Starting /dee2/code/volunteer_pipeline.sh SRR7180075 current disk space = 3058198888448 free memory = 1445366084 SRR7180075 SRAfilesize 09c0411e29b317190ffb0bc78e4afab1 SRR7180075.sra SRR7180075.sra file validated SRR7180075 is paired end SRR7180075 is conventional basespace SRR7180075 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7180075_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 24.76875 28.0 18.0 32.0 18.0 33.0 2 30.2645 31.0 29.0 33.0 27.0 33.0 3 30.79175 31.0 29.0 33.0 27.0 33.0 4 32.081 33.0 32.0 33.0 31.0 33.0 5 32.70075 33.0 33.0 33.0 32.0 34.0 6 36.51575 38.0 37.0 38.0 34.0 38.0 7 37.2955 38.0 38.0 38.0 36.0 38.0 8 37.37975 38.0 38.0 38.0 37.0 38.0 9 37.49775 38.0 38.0 38.0 37.0 38.0 10-14 37.56165 38.0 38.0 38.0 38.0 38.0 15-19 37.61295 38.0 38.0 38.0 38.0 38.0 20-24 37.56985 38.0 38.0 38.0 38.0 38.0 25-29 37.50305 38.0 38.0 38.0 37.8 38.0 30-34 37.48725 38.0 38.0 38.0 37.8 38.0 35-39 37.43515000000001 38.0 38.0 38.0 37.4 38.0 40-44 37.39855 38.0 38.0 38.0 37.2 38.0 45-49 37.36565 38.0 38.0 38.0 37.0 38.0 50-54 37.33945 38.0 38.0 38.0 37.0 38.0 55-59 37.304050000000004 38.0 38.0 38.0 37.0 38.0 60-64 37.232 38.0 38.0 38.0 36.8 38.0 65-69 37.17505 38.0 38.0 38.0 36.6 38.0 70-74 37.12055 38.0 38.0 38.0 36.2 38.0 75-79 37.058350000000004 38.0 38.0 38.0 36.2 38.0 80-84 36.9752 38.0 38.0 38.0 36.0 38.0 85-89 36.942949999999996 38.0 38.0 38.0 35.8 38.0 90-94 36.92725 38.0 38.0 38.0 35.8 38.0 95-99 36.77505 38.0 38.0 38.0 35.2 38.0 100-104 36.709 38.0 38.0 38.0 34.8 38.0 105-109 36.619749999999996 38.0 38.0 38.0 34.6 38.0 110-114 36.4913 38.0 38.0 38.0 34.2 38.0 115-119 36.3754 38.0 38.0 38.0 34.0 38.0 120-124 36.254599999999996 38.0 37.8 38.0 34.0 38.0 125-129 36.0969 38.0 37.8 38.0 33.6 38.0 130-134 35.75915 38.0 37.0 38.0 32.2 38.0 135-139 35.6137 38.0 36.6 38.0 31.8 38.0 140-144 35.282500000000006 38.0 36.0 38.0 31.0 38.0 145-149 34.831450000000004 38.0 36.0 38.0 29.4 38.0 150-151 31.790375 36.5 32.0 38.0 14.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 1.0 7 0.0 8 1.0 9 1.0 10 0.0 11 0.0 12 1.0 13 1.0 14 2.0 15 1.0 16 0.0 17 2.0 18 1.0 19 2.0 20 4.0 21 4.0 22 2.0 23 5.0 24 7.0 25 10.0 26 18.0 27 20.0 28 19.0 29 30.0 30 26.0 31 33.0 32 58.0 33 83.0 34 131.0 35 220.0 36 574.0 37 2742.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 34.98427672955975 13.626834381551362 13.626834381551362 37.76205450733753 2 19.75 17.825 37.275000000000006 25.15 3 20.150000000000002 22.775000000000002 27.325 29.75 4 23.25 28.7 23.3 24.75 5 21.175 30.55 26.450000000000003 21.825 6 18.8 34.925 25.95 20.325 7 14.6 23.65 43.025000000000006 18.725 8 16.8 24.825 31.85 26.525 9 17.7 24.349999999999998 33.275 24.675 10-14 20.24 29.955 27.04 22.765 15-19 19.245 28.810000000000002 27.805000000000003 24.14 20-24 19.405 28.575 28.335 23.685000000000002 25-29 19.48 28.525 28.26 23.735 30-34 19.88 27.92 28.465 23.735 35-39 19.56 28.444999999999997 27.96 24.035 40-44 19.655 28.765 27.935 23.645 45-49 19.830000000000002 28.57 27.555000000000003 24.044999999999998 50-54 19.634999999999998 27.93 28.355000000000004 24.08 55-59 20.11 28.494999999999997 27.62 23.775 60-64 19.919999999999998 28.125 28.02 23.935000000000002 65-69 20.01 28.560000000000002 27.939999999999998 23.49 70-74 20.015 28.345 27.875 23.765 75-79 19.63 28.110000000000003 27.689999999999998 24.57 80-84 19.955000000000002 27.72 27.779999999999998 24.545 85-89 20.445 27.76 27.815 23.98 90-94 20.16 28.294999999999998 27.92 23.625 95-99 19.7 27.639999999999997 28.08 24.58 100-104 20.27 27.98 27.92 23.830000000000002 105-109 20.560000000000002 27.79 27.76 23.89 110-114 20.115 27.6 28.134999999999998 24.15 115-119 20.915 26.72 28.475 23.89 120-124 20.86 27.98 27.12 24.04 125-129 20.015 27.605 27.860000000000003 24.52 130-134 20.515 28.185 27.345000000000002 23.955000000000002 135-139 20.4 27.555000000000003 28.110000000000003 23.935000000000002 140-144 21.11 27.439999999999998 27.68 23.77 145-149 21.135 28.585 26.939999999999998 23.34 150-151 20.75 28.075 26.237500000000004 24.9375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 2.0 1 1.0 2 1.0 3 1.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 1.0 17 0.5 18 0.5 19 0.5 20 0.0 21 0.5 22 1.0 23 2.5 24 3.5 25 4.5 26 6.5 27 9.0 28 9.0 29 13.5 30 21.0 31 26.0 32 37.5 33 54.5 34 66.5 35 75.0 36 90.0 37 112.5 38 134.0 39 149.5 40 186.5 41 199.5 42 222.0 43 271.5 44 276.0 45 267.5 46 255.5 47 240.5 48 233.0 49 204.5 50 165.0 51 142.5 52 121.0 53 101.5 54 72.5 55 49.5 56 43.0 57 34.0 58 26.0 59 17.5 60 9.5 61 6.5 62 7.0 63 5.5 64 3.0 65 2.5 66 2.0 67 1.5 68 3.0 69 3.0 70 1.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.6 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67377666248431 99.3 2 0.301129234629862 0.6 3 0.0 0.0 4 0.02509410288582183 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.037500000000000006 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.07500000000000001 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.175 0.0 0.0 0.0 0.0 96-97 0.2875 0.0 0.0 0.0 0.0 98-99 0.3625 0.0 0.0 0.0 0.0 100-101 0.4625 0.0 0.0 0.0 0.0 102-103 0.5375000000000001 0.0 0.0 0.0 0.0 104-105 0.6 0.0 0.0 0.0 0.0 106-107 0.7749999999999999 0.0 0.0 0.0 0.0 108-109 0.8625 0.0 0.0 0.0 0.0 110-111 1.075 0.0 0.0 0.0 0.0 112-113 1.2625 0.0 0.0 0.0 0.0 114-115 1.375 0.0 0.0 0.0 0.0 116-117 1.5375 0.0 0.0 0.0 0.0 118-119 1.8375 0.0 0.0 0.0 0.0 120-121 2.1 0.0 0.0 0.0 0.0 122-123 2.425 0.0 0.0 0.0 0.0 124-125 2.8375000000000004 0.0 0.0 0.0 0.0 126-127 3.15 0.0 0.0 0.0 0.0 128-129 3.525 0.0 0.0 0.0 0.0 130-131 3.85 0.0 0.0 0.0 0.0 132-133 4.225 0.0 0.0 0.0 0.0 134-135 4.550000000000001 0.0 0.0 0.0 0.0 136-137 4.887499999999999 0.0 0.0 0.0 0.0 138-139 5.4625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7180075 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7180075_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.854 33.0 33.0 34.0 32.0 34.0 2 32.99475 33.0 33.0 34.0 32.0 34.0 3 32.95825 34.0 33.0 34.0 32.0 34.0 4 32.928 34.0 33.0 34.0 32.0 34.0 5 32.904 34.0 33.0 34.0 32.0 34.0 6 37.03175 38.0 38.0 38.0 37.0 38.0 7 37.07625 38.0 38.0 38.0 37.0 38.0 8 36.99475 38.0 38.0 38.0 37.0 38.0 9 37.1095 38.0 38.0 38.0 37.0 38.0 10-14 37.1226 38.0 38.0 38.0 37.0 38.0 15-19 37.0413 38.0 38.0 38.0 36.8 38.0 20-24 37.023599999999995 38.0 38.0 38.0 36.8 38.0 25-29 37.019999999999996 38.0 38.0 38.0 37.0 38.0 30-34 37.0386 38.0 38.0 38.0 37.0 38.0 35-39 36.96765 38.0 38.0 38.0 37.0 38.0 40-44 36.931450000000005 38.0 38.0 38.0 36.8 38.0 45-49 36.942949999999996 38.0 38.0 38.0 36.2 38.0 50-54 36.9731 38.0 38.0 38.0 36.6 38.0 55-59 36.899899999999995 38.0 38.0 38.0 36.4 38.0 60-64 36.736000000000004 38.0 38.0 38.0 35.6 38.0 65-69 36.8365 38.0 38.0 38.0 36.0 38.0 70-74 36.818149999999996 38.0 38.0 38.0 36.0 38.0 75-79 36.74255 38.0 38.0 38.0 35.8 38.0 80-84 36.67695 38.0 38.0 38.0 35.6 38.0 85-89 36.54325 38.0 38.0 38.0 34.8 38.0 90-94 36.4118 38.0 38.0 38.0 34.2 38.0 95-99 36.25945 38.0 38.0 38.0 34.0 38.0 100-104 36.149350000000005 38.0 38.0 38.0 33.8 38.0 105-109 36.04005 38.0 37.8 38.0 33.4 38.0 110-114 36.118700000000004 38.0 38.0 38.0 34.0 38.0 115-119 35.990300000000005 38.0 38.0 38.0 33.2 38.0 120-124 35.7502 38.0 37.2 38.0 32.4 38.0 125-129 35.54630000000001 38.0 36.4 38.0 31.0 38.0 130-134 35.16155 38.0 36.0 38.0 29.0 38.0 135-139 34.989250000000006 38.0 36.0 38.0 28.4 38.0 140-144 34.654199999999996 38.0 35.4 38.0 27.8 38.0 145-149 34.09505 38.0 35.0 38.0 24.4 38.0 150-151 30.755125 36.5 29.5 38.0 8.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 15.0 3 5.0 4 6.0 5 0.0 6 0.0 7 1.0 8 2.0 9 1.0 10 1.0 11 1.0 12 2.0 13 1.0 14 0.0 15 1.0 16 1.0 17 3.0 18 4.0 19 5.0 20 3.0 21 6.0 22 7.0 23 10.0 24 9.0 25 12.0 26 13.0 27 20.0 28 31.0 29 23.0 30 44.0 31 50.0 32 67.0 33 93.0 34 138.0 35 198.0 36 550.0 37 2677.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.868934467233615 16.58329164582291 16.358179089544773 29.189594797398698 2 24.5311327831958 23.080770192548137 34.38359589897475 18.00450112528132 3 22.20555138784696 27.906976744186046 29.257314328582147 20.630157539384847 4 25.374999999999996 34.925 21.224999999999998 18.475 5 24.381095273818453 35.33383345836459 22.58064516129032 17.704426106526633 6 20.030007501875467 36.78419604901225 24.006001500375092 19.179794948737182 7 18.734367183591797 18.584292146073036 40.24512256128064 22.436218109054526 8 22.125 24.349999999999998 27.1 26.424999999999997 9 22.405601400350086 26.756689172293076 26.9567391847962 23.88097024256064 10-14 23.974999999999998 28.634999999999998 25.835 21.555 15-19 23.475868967241812 27.70692673168292 27.151787946986744 21.66541635408852 20-24 23.426398478935255 28.09466626638647 27.279095366756728 21.199839887921545 25-29 23.90488110137672 27.619524405506883 27.163954943679595 21.311639549436794 30-34 23.428342433501978 28.272303761959627 27.285478134548914 21.01387566998948 35-39 23.63736649450935 27.87945645088502 27.458256029684602 21.024921024921024 40-44 23.914569337210466 28.406698084829042 27.25859821518099 20.420134362779503 45-49 23.217413059794847 28.20615461596197 27.285464098073554 21.290968226169625 50-54 23.63090772693173 28.342085521380344 27.08677169292323 20.940235058764692 55-59 23.91739173917392 28.03780378037804 27.202720272027204 20.842084208420843 60-64 23.537353735373536 28.622862286228624 26.737673767376734 21.102110211021103 65-69 24.211210560528027 27.78138906945347 27.371368568428423 20.63603180159008 70-74 24.545 28.17 26.779999999999998 20.505000000000003 75-79 23.11 28.395 27.875 20.62 80-84 23.93 27.279999999999998 27.915 20.875 85-89 24.104999999999997 27.16 28.09 20.645 90-94 23.724999999999998 27.985 27.544999999999998 20.745 95-99 24.355 28.555000000000003 27.02 20.07 100-104 24.47 27.825 26.93 20.775 105-109 23.945 27.73 27.805000000000003 20.52 110-114 24.03 27.935 27.284999999999997 20.75 115-119 24.92 27.455000000000002 27.355 20.27 120-124 24.625 28.345 27.189999999999998 19.84 125-129 24.779999999999998 28.475 26.939999999999998 19.805 130-134 24.995 27.96 26.915 20.13 135-139 24.635 28.07 27.41 19.885 140-144 25.16 28.310000000000002 26.87 19.66 145-149 25.555 28.275 26.995 19.175 150-151 24.8906113264158 28.003500437554695 27.490936367045883 19.614951868983624 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.5 15 1.0 16 0.5 17 0.5 18 1.0 19 0.5 20 1.0 21 1.0 22 1.5 23 1.5 24 0.0 25 0.0 26 1.0 27 2.5 28 6.0 29 10.0 30 11.0 31 13.0 32 21.0 33 27.0 34 34.0 35 41.0 36 56.0 37 85.0 38 117.5 39 145.5 40 170.0 41 203.5 42 241.0 43 274.5 44 298.5 45 302.0 46 286.0 47 276.0 48 259.0 49 239.0 50 201.5 51 149.0 52 124.0 53 102.5 54 75.0 55 56.0 56 41.5 57 31.0 58 22.0 59 15.0 60 13.0 61 10.0 62 8.0 63 6.0 64 3.0 65 0.5 66 2.5 67 3.0 68 1.5 69 1.5 70 0.5 71 0.5 72 1.0 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.025 3 0.025 4 0.0 5 0.025 6 0.025 7 0.05 8 0.0 9 0.025 10-14 0.0 15-19 0.025 20-24 0.06999999999999999 25-29 0.125 30-34 0.185 35-39 0.28500000000000003 40-44 0.27 45-49 0.075 50-54 0.025 55-59 0.01 60-64 0.01 65-69 0.005 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.375 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57232704402516 98.95 2 0.27672955974842767 0.5499999999999999 3 0.12578616352201258 0.375 4 0.0 0.0 5 0.025157232704402514 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCAGCTTGAGCAAATTCAGTTTCTAAGCAAAAGCTTTCCAGGCCCCTTTA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.037500000000000006 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.07500000000000001 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.175 0.0 0.0 0.0 0.0 96-97 0.2875 0.0 0.0 0.0 0.0 98-99 0.3625 0.0 0.0 0.0 0.0 100-101 0.4625 0.0 0.0 0.0 0.0 102-103 0.5375000000000001 0.0 0.0 0.0 0.0 104-105 0.6 0.0 0.0 0.0 0.0 106-107 0.7749999999999999 0.0 0.0 0.0 0.0 108-109 0.8625 0.0 0.0 0.0 0.0 110-111 1.075 0.0 0.0 0.0 0.0 112-113 1.2625 0.0 0.0 0.0 0.0 114-115 1.3875 0.0 0.0 0.0 0.0 116-117 1.5625 0.0 0.0 0.0 0.0 118-119 1.8624999999999998 0.0 0.0 0.0 0.0 120-121 2.1375 0.0 0.0 0.0 0.0 122-123 2.4749999999999996 0.0 0.0 0.0 0.0 124-125 2.8375000000000004 0.0 0.0 0.0 0.0 126-127 3.15 0.0 0.0 0.0 0.0 128-129 3.5125 0.0 0.0 0.0 0.0 130-131 3.825 0.0 0.0 0.0 0.0 132-133 4.175000000000001 0.0 0.0 0.0 0.0 134-135 4.5375 0.0 0.0 0.0 0.0 136-137 4.887499999999999 0.0 0.0 0.0 0.0 138-139 5.449999999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCTTGAG 10 0.006830828 145.0 4 TTAGCTG 10 0.006830828 145.0 6 CAGCTTG 10 0.006830828 145.0 2 >>END_MODULE Read 902645 spots for SRR7180075.sra Written 902645 spots for SRR7180075.sra Read 902645 spots for SRR7180075.sra Written 902645 spots for SRR7180075.sra Read 902645 spots for SRR7180075.sra Written 902645 spots for SRR7180075.sra Read 902645 spots for SRR7180075.sra Written 902645 spots for SRR7180075.sra Read 902645 spots for SRR7180075.sra Written 902645 spots for SRR7180075.sra Read 902645 spots for SRR7180075.sra Written 902645 spots for SRR7180075.sra Read 902661 spots for SRR7180075.sra Written 902661 spots for SRR7180075.sra Read 902645 spots for SRR7180075.sra Written 902645 spots for SRR7180075.sra Read 902645 spots for SRR7180075.sra Written 902645 spots for SRR7180075.sra Read 902645 spots for SRR7180075.sra Written 902645 spots for SRR7180075.sra Read 902645 spots for SRR7180075.sra Written 902645 spots for SRR7180075.sra Read 902645 spots for SRR7180075.sra Written 902645 spots for SRR7180075.sra Read 902645 spots for SRR7180075.sra Written 902645 spots for SRR7180075.sra Read 902645 spots for SRR7180075.sra Written 902645 spots for SRR7180075.sra Read 902645 spots for SRR7180075.sra Written 902645 spots for SRR7180075.sra Read 902645 spots for SRR7180075.sra Written 902645 spots for SRR7180075.sra Read 902645 spots for SRR7180075.sra Written 902645 spots for SRR7180075.sra Read 902645 spots for SRR7180075.sra Written 902645 spots for SRR7180075.sra Read 902645 spots for SRR7180075.sra Written 902645 spots for SRR7180075.sra Read 902645 spots for SRR7180075.sra Written 902645 spots for SRR7180075.sra SRR ids: ['SRR7180075.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_r2l7er1y SRR7180075.sra spots: 18052916 blocks: [[1, 902645], [902646, 1805290], [1805291, 2707935], [2707936, 3610580], [3610581, 4513225], [4513226, 5415870], [5415871, 6318515], [6318516, 7221160], [7221161, 8123805], [8123806, 9026450], [9026451, 9929095], [9929096, 10831740], [10831741, 11734385], [11734386, 12637030], [12637031, 13539675], [13539676, 14442320], [14442321, 15344965], [15344966, 16247610], [16247611, 17150255], [17150256, 18052916]] SRR7180075 file size 6095840 SRR7180075 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7180075 SRR7180075_1.fastq SRR7180075_2.fastq Input file: SRR7180075_1.fastq Paired file: SRR7180075_2.fastq trimmed: SRR7180075-trimmed-pair1.fastq, SRR7180075-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 17:05:31 2025 >> started Mon Feb 10 17:06:00 2025 >> done (29.597s) 18052916 read pairs processed; of these: 34243 ( 0.19%) short read pairs filtered out after trimming by size control 29448 ( 0.16%) empty read pairs filtered out after trimming by size control 17989225 (99.65%) read pairs available; of these: 6811057 (37.86%) trimmed read pairs available after processing 11178168 (62.14%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 3 0.00% 20 4 0.00% 21 5 0.00% 22 7 0.00% 23 8 0.00% 24 10 0.00% 25 13 0.00% 26 13 0.00% 27 6 0.00% 28 12 0.00% 29 9 0.00% 30 4 0.00% 31 9 0.00% 32 12 0.00% 33 3 0.00% 34 7 0.00% 35 9 0.00% 36 15 0.00% 37 26 0.00% 38 10 0.00% 39 10 0.00% 40 43 0.00% 41 30 0.00% 42 14 0.00% 43 13 0.00% 44 37 0.00% 45 81 0.00% 46 69 0.00% 47 36 0.00% 48 48 0.00% 49 82 0.00% 50 126 0.00% 51 83 0.00% 52 58 0.00% 53 50 0.00% 54 112 0.00% 55 176 0.00% 56 60 0.00% 57 63 0.00% 58 88 0.00% 59 226 0.00% 60 130 0.00% 61 104 0.00% 62 130 0.00% 63 143 0.00% 64 142 0.00% 65 164 0.00% 66 159 0.00% 67 216 0.00% 68 216 0.00% 69 312 0.00% 70 294 0.00% 71 311 0.00% 72 408 0.00% 73 478 0.00% 74 595 0.00% 75 575 0.00% 76 686 0.00% 77 907 0.01% 78 942 0.01% 79 1012 0.01% 80 1111 0.01% 81 1274 0.01% 82 1616 0.01% 83 1804 0.01% 84 3288 0.02% 85 4335 0.02% 86 4497 0.02% 87 5142 0.03% 88 5355 0.03% 89 5715 0.03% 90 5848 0.03% 91 6135 0.03% 92 6336 0.04% 93 6737 0.04% 94 6998 0.04% 95 7360 0.04% 96 8043 0.04% 97 8469 0.05% 98 8969 0.05% 99 9453 0.05% 100 10080 0.06% 101 10501 0.06% 102 11459 0.06% 103 12408 0.07% 104 13152 0.07% 105 14035 0.08% 106 14778 0.08% 107 15894 0.09% 108 17025 0.09% 109 17836 0.10% 110 18978 0.11% 111 19582 0.11% 112 20705 0.12% 113 21806 0.12% 114 22902 0.13% 115 23989 0.13% 116 25574 0.14% 117 26574 0.15% 118 28354 0.16% 119 30002 0.17% 120 30490 0.17% 121 33001 0.18% 122 34290 0.19% 123 34400 0.19% 124 36245 0.20% 125 37089 0.21% 126 39357 0.22% 127 40890 0.23% 128 42573 0.24% 129 44267 0.25% 130 46468 0.26% 131 48484 0.27% 132 51072 0.28% 133 53825 0.30% 134 56347 0.31% 135 58473 0.33% 136 62124 0.35% 137 64565 0.36% 138 68704 0.38% 139 72092 0.40% 140 76655 0.43% 141 82499 0.46% 142 90324 0.50% 143 99179 0.55% 144 113279 0.63% 145 130064 0.72% 146 158032 0.88% 147 204839 1.14% 148 303654 1.69% 149 588798 3.27% 150 3515244 19.54% 151 11178168 62.14% 17989225 reads passed initial QC criterion=sequence-density sequence-density=0.58 sequence-density-rank=1 fanout-score=2.16 fanout-score-rank=25 prefix-density=0.61 prefix-fanout=2.1 sequence=CAGGTGCAGTTTGATCCACA criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=36.90 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=5.9 sequence=GATATCATAATGACTGAAAAACATCTTACATTGCTTAATCAAACACACGCTAGCTCGCTTATAAGCGCCCCTAGTTAAGGGAAACCTTTATTTAATAAAGTCACAAACAAAAGCGGGCTTAGCTAAAATCAATTCTGCTCCATCGTAATTAAGAGACCATGAGCACATCAACAAGCAACTTTGTCTCGCTAATTAGTAGTTATAATTAGCAGTAGTACTTGGCCTTGGTTCAAAATCATCCGAAGACGATTTTTTTCCTTTAAGCCCGACACCATCATCATAAACTGATATGTTAGGTCCTGGTTCGAAGTCCTCCTGAAAAGATTTTTCTCCTTTAAGAGTAGCGTCGTCGTGGTAAACGGACACATTAGGCCTCGGCTCAACATCTTCAGCGAAGGATCTCTCTCCTTTAACGTCACCATCATTGTAAAGGAACAACTGAGAGTTTGGGTGGAAATGTTTCGAAAAGGACTTATCTTTTGCTGGTTTTATACCATTGTCATAAGATGTA criterion=sequence-density sequence-density=0.74 sequence-density-rank=1 fanout-score=2.53 fanout-score-rank=20 prefix-density=0.75 prefix-fanout=2.5 sequence=ATGTACCCTGACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=28 fanout-score=102.09 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=8.8 sequence=TTTTCTTTGAGAGTGCATAGATTTGTGTTGATATAGAAAACAATGGCACTACATGGAAAGATTGAGACAACATTAGAACTCAAGTCCTCCGCAGAGAAGTTCTACAAAGTGTGGAGGAGCCAGTCCTTCCATGTTCCCAAACATGCTTCCAAGCATATCCAAGGAGTTGATATACATGCAGGTGACTGGGAGACTGCGGGCTCTATCAGGATTTGGCAGTACACAATCGGAGGGAAAGCCGGGGTCTTTAAAGAGGAGGTTTCCTTCGATGATGAGAACAAGATCATAACTCTTAATGGTTTGGAAGGAGATGTCATGAAAATTTACAAGGTCTATA SRR7180075 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 17:07:03 Started mapping on | Feb 10 17:07:03 Finished on | Feb 10 17:09:41 Mapping speed, Million of reads per hour | 409.88 Number of input reads | 17989225 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 16744436 Uniquely mapped reads % | 93.08% Average mapped length | 295.46 Number of splices: Total | 16273220 Number of splices: Annotated (sjdb) | 15962012 Number of splices: GT/AG | 16014823 Number of splices: GC/AG | 204040 Number of splices: AT/AC | 12147 Number of splices: Non-canonical | 42210 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.69 Insertion rate per base | 0.02% Insertion average length | 2.59 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 452262 % of reads mapped to multiple loci | 2.51% Number of reads mapped to too many loci | 43177 % of reads mapped to too many loci | 0.24% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.10% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 823352 823352 823352 N_multimapping 452262 452262 452262 N_noFeature 390845 16580431 453437 N_ambiguous 182564 867 80619 UnstrandedReadsAssigned:16171027 PositiveStrandReadsAssigned:163138 NegativeStrandReadsAssigned:16210380 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7180075 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7180075-trimmed-pair1.fastq SRR7180075-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,989,225 reads, 16,062,156 reads pseudoaligned [quant] estimated average fragment length: 234.598 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,091 rounds 52401 SRR7180075.ke.tsv 34699 SRR7180075.se.tsv 87100 total ==> SRR7180075.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1784.4 1506 43.8616 Potri.005G024800.1.v4.1 1035 801.402 244 15.8231 Potri.004G059700.1.v4.1 961 727.407 49 3.50083 Potri.007G009000.2.v4.1 1416 1182.4 0 0 Potri.003G141000.2.v4.1 2943 2709.4 604 11.5855 Potri.016G087400.1.v4.1 270 77.8025 1563 1044.04 Potri.015G069301.1.v4.1 564 332.883 0 0 Potri.010G195200.1.v4.1 1773 1539.4 570 19.2431 Potri.012G127500.1.v4.1 977 743.402 4719 329.897 ==> SRR7180075.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 24 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 577 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 4 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 7 Potri.001G452600.v4.1 460 SRR7180075 completed mapping pipeline successfully