708 0.30% 137 45803 0.31% 138 48685 0.33% 139 51747 0.35% 140 55600 0.38% 141 59153 0.40% 142 64707 0.44% 143 71180 0.48% 144 81199 0.55% 145 91658 0.62% 146 109165 0.74% 147 142473 0.96% 148 215117 1.45% 149 433760 2.93% 150 2778173 18.77% 151 9712501 65.62% 14800521 reads passed initial QC criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=2.56 fanout-score-rank=29 prefix-density=0.29 prefix-fanout=2.3 sequence=AGTTCATCTCAGA criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=68.18 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=9.4 sequence=GAAAATCAAAGTACTTCACACCATGAAAAATCACACACTAAGCAAACCATGCATGATGGAATAAAAATGCTTTTAGGCGCACTGGAAATCTTTGGGGACCTTCTTTCCACAGACATTGAGAAGCAAGCTTAGAGATACAGGGATATTAAGGTTGATGCCCAAGATGTTAGCTTTGATGGCAGTGCAAAGGCAAACAGCAGCCTCGAGATCAAGAAGGCCTTGAATGAGACTACAGCAAGGTTCTACTGGGGGAGTGCCAACGGTGACATTAAGCAATGAACCGAGCAAATCAGCACATACACCTAATTTAAGTGCATCCTTTGGGCACTTTCCAC criterion=sequence-density sequence-density=0.34 sequence-density-rank=1 fanout-score=6.04 fanout-score-rank=15 prefix-density=0.52 prefix-fanout=3.9 sequence=CTGCAAATGTGG criterion=fanout-score sequence-density=0.09 sequence-density-rank=25 fanout-score=121.45 fanout-score-rank=1 prefix-density=0.50 prefix-fanout=22.5 sequence=CAAAGAAGAAGAT SRR7180073 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 16:43:00 Started mapping on | Feb 10 16:43:01 Finished on | Feb 10 16:45:16 Mapping speed, Million of reads per hour | 394.68 Number of input reads | 14800521 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 14016734 Uniquely mapped reads % | 94.70% Average mapped length | 296.59 Number of splices: Total | 14438261 Number of splices: Annotated (sjdb) | 14215808 Number of splices: GT/AG | 14218592 Number of splices: GC/AG | 179048 Number of splices: AT/AC | 9592 Number of splices: Non-canonical | 31029 Mismatch rate per base, % | 0.32% Deletion rate per base | 0.03% Deletion average length | 2.61 Insertion rate per base | 0.02% Insertion average length | 2.65 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 358433 % of reads mapped to multiple loci | 2.42% Number of reads mapped to too many loci | 27389 % of reads mapped to too many loci | 0.19% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.65% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 433414 433414 433414 N_multimapping 358433 358433 358433 N_noFeature 275946 13901300 318701 N_ambiguous 135876 710 62816 UnstrandedReadsAssigned:13604912 PositiveStrandReadsAssigned:114724 NegativeStrandReadsAssigned:13635217 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7180073 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7180073-trimmed-pair1.fastq SRR7180073-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,800,521 reads, 13,511,183 reads pseudoaligned [quant] estimated average fragment length: 241.902 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,279 rounds 52401 SRR7180073.ke.tsv 34699 SRR7180073.se.tsv 87100 total ==> SRR7180073.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1777.1 925 36.723 Potri.005G024800.1.v4.1 1035 794.098 191 16.9694 Potri.004G059700.1.v4.1 961 720.129 21 2.05739 Potri.007G009000.2.v4.1 1416 1175.1 0 0 Potri.003G141000.2.v4.1 2943 2702.1 534 13.9427 Potri.016G087400.1.v4.1 270 76.3394 1238 1144.14 Potri.015G069301.1.v4.1 564 326.303 0 0 Potri.010G195200.1.v4.1 1773 1532.1 126 5.80218 Potri.012G127500.1.v4.1 977 736.123 2807 269.029 ==> SRR7180073.se.tsv <== Potri.001G166300.v4.1 2 Potri.001G448400.v4.1 58 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 355 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 195 SRR7180073 completed mapping pipeline successfully