Starting /dee2/code/volunteer_pipeline.sh SRR7180074 current disk space = 3058014896128 free memory = 1530382500 SRR7180074 SRAfilesize 0190ee9c4e20585a8df7607c496895ea SRR7180074.sra SRR7180074.sra file validated SRR7180074 is paired end SRR7180074 is conventional basespace SRR7180074 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7180074_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.471 33.0 33.0 34.0 32.0 34.0 2 30.808 32.0 31.0 33.0 27.0 33.0 3 32.35225 33.0 33.0 33.0 29.0 34.0 4 32.91075 33.0 33.0 34.0 31.0 34.0 5 32.94 33.0 33.0 34.0 31.0 34.0 6 36.65625 38.0 37.0 38.0 34.0 38.0 7 37.06625 38.0 37.0 38.0 35.0 38.0 8 37.58025 38.0 38.0 38.0 37.0 38.0 9 37.6665 38.0 38.0 38.0 38.0 38.0 10-14 37.6898 38.0 38.0 38.0 38.0 38.0 15-19 37.7302 38.0 38.0 38.0 38.0 38.0 20-24 37.692899999999995 38.0 38.0 38.0 38.0 38.0 25-29 37.6844 38.0 38.0 38.0 38.0 38.0 30-34 37.66575 38.0 38.0 38.0 38.0 38.0 35-39 37.650999999999996 38.0 38.0 38.0 38.0 38.0 40-44 37.6052 38.0 38.0 38.0 38.0 38.0 45-49 37.5589 38.0 38.0 38.0 38.0 38.0 50-54 37.58885 38.0 38.0 38.0 38.0 38.0 55-59 37.538850000000004 38.0 38.0 38.0 38.0 38.0 60-64 37.507549999999995 38.0 38.0 38.0 38.0 38.0 65-69 37.46675 38.0 38.0 38.0 37.4 38.0 70-74 37.406 38.0 38.0 38.0 37.0 38.0 75-79 37.4133 38.0 38.0 38.0 37.0 38.0 80-84 37.3205 38.0 38.0 38.0 37.0 38.0 85-89 37.2959 38.0 38.0 38.0 37.0 38.0 90-94 37.246249999999996 38.0 38.0 38.0 37.0 38.0 95-99 37.20855 38.0 38.0 38.0 36.8 38.0 100-104 37.1769 38.0 38.0 38.0 36.2 38.0 105-109 37.064550000000004 38.0 38.0 38.0 36.0 38.0 110-114 36.898250000000004 38.0 38.0 38.0 35.6 38.0 115-119 36.8286 38.0 38.0 38.0 35.0 38.0 120-124 36.77225 38.0 38.0 38.0 35.0 38.0 125-129 36.686350000000004 38.0 38.0 38.0 34.8 38.0 130-134 36.3204 38.0 38.0 38.0 33.8 38.0 135-139 36.1927 38.0 37.8 38.0 33.6 38.0 140-144 36.1694 38.0 37.6 38.0 33.4 38.0 145-149 35.787699999999994 38.0 36.4 38.0 33.0 38.0 150-151 32.84375 37.0 33.5 38.0 17.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 1.0 10 1.0 11 0.0 12 0.0 13 0.0 14 0.0 15 1.0 16 0.0 17 3.0 18 1.0 19 0.0 20 2.0 21 1.0 22 0.0 23 4.0 24 1.0 25 5.0 26 6.0 27 11.0 28 11.0 29 21.0 30 15.0 31 26.0 32 39.0 33 44.0 34 84.0 35 151.0 36 474.0 37 3097.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.26315789473684 15.526315789473685 11.657894736842104 36.55263157894737 2 20.3 19.7 36.725 23.275000000000002 3 19.35 27.6 26.0 27.05 4 22.775000000000002 34.599999999999994 21.0 21.625 5 20.875 35.375 23.925 19.825 6 17.45 36.8 25.75 20.0 7 13.625000000000002 22.775000000000002 43.95 19.650000000000002 8 18.575 23.325000000000003 29.049999999999997 29.049999999999997 9 17.525 22.400000000000002 32.225 27.85 10-14 20.21 28.505000000000003 26.875 24.41 15-19 20.349999999999998 27.83 27.91 23.91 20-24 20.075000000000003 28.43 27.395000000000003 24.099999999999998 25-29 19.975 27.93 27.47 24.625 30-34 19.27 28.945 27.51 24.275 35-39 20.125 28.78 27.315 23.78 40-44 20.095 28.360000000000003 27.889999999999997 23.655 45-49 19.950000000000003 28.415000000000003 27.339999999999996 24.295 50-54 20.005 28.64 27.900000000000002 23.455000000000002 55-59 20.04 28.110000000000003 27.505000000000003 24.345 60-64 19.79 28.499999999999996 27.57 24.14 65-69 20.085 28.444999999999997 27.87 23.599999999999998 70-74 20.45 28.555000000000003 27.735 23.26 75-79 19.744999999999997 28.17 28.044999999999998 24.04 80-84 20.200000000000003 27.950000000000003 27.805000000000003 24.044999999999998 85-89 20.275000000000002 28.455000000000002 27.675 23.595 90-94 20.145 28.035 27.884999999999998 23.935000000000002 95-99 20.244999999999997 27.700000000000003 28.12 23.935000000000002 100-104 20.375 28.02 27.589999999999996 24.015 105-109 20.235 28.144999999999996 28.09 23.53 110-114 20.445 28.01 27.839999999999996 23.705000000000002 115-119 20.565 28.15 28.065 23.22 120-124 21.115000000000002 27.794999999999998 27.63 23.46 125-129 20.665 28.244999999999997 27.800000000000004 23.29 130-134 20.27 28.09 27.644999999999996 23.995 135-139 20.46 27.88 27.42 24.240000000000002 140-144 21.035 27.72 27.36 23.885 145-149 20.655 27.485 28.050000000000004 23.810000000000002 150-151 20.9375 27.6375 27.35 24.075 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 1.5 24 3.5 25 3.0 26 3.0 27 6.5 28 7.5 29 14.0 30 19.5 31 18.0 32 25.5 33 41.0 34 53.0 35 57.0 36 68.5 37 100.0 38 134.5 39 158.5 40 197.0 41 243.0 42 259.0 43 264.0 44 267.5 45 275.0 46 268.0 47 262.0 48 247.0 49 211.0 50 173.0 51 134.5 52 116.5 53 94.0 54 71.0 55 49.0 56 40.0 57 34.0 58 19.0 59 15.5 60 13.0 61 7.5 62 5.0 63 4.5 64 3.5 65 3.0 66 2.5 67 1.0 68 0.5 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 5.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.84977466199298 99.7 2 0.15022533800701052 0.3 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.037500000000000006 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.0875 0.0 0.0 0.0 0.0 94-95 0.1375 0.0 0.0 0.0 0.0 96-97 0.225 0.0 0.0 0.0 0.0 98-99 0.2875 0.0 0.0 0.0 0.0 100-101 0.3625 0.0 0.0 0.0 0.0 102-103 0.4375 0.0 0.0 0.0 0.0 104-105 0.5125 0.0 0.0 0.0 0.0 106-107 0.5375000000000001 0.0 0.0 0.0 0.0 108-109 0.6625000000000001 0.0 0.0 0.0 0.0 110-111 0.75 0.0 0.0 0.0 0.0 112-113 0.8875 0.0 0.0 0.0 0.0 114-115 0.9624999999999999 0.0 0.0 0.0 0.0 116-117 1.0875 0.0 0.0 0.0 0.0 118-119 1.3375 0.0 0.0 0.0 0.0 120-121 1.4500000000000002 0.0 0.0 0.0 0.0 122-123 1.6375 0.0 0.0 0.0 0.0 124-125 1.9125 0.0 0.0 0.0 0.0 126-127 2.175 0.0 0.0 0.0 0.0 128-129 2.45 0.0 0.0 0.0 0.0 130-131 2.85 0.0 0.0 0.0 0.0 132-133 3.2875 0.0 0.0 0.0 0.0 134-135 3.5875000000000004 0.0 0.0 0.0 0.0 136-137 3.9375 0.0 0.0 0.0 0.0 138-139 4.275 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TAATCCA 10 0.006836113 144.9625 4 >>END_MODULE SRR7180074 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7180074_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.20825 33.0 33.0 34.0 33.0 34.0 2 33.3045 34.0 33.0 34.0 33.0 34.0 3 33.291 34.0 33.0 34.0 33.0 34.0 4 33.29275 34.0 33.0 34.0 33.0 34.0 5 33.29425 34.0 33.0 34.0 33.0 34.0 6 37.48175 38.0 38.0 38.0 38.0 38.0 7 37.48475 38.0 38.0 38.0 38.0 38.0 8 37.37625 38.0 38.0 38.0 38.0 38.0 9 37.458 38.0 38.0 38.0 38.0 38.0 10-14 37.4565 38.0 38.0 38.0 38.0 38.0 15-19 37.41325 38.0 38.0 38.0 38.0 38.0 20-24 37.3854 38.0 38.0 38.0 37.8 38.0 25-29 37.406150000000004 38.0 38.0 38.0 38.0 38.0 30-34 37.36415 38.0 38.0 38.0 37.6 38.0 35-39 37.27535 38.0 38.0 38.0 37.0 38.0 40-44 37.2243 38.0 38.0 38.0 37.0 38.0 45-49 37.23295 38.0 38.0 38.0 37.0 38.0 50-54 37.21855 38.0 38.0 38.0 37.0 38.0 55-59 37.19495 38.0 38.0 38.0 36.8 38.0 60-64 37.15085 38.0 38.0 38.0 36.8 38.0 65-69 37.0638 38.0 38.0 38.0 36.2 38.0 70-74 37.032500000000006 38.0 38.0 38.0 36.2 38.0 75-79 37.01945 38.0 38.0 38.0 36.0 38.0 80-84 36.97515 38.0 38.0 38.0 36.0 38.0 85-89 36.8632 38.0 38.0 38.0 36.0 38.0 90-94 36.79625 38.0 38.0 38.0 35.4 38.0 95-99 36.70035 38.0 38.0 38.0 35.0 38.0 100-104 36.3716 38.0 38.0 38.0 34.0 38.0 105-109 36.27575 38.0 38.0 38.0 34.0 38.0 110-114 36.1764 38.0 38.0 38.0 33.8 38.0 115-119 36.22755 38.0 37.8 38.0 34.0 38.0 120-124 35.938100000000006 38.0 37.0 38.0 33.0 38.0 125-129 35.807050000000004 38.0 36.8 38.0 32.6 38.0 130-134 35.451049999999995 38.0 36.0 38.0 31.0 38.0 135-139 35.3451 38.0 36.0 38.0 30.6 38.0 140-144 34.8194 38.0 35.2 38.0 28.0 38.0 145-149 34.23655 38.0 35.0 38.0 25.4 38.0 150-151 30.633875000000003 36.5 29.0 38.0 12.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 1.0 4 3.0 5 0.0 6 2.0 7 0.0 8 0.0 9 2.0 10 0.0 11 0.0 12 1.0 13 2.0 14 1.0 15 1.0 16 6.0 17 1.0 18 3.0 19 1.0 20 2.0 21 6.0 22 2.0 23 9.0 24 9.0 25 10.0 26 15.0 27 12.0 28 18.0 29 25.0 30 33.0 31 53.0 32 56.0 33 85.0 34 105.0 35 231.0 36 612.0 37 2691.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.35 16.825000000000003 15.725 30.099999999999998 2 24.15 23.325000000000003 33.900000000000006 18.625 3 19.8 26.6 31.8 21.8 4 23.575 34.275 23.025000000000002 19.125 5 24.474999999999998 35.825 22.775000000000002 16.925 6 18.904726181545385 38.009502375593904 23.330832708177045 19.754938734683673 7 18.65 18.5 41.75 21.099999999999998 8 20.849999999999998 24.05 28.15 26.950000000000003 9 22.925 24.25 28.425 24.4 10-14 23.72737273727373 28.62786278627863 25.492549254925496 22.152215221522155 15-19 23.23848577286593 27.954193128969347 27.669150372555883 21.13817072560884 20-24 22.988390712570055 28.813050440352285 27.04163330664532 21.156925540432344 25-29 22.750262907506634 28.40402624067304 27.607792077720468 21.237918774099853 30-34 23.137804939137403 28.40254470770926 27.95671993187397 20.502930421279366 35-39 23.629072681704262 27.779448621553886 27.694235588972433 20.897243107769423 40-44 23.346030473135528 28.41820368885325 27.315557337610265 20.920208500400964 45-49 22.939409113670507 28.357536304456687 27.526289434151224 21.176765147721582 50-54 22.96222166624969 28.87165374030523 27.610708031023268 20.555416562421815 55-59 23.12503127032571 27.91814679541702 28.123280132085853 20.833541802171414 60-64 23.899339603762257 27.34640784470682 28.01180708425055 20.74244546728037 65-69 23.773075191355243 28.09545249887438 27.269998499174548 20.861473810595825 70-74 23.6580119065486 28.370603832107662 27.460103056681174 20.511281204662566 75-79 23.675654044319945 27.202241008453804 28.502826271822318 20.619278675403933 80-84 23.52411446868121 27.9217530518311 28.08184910946568 20.472283370022012 85-89 23.986993496748372 27.213606803401703 28.044022011005502 20.755377688844423 90-94 23.765941485371343 28.707176794198553 27.151787946986744 20.37509377344336 95-99 24.036201810090503 28.026401320066004 27.66638331916596 20.271013550677534 100-104 24.143621543231486 27.639145871880782 27.6741511226684 20.543081462219334 105-109 23.75237523752375 28.337833783378336 27.422742274227424 20.487048704870485 110-114 23.98 28.249999999999996 27.42 20.349999999999998 115-119 24.0062003100155 27.986399319965997 27.821391069553474 20.186009300465024 120-124 23.86477295459092 28.225645129025807 27.650530106021204 20.259051810362074 125-129 24.283355845715143 28.805843213767574 27.1849517234479 19.72584921706939 130-134 24.541043469561302 27.94257415837127 27.192236506427893 20.324145865639537 135-139 24.267280184055217 27.808342502750826 27.97339201760528 19.950985295588676 140-144 24.511127781945486 27.961990497624406 27.941985496374095 19.584896224056013 145-149 24.759903961584634 28.61144457783113 27.415966386554626 19.21268507402961 150-151 25.187781672508763 28.01702553830746 27.240861291937907 19.55433149724587 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 1.0 9 0.5 10 0.0 11 0.0 12 0.5 13 1.0 14 0.5 15 0.0 16 0.0 17 0.0 18 1.0 19 1.0 20 0.0 21 1.0 22 1.0 23 1.0 24 1.5 25 2.0 26 4.0 27 4.0 28 6.0 29 11.0 30 10.5 31 15.5 32 24.0 33 25.0 34 30.0 35 48.5 36 78.0 37 100.5 38 121.0 39 156.5 40 183.5 41 221.0 42 267.0 43 289.5 44 291.0 45 300.5 46 284.5 47 268.5 48 252.0 49 210.5 50 177.5 51 125.0 52 105.0 53 93.0 54 70.0 55 57.5 56 44.5 57 35.5 58 23.5 59 15.0 60 12.5 61 9.0 62 5.5 63 4.0 64 1.5 65 2.0 66 2.0 67 0.0 68 0.0 69 0.5 70 0.5 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.025 7 0.0 8 0.0 9 0.0 10-14 0.01 15-19 0.015 20-24 0.08 25-29 0.155 30-34 0.185 35-39 0.25 40-44 0.24 45-49 0.15 50-54 0.075 55-59 0.065 60-64 0.06 65-69 0.055 70-74 0.055 75-79 0.045 80-84 0.06 85-89 0.05 90-94 0.025 95-99 0.005 100-104 0.015 105-109 0.01 110-114 0.0 115-119 0.005 120-124 0.02 125-129 0.055 130-134 0.045 135-139 0.03 140-144 0.025 145-149 0.04 150-151 0.15 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69909729187563 99.4 2 0.3009027081243731 0.6 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.037500000000000006 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.0875 0.0 0.0 0.0 0.0 94-95 0.1375 0.0 0.0 0.0 0.0 96-97 0.225 0.0 0.0 0.0 0.0 98-99 0.2875 0.0 0.0 0.0 0.0 100-101 0.3625 0.0 0.0 0.0 0.0 102-103 0.4375 0.0 0.0 0.0 0.0 104-105 0.5125 0.0 0.0 0.0 0.0 106-107 0.5625 0.0 0.0 0.0 0.0 108-109 0.6875 0.0 0.0 0.0 0.0 110-111 0.7749999999999999 0.0 0.0 0.0 0.0 112-113 0.9125 0.0 0.0 0.0 0.0 114-115 0.9875 0.0 0.0 0.0 0.0 116-117 1.1125 0.0 0.0 0.0 0.0 118-119 1.3624999999999998 0.0 0.0 0.0 0.0 120-121 1.475 0.0 0.0 0.0 0.0 122-123 1.6625 0.0 0.0 0.0 0.0 124-125 1.9625 0.0 0.0 0.0 0.0 126-127 2.2375 0.0 0.0 0.0 0.0 128-129 2.5250000000000004 0.0 0.0 0.0 0.0 130-131 2.925 0.0 0.0 0.0 0.0 132-133 3.3625 0.0 0.0 0.0 0.0 134-135 3.6875 0.0 0.0 0.0 0.0 136-137 4.0125 0.0 0.0 0.0 0.0 138-139 4.35 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 805563 spots for SRR7180074.sra Written 805563 spots for SRR7180074.sra Read 805563 spots for SRR7180074.sra Written 805563 spots for SRR7180074.sra Read 805563 spots for SRR7180074.sra Written 805563 spots for SRR7180074.sra Read 805563 spots for SRR7180074.sra Written 805563 spots for SRR7180074.sra Read 805563 spots for SRR7180074.sra Written 805563 spots for SRR7180074.sra Read 805563 spots for SRR7180074.sra Written 805563 spots for SRR7180074.sra Read 805563 spots for SRR7180074.sra Written 805563 spots for SRR7180074.sra Read 805563 spots for SRR7180074.sra Written 805563 spots for SRR7180074.sra Read 805563 spots for SRR7180074.sra Written 805563 spots for SRR7180074.sra Read 805563 spots for SRR7180074.sra Written 805563 spots for SRR7180074.sra Read 805563 spots for SRR7180074.sra Written 805563 spots for SRR7180074.sra Read 805580 spots for SRR7180074.sra Written 805580 spots for SRR7180074.sra Read 805563 spots for SRR7180074.sra Written 805563 spots for SRR7180074.sra Read 805563 spots for SRR7180074.sra Written 805563 spots for SRR7180074.sra Read 805563 spots for SRR7180074.sra Written 805563 spots for SRR7180074.sra Read 805563 spots for SRR7180074.sra Written 805563 spots for SRR7180074.sra Read 805563 spots for SRR7180074.sra Written 805563 spots for SRR7180074.sra Read 805563 spots for SRR7180074.sra Written 805563 spots for SRR7180074.sra Read 805563 spots for SRR7180074.sra Written 805563 spots for SRR7180074.sra Read 805563 spots for SRR7180074.sra Written 805563 spots for SRR7180074.sra SRR ids: ['SRR7180074.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_yte6c_7x SRR7180074.sra spots: 16111277 blocks: [[1, 805563], [805564, 1611126], [1611127, 2416689], [2416690, 3222252], [3222253, 4027815], [4027816, 4833378], [4833379, 5638941], [5638942, 6444504], [6444505, 7250067], [7250068, 8055630], [8055631, 8861193], [8861194, 9666756], [9666757, 10472319], [10472320, 11277882], [11277883, 12083445], [12083446, 12889008], [12889009, 13694571], [13694572, 14500134], [14500135, 15305697], [15305698, 16111277]] SRR7180074 file size 5437882 SRR7180074 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7180074 SRR7180074_1.fastq SRR7180074_2.fastq Input file: SRR7180074_1.fastq Paired file: SRR7180074_2.fastq trimmed: SRR7180074-trimmed-pair1.fastq, SRR7180074-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 17:36:06 2025 >> started Mon Feb 10 17:36:26 2025 >> done (19.566s) 16111277 read pairs processed; of these: 16618 ( 0.10%) short read pairs filtered out after trimming by size control 9589 ( 0.06%) empty read pairs filtered out after trimming by size control 16085070 (99.84%) read pairs available; of these: 5598256 (34.80%) trimmed read pairs available after processing 10486814 (65.20%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 2 0.00% 20 4 0.00% 21 1 0.00% 22 1 0.00% 23 4 0.00% 24 7 0.00% 25 5 0.00% 26 5 0.00% 27 6 0.00% 28 7 0.00% 29 1 0.00% 30 1 0.00% 31 2 0.00% 32 2 0.00% 33 8 0.00% 34 5 0.00% 35 6 0.00% 36 23 0.00% 37 16 0.00% 38 2 0.00% 39 8 0.00% 40 21 0.00% 41 16 0.00% 42 11 0.00% 43 8 0.00% 44 16 0.00% 45 59 0.00% 46 44 0.00% 47 74 0.00% 48 42 0.00% 49 55 0.00% 50 53 0.00% 51 98 0.00% 52 15 0.00% 53 20 0.00% 54 46 0.00% 55 115 0.00% 56 45 0.00% 57 36 0.00% 58 50 0.00% 59 61 0.00% 60 74 0.00% 61 59 0.00% 62 86 0.00% 63 95 0.00% 64 109 0.00% 65 132 0.00% 66 116 0.00% 67 160 0.00% 68 155 0.00% 69 187 0.00% 70 223 0.00% 71 272 0.00% 72 320 0.00% 73 324 0.00% 74 393 0.00% 75 516 0.00% 76 550 0.00% 77 576 0.00% 78 628 0.00% 79 745 0.00% 80 874 0.01% 81 972 0.01% 82 1098 0.01% 83 1331 0.01% 84 2407 0.01% 85 2941 0.02% 86 3003 0.02% 87 3212 0.02% 88 3505 0.02% 89 3749 0.02% 90 3912 0.02% 91 4144 0.03% 92 4413 0.03% 93 4920 0.03% 94 4948 0.03% 95 5374 0.03% 96 5720 0.04% 97 6105 0.04% 98 6606 0.04% 99 6953 0.04% 100 7457 0.05% 101 7976 0.05% 102 8449 0.05% 103 9243 0.06% 104 9740 0.06% 105 10259 0.06% 106 11217 0.07% 107 12145 0.08% 108 12571 0.08% 109 13187 0.08% 110 14146 0.09% 111 14936 0.09% 112 16057 0.10% 113 16470 0.10% 114 17418 0.11% 115 18457 0.11% 116 19251 0.12% 117 20336 0.13% 118 21941 0.14% 119 22428 0.14% 120 23785 0.15% 121 25712 0.16% 122 26171 0.16% 123 27049 0.17% 124 28240 0.18% 125 28680 0.18% 126 30298 0.19% 127 31546 0.20% 128 32995 0.21% 129 34543 0.21% 130 36197 0.23% 131 37749 0.23% 132 40106 0.25% 133 42090 0.26% 134 43274 0.27% 135 46245 0.29% 136 48558 0.30% 137 51377 0.32% 138 54677 0.34% 139 58095 0.36% 140 61112 0.38% 141 66339 0.41% 142 72646 0.45% 143 79777 0.50% 144 89090 0.55% 145 102958 0.64% 146 123297 0.77% 147 159541 0.99% 148 234575 1.46% 149 466588 2.90% 150 3028353 18.83% 151 10486814 65.20% 16085070 reads passed initial QC criterion=sequence-density sequence-density=0.29 sequence-density-rank=1 fanout-score=2.88 fanout-score-rank=28 prefix-density=0.41 prefix-fanout=2.1 sequence=CATCTCAGACCTCTCATAGAACATCTTAACTGGTGCAACACCTGCAATGATTGTCTCAGTTGTGGTGTTCTCTGAGAAACCTAAGTCAGGGTACAT criterion=fanout-score sequence-density=0.04 sequence-density-rank=31 fanout-score=20.57 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=6.5 sequence=TGCAAATCCAAGAAGATTTGCAGAAAACAAGCCATGAATATATACTAGCTACTTTATTGAAACTTGTTGAAGACAAGAGACAACCCTTATAAACGCCTAGTAGATGAAATATTATTTCTTGTCAATCCGTCGATGCGATGATCATTTCTTGAATCAACGCAGCCAGCGGATCGCTCTCATTTACAAGTGCAAGGATCGCAGGTACAGTTGGCTCCACACTTGC criterion=sequence-density sequence-density=0.53 sequence-density-rank=1 fanout-score=2.72 fanout-score-rank=20 prefix-density=0.54 prefix-fanout=2.7 sequence=ATGTACCCTGACTTAGGTTTCTCAGA criterion=fanout-score sequence-density=0.11 sequence-density-rank=21 fanout-score=23.76 fanout-score-rank=1 prefix-density=0.31 prefix-fanout=8.3 sequence=AAGGCCAAGATCCAGGACAAGGA SRR7180074 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 17:37:15 Started mapping on | Feb 10 17:37:15 Finished on | Feb 10 17:39:33 Mapping speed, Million of reads per hour | 419.61 Number of input reads | 16085070 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 14987756 Uniquely mapped reads % | 93.18% Average mapped length | 296.36 Number of splices: Total | 15126457 Number of splices: Annotated (sjdb) | 14862450 Number of splices: GT/AG | 14888050 Number of splices: GC/AG | 190552 Number of splices: AT/AC | 11516 Number of splices: Non-canonical | 36339 Mismatch rate per base, % | 0.32% Deletion rate per base | 0.03% Deletion average length | 2.59 Insertion rate per base | 0.02% Insertion average length | 2.56 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 370710 % of reads mapped to multiple loci | 2.30% Number of reads mapped to too many loci | 41380 % of reads mapped to too many loci | 0.26% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.20% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 740568 740568 740568 N_multimapping 370710 370710 370710 N_noFeature 351658 14853676 406884 N_ambiguous 159045 968 79572 UnstrandedReadsAssigned:14477053 PositiveStrandReadsAssigned:133112 NegativeStrandReadsAssigned:14501300 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7180074 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7180074-trimmed-pair1.fastq SRR7180074-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,085,070 reads, 14,407,396 reads pseudoaligned [quant] estimated average fragment length: 242.276 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,216 rounds 52401 SRR7180074.ke.tsv 34699 SRR7180074.se.tsv 87100 total ==> SRR7180074.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1776.72 1308 47.8072 Potri.005G024800.1.v4.1 1035 793.724 327 26.7537 Potri.004G059700.1.v4.1 961 719.752 30 2.70672 Potri.007G009000.2.v4.1 1416 1174.72 0 0 Potri.003G141000.2.v4.1 2943 2701.72 787.259 18.9227 Potri.016G087400.1.v4.1 270 75.9409 1191 1018.45 Potri.015G069301.1.v4.1 564 326.132 0 0 Potri.010G195200.1.v4.1 1773 1531.72 388 16.4497 Potri.012G127500.1.v4.1 977 735.73 5119 451.827 ==> SRR7180074.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 45 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 388 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 517 SRR7180074 completed mapping pipeline successfully