Starting /dee2/code/volunteer_pipeline.sh SRR7180076 current disk space = 3058113773568 free memory = 1473402724 SRR7180076 SRAfilesize 589feeeca8595efb69776ad8bdfdf9ca SRR7180076.sra SRR7180076.sra file validated SRR7180076 is paired end SRR7180076 is conventional basespace SRR7180076 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7180076_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.08875 33.0 33.0 34.0 30.0 34.0 2 32.6845 33.0 33.0 34.0 30.0 34.0 3 32.562 33.0 33.0 34.0 30.0 34.0 4 32.28575 33.0 33.0 34.0 31.0 34.0 5 32.73025 33.0 33.0 34.0 32.0 34.0 6 37.1095 38.0 37.0 38.0 36.0 38.0 7 37.58425 38.0 38.0 38.0 37.0 38.0 8 37.63575 38.0 38.0 38.0 38.0 38.0 9 37.68225 38.0 38.0 38.0 38.0 38.0 10-14 37.73015 38.0 38.0 38.0 38.0 38.0 15-19 37.733450000000005 38.0 38.0 38.0 38.0 38.0 20-24 37.72495 38.0 38.0 38.0 38.0 38.0 25-29 37.727850000000004 38.0 38.0 38.0 38.0 38.0 30-34 37.67525 38.0 38.0 38.0 38.0 38.0 35-39 37.68175 38.0 38.0 38.0 38.0 38.0 40-44 37.6274 38.0 38.0 38.0 38.0 38.0 45-49 37.616699999999994 38.0 38.0 38.0 38.0 38.0 50-54 37.59065 38.0 38.0 38.0 38.0 38.0 55-59 37.5741 38.0 38.0 38.0 38.0 38.0 60-64 37.523849999999996 38.0 38.0 38.0 38.0 38.0 65-69 37.50335 38.0 38.0 38.0 37.4 38.0 70-74 37.46419999999999 38.0 38.0 38.0 37.2 38.0 75-79 37.43015 38.0 38.0 38.0 37.0 38.0 80-84 37.41315000000001 38.0 38.0 38.0 37.0 38.0 85-89 37.35845 38.0 38.0 38.0 37.0 38.0 90-94 37.324149999999996 38.0 38.0 38.0 37.0 38.0 95-99 37.20285 38.0 38.0 38.0 36.8 38.0 100-104 37.12515 38.0 38.0 38.0 36.0 38.0 105-109 37.0349 38.0 38.0 38.0 36.0 38.0 110-114 36.97865 38.0 38.0 38.0 36.0 38.0 115-119 36.9077 38.0 38.0 38.0 35.6 38.0 120-124 36.80445000000001 38.0 38.0 38.0 35.0 38.0 125-129 36.6768 38.0 38.0 38.0 34.8 38.0 130-134 36.4794 38.0 38.0 38.0 34.2 38.0 135-139 36.2429 38.0 38.0 38.0 33.8 38.0 140-144 36.03935 38.0 37.8 38.0 33.0 38.0 145-149 35.792449999999995 38.0 37.2 38.0 33.2 38.0 150-151 33.266125 37.0 34.0 38.0 17.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 1.0 15 0.0 16 0.0 17 0.0 18 0.0 19 1.0 20 1.0 21 2.0 22 1.0 23 2.0 24 7.0 25 12.0 26 8.0 27 8.0 28 14.0 29 13.0 30 17.0 31 23.0 32 40.0 33 45.0 34 83.0 35 181.0 36 385.0 37 3156.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 31.14104595879556 13.259376650818805 14.368726888536715 41.23085050184891 2 19.5896922692019 18.88916687515637 38.15361521140856 23.367525644233176 3 19.7 24.825 26.424999999999997 29.049999999999997 4 20.225 34.35 22.25 23.175 5 22.125 35.05 24.725 18.099999999999998 6 17.325 35.375 26.174999999999997 21.125 7 14.149999999999999 21.825 43.875 20.150000000000002 8 16.85 22.225 31.1 29.825000000000003 9 16.975 23.45 32.875 26.700000000000003 10-14 20.11 29.020000000000003 27.08 23.79 15-19 19.919999999999998 28.185 27.839999999999996 24.055 20-24 19.615 28.675 27.77 23.94 25-29 19.23 28.804999999999996 27.665 24.3 30-34 19.189999999999998 28.285 28.144999999999996 24.38 35-39 20.11 27.73 28.29 23.87 40-44 19.61 28.575 28.03 23.785 45-49 19.96 28.37 27.96 23.71 50-54 19.915 28.33 27.74 24.015 55-59 20.53 28.275 27.725 23.47 60-64 20.200000000000003 28.42 27.805000000000003 23.575 65-69 19.73 28.395 27.544999999999998 24.33 70-74 20.395 27.810000000000002 28.235 23.56 75-79 20.200000000000003 28.299999999999997 28.1 23.400000000000002 80-84 20.155 27.62 28.21 24.015 85-89 20.54 27.96 27.77 23.73 90-94 20.630000000000003 28.155 27.855 23.36 95-99 20.25 27.400000000000002 28.410000000000004 23.94 100-104 20.25 27.975 27.894999999999996 23.880000000000003 105-109 20.335 27.405 28.175 24.085 110-114 20.599999999999998 27.939999999999998 27.58 23.880000000000003 115-119 20.380000000000003 28.294999999999998 27.55 23.775 120-124 20.53 27.48 27.79 24.2 125-129 20.365 27.46 27.37 24.805 130-134 20.04 27.805000000000003 27.884999999999998 24.27 135-139 20.745 28.01 27.284999999999997 23.96 140-144 20.9 27.67 27.544999999999998 23.885 145-149 20.515 28.515 27.35 23.62 150-151 20.843237833103966 28.962842487176278 27.048667584136123 23.145252095583636 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.5 22 1.0 23 0.5 24 2.5 25 3.5 26 5.5 27 8.0 28 9.0 29 13.0 30 20.5 31 25.5 32 32.5 33 42.5 34 49.0 35 60.0 36 73.0 37 93.0 38 126.5 39 170.0 40 185.5 41 216.0 42 261.5 43 295.0 44 311.0 45 286.5 46 271.5 47 255.5 48 231.0 49 204.5 50 169.0 51 133.5 52 103.0 53 88.5 54 71.5 55 51.0 56 42.5 57 26.0 58 14.5 59 12.5 60 10.0 61 7.0 62 4.5 63 2.5 64 1.0 65 1.0 66 1.0 67 1.0 68 1.5 69 1.0 70 1.0 71 1.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 5.35 2 0.075 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.08750000000000001 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69909729187563 99.4 2 0.3009027081243731 0.6 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1125 0.0 0.0 0.0 0.0 86-87 0.1375 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.175 0.0 0.0 0.0 0.0 92-93 0.21250000000000002 0.0 0.0 0.0 0.0 94-95 0.25 0.0 0.0 0.0 0.0 96-97 0.2875 0.0 0.0 0.0 0.0 98-99 0.325 0.0 0.0 0.0 0.0 100-101 0.3875 0.0 0.0 0.0 0.0 102-103 0.5125 0.0 0.0 0.0 0.0 104-105 0.625 0.0 0.0 0.0 0.0 106-107 0.675 0.0 0.0 0.0 0.0 108-109 0.7124999999999999 0.0 0.0 0.0 0.0 110-111 0.8 0.0 0.0 0.0 0.0 112-113 0.9874999999999999 0.0 0.0 0.0 0.0 114-115 1.0875 0.0 0.0 0.0 0.0 116-117 1.25 0.0 0.0 0.0 0.0 118-119 1.4 0.0 0.0 0.0 0.0 120-121 1.5125 0.0 0.0 0.0 0.0 122-123 1.825 0.0 0.0 0.0 0.0 124-125 2.075 0.0 0.0 0.0 0.0 126-127 2.3499999999999996 0.0 0.0 0.0 0.0 128-129 2.5250000000000004 0.0 0.0 0.0 0.0 130-131 2.7625 0.0 0.0 0.0 0.0 132-133 3.0250000000000004 0.0 0.0 0.0 0.0 134-135 3.3125 0.0 0.0 0.0 0.0 136-137 3.5625 0.0 0.0 0.0 0.0 138-139 3.9625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7180076 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7180076_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.18425 34.0 33.0 34.0 33.0 34.0 2 33.33225 34.0 33.0 34.0 33.0 34.0 3 33.42375 34.0 33.0 34.0 33.0 34.0 4 33.4235 34.0 33.0 34.0 33.0 34.0 5 33.4025 34.0 33.0 34.0 33.0 34.0 6 37.5265 38.0 38.0 38.0 38.0 38.0 7 37.5085 38.0 38.0 38.0 38.0 38.0 8 37.5745 38.0 38.0 38.0 38.0 38.0 9 37.59425 38.0 38.0 38.0 38.0 38.0 10-14 37.560050000000004 38.0 38.0 38.0 38.0 38.0 15-19 37.477999999999994 38.0 38.0 38.0 38.0 38.0 20-24 37.46375 38.0 38.0 38.0 38.0 38.0 25-29 37.441449999999996 38.0 38.0 38.0 38.0 38.0 30-34 37.454299999999996 38.0 38.0 38.0 38.0 38.0 35-39 37.4279 38.0 38.0 38.0 38.0 38.0 40-44 37.345749999999995 38.0 38.0 38.0 37.8 38.0 45-49 37.3929 38.0 38.0 38.0 37.6 38.0 50-54 37.4108 38.0 38.0 38.0 37.6 38.0 55-59 37.4084 38.0 38.0 38.0 37.4 38.0 60-64 37.310700000000004 38.0 38.0 38.0 37.2 38.0 65-69 37.28249999999999 38.0 38.0 38.0 37.0 38.0 70-74 37.22965 38.0 38.0 38.0 37.0 38.0 75-79 37.2693 38.0 38.0 38.0 37.0 38.0 80-84 37.1957 38.0 38.0 38.0 37.0 38.0 85-89 37.107299999999995 38.0 38.0 38.0 36.2 38.0 90-94 37.00664999999999 38.0 38.0 38.0 36.0 38.0 95-99 36.924549999999996 38.0 38.0 38.0 36.0 38.0 100-104 36.8609 38.0 38.0 38.0 35.6 38.0 105-109 36.735499999999995 38.0 38.0 38.0 35.0 38.0 110-114 36.71665 38.0 38.0 38.0 35.0 38.0 115-119 36.519349999999996 38.0 38.0 38.0 34.2 38.0 120-124 36.4198 38.0 38.0 38.0 34.2 38.0 125-129 36.2267 38.0 38.0 38.0 33.8 38.0 130-134 36.03575 38.0 37.8 38.0 33.2 38.0 135-139 35.6801 38.0 36.2 38.0 32.6 38.0 140-144 35.3979 38.0 36.0 38.0 31.0 38.0 145-149 34.981350000000006 38.0 36.0 38.0 30.6 38.0 150-151 31.55875 36.5 31.5 38.0 15.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 4.0 4 0.0 5 1.0 6 0.0 7 0.0 8 0.0 9 0.0 10 1.0 11 2.0 12 0.0 13 0.0 14 0.0 15 3.0 16 1.0 17 4.0 18 1.0 19 1.0 20 2.0 21 8.0 22 4.0 23 2.0 24 7.0 25 8.0 26 8.0 27 12.0 28 11.0 29 22.0 30 22.0 31 29.0 32 49.0 33 73.0 34 104.0 35 178.0 36 485.0 37 2957.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.650000000000006 14.224999999999998 19.3 32.824999999999996 2 23.549999999999997 20.599999999999998 38.525 17.325 3 21.5 24.85 31.35 22.3 4 24.224999999999998 32.025 23.125 20.625 5 25.124999999999996 36.25 23.200000000000003 15.425 6 18.188641481110835 38.65399049286965 23.942957217913435 19.21441080810608 7 17.60440110027507 17.90447611902976 41.935483870967744 22.55563890972743 8 21.25 22.400000000000002 28.4 27.950000000000003 9 21.816362271703778 24.718538904178132 29.271953965474108 24.193144858643983 10-14 23.95895895895896 28.163163163163162 26.001001001001 21.876876876876878 15-19 22.938673341677095 28.250312891113893 27.989987484355446 20.821026282853566 20-24 23.650475713570355 28.082123184777164 27.225838758137204 21.04156234351527 25-29 23.179404988480417 28.743864569768608 27.08604627867375 20.99068416307723 30-34 23.136645962732917 28.626527749949908 27.429372871168102 20.80745341614907 35-39 23.08309110955197 28.716046907888142 27.18753132204069 21.013330660519195 40-44 23.658878973227715 28.191116013235735 27.29870650757044 20.85129850596611 45-49 23.23100806249687 28.288847713956635 27.732986128499178 20.747158095047325 50-54 23.510265398097147 28.452679018527792 27.466199298948425 20.57085628442664 55-59 23.75563345017526 27.856785177766653 27.29594391587381 21.091637456184277 60-64 23.460190285428144 27.73660490736104 27.666499749624435 21.13670505758638 65-69 23.30495743615423 28.302453680520784 27.175763645468205 21.216825237856785 70-74 23.394885652804884 28.25902016714207 27.293199219336433 21.05289496071661 75-79 23.135822240016015 27.8400560504454 27.649884896406768 21.37423681313182 80-84 24.13672305074567 28.070263236913224 27.384646181563404 20.4083675307777 85-89 23.721349214292864 28.07526774096687 27.87508757882094 20.32829546591933 90-94 24.07361104165625 27.909186377956697 27.499124868730306 20.518077711656748 95-99 24.056202810140505 27.971398569928496 27.996399819990998 19.975998799939997 100-104 23.952395239523952 27.4977497749775 27.847784778477845 20.7020702070207 105-109 23.726186309315466 28.546427321366068 26.911345567278367 20.816040802040103 110-114 23.832383238323832 27.357735773577357 28.092809280928094 20.717071707170717 115-119 23.56971394278856 28.125625125025007 27.670534106821364 20.634126825365072 120-124 24.424884976995397 28.305661132226444 27.245449089817964 20.024004800960192 125-129 24.166041510377596 27.926981745436358 27.51187796949237 20.395098774693672 130-134 23.986993496748372 28.45422711355678 27.243621810905456 20.315157578789396 135-139 23.847154146243874 28.423527058117436 27.843353005901772 19.88596578973692 140-144 24.26242624262426 28.522852285228524 26.94769476947695 20.267026702670268 145-149 24.834999999999997 28.610000000000003 27.11 19.445 150-151 24.79318124843319 28.804211581850087 26.97417899222863 19.42842817748809 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.5 8 0.5 9 0.5 10 1.0 11 1.0 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.5 21 1.0 22 1.5 23 1.0 24 1.0 25 1.5 26 1.5 27 3.0 28 3.5 29 7.5 30 9.0 31 8.0 32 15.0 33 22.5 34 34.0 35 52.5 36 79.0 37 100.0 38 120.0 39 165.0 40 198.5 41 212.5 42 255.0 43 294.0 44 290.5 45 290.5 46 292.0 47 268.5 48 247.0 49 222.5 50 180.0 51 143.5 52 126.0 53 100.5 54 62.5 55 42.5 56 33.5 57 26.0 58 22.0 59 15.5 60 11.5 61 11.5 62 7.5 63 2.5 64 2.0 65 2.0 66 2.5 67 2.0 68 0.5 69 0.0 70 0.5 71 0.5 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.075 7 0.025 8 0.0 9 0.075 10-14 0.1 15-19 0.125 20-24 0.15 25-29 0.16999999999999998 30-34 0.18 35-39 0.22999999999999998 40-44 0.27 45-49 0.155 50-54 0.15 55-59 0.15 60-64 0.15 65-69 0.15 70-74 0.08499999999999999 75-79 0.09 80-84 0.09 85-89 0.09 90-94 0.015 95-99 0.005 100-104 0.01 105-109 0.005 110-114 0.01 115-119 0.02 120-124 0.02 125-129 0.025 130-134 0.05 135-139 0.03 140-144 0.01 145-149 0.0 150-151 0.27499999999999997 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.6 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59839357429718 99.2 2 0.4016064257028112 0.8 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1125 0.0 0.0 0.0 0.0 86-87 0.1375 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.175 0.0 0.0 0.0 0.0 92-93 0.21250000000000002 0.0 0.0 0.0 0.0 94-95 0.25 0.0 0.0 0.0 0.0 96-97 0.2875 0.0 0.0 0.0 0.0 98-99 0.325 0.0 0.0 0.0 0.0 100-101 0.3875 0.0 0.0 0.0 0.0 102-103 0.5125 0.0 0.0 0.0 0.0 104-105 0.625 0.0 0.0 0.0 0.0 106-107 0.675 0.0 0.0 0.0 0.0 108-109 0.7124999999999999 0.0 0.0 0.0 0.0 110-111 0.8 0.0 0.0 0.0 0.0 112-113 0.95 0.0 0.0 0.0 0.0 114-115 1.0375 0.0 0.0 0.0 0.0 116-117 1.2 0.0 0.0 0.0 0.0 118-119 1.325 0.0 0.0 0.0 0.0 120-121 1.4375 0.0 0.0 0.0 0.0 122-123 1.75 0.0 0.0 0.0 0.0 124-125 2.0 0.0 0.0 0.0 0.0 126-127 2.2750000000000004 0.0 0.0 0.0 0.0 128-129 2.4375 0.0 0.0 0.0 0.0 130-131 2.6625 0.0 0.0 0.0 0.0 132-133 2.9125 0.0 0.0 0.0 0.0 134-135 3.2 0.0 0.0 0.0 0.0 136-137 3.45 0.0 0.0 0.0 0.0 138-139 3.8875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TAAAGCA 10 0.00679203 145.25316 145 GAAAGCT 10 0.00679203 145.25316 8 >>END_MODULE Read 786586 spots for SRR7180076.sra Written 786586 spots for SRR7180076.sra Read 786586 spots for SRR7180076.sra Written 786586 spots for SRR7180076.sra Read 786586 spots for SRR7180076.sra Written 786586 spots for SRR7180076.sra Read 786586 spots for SRR7180076.sra Written 786586 spots for SRR7180076.sra Read 786586 spots for SRR7180076.sra Written 786586 spots for SRR7180076.sra Read 786586 spots for SRR7180076.sra Written 786586 spots for SRR7180076.sra Read 786586 spots for SRR7180076.sra Written 786586 spots for SRR7180076.sra Read 786586 spots for SRR7180076.sra Written 786586 spots for SRR7180076.sra Read 786586 spots for SRR7180076.sra Written 786586 spots for SRR7180076.sra Read 786586 spots for SRR7180076.sra Written 786586 spots for SRR7180076.sra Read 786586 spots for SRR7180076.sra Written 786586 spots for SRR7180076.sra Read 786586 spots for SRR7180076.sra Written 786586 spots for SRR7180076.sra Read 786586 spots for SRR7180076.sra Written 786586 spots for SRR7180076.sra Read 786586 spots for SRR7180076.sra Written 786586 spots for SRR7180076.sra Read 786586 spots for SRR7180076.sra Written 786586 spots for SRR7180076.sra Read 786592 spots for SRR7180076.sra Written 786592 spots for SRR7180076.sra Read 786586 spots for SRR7180076.sra Written 786586 spots for SRR7180076.sra Read 786586 spots for SRR7180076.sra Written 786586 spots for SRR7180076.sra Read 786586 spots for SRR7180076.sra Written 786586 spots for SRR7180076.sra Read 786586 spots for SRR7180076.sra Written 786586 spots for SRR7180076.sra SRR ids: ['SRR7180076.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_1e4labf8 SRR7180076.sra spots: 15731726 blocks: [[1, 786586], [786587, 1573172], [1573173, 2359758], [2359759, 3146344], [3146345, 3932930], [3932931, 4719516], [4719517, 5506102], [5506103, 6292688], [6292689, 7079274], [7079275, 7865860], [7865861, 8652446], [8652447, 9439032], [9439033, 10225618], [10225619, 11012204], [11012205, 11798790], [11798791, 12585376], [12585377, 13371962], [13371963, 14158548], [14158549, 14945134], [14945135, 15731726]] SRR7180076 file size 5309265 SRR7180076 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7180076 SRR7180076_1.fastq SRR7180076_2.fastq Input file: SRR7180076_1.fastq Paired file: SRR7180076_2.fastq trimmed: SRR7180076-trimmed-pair1.fastq, SRR7180076-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 17:22:59 2025 >> started Mon Feb 10 17:23:17 2025 >> done (17.655s) 15731726 read pairs processed; of these: 13693 ( 0.09%) short read pairs filtered out after trimming by size control 6823 ( 0.04%) empty read pairs filtered out after trimming by size control 15711210 (99.87%) read pairs available; of these: 5012464 (31.90%) trimmed read pairs available after processing 10698746 (68.10%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 20 1 0.00% 21 1 0.00% 22 1 0.00% 23 2 0.00% 24 3 0.00% 25 2 0.00% 26 2 0.00% 27 0 0.00% 28 1 0.00% 29 2 0.00% 30 4 0.00% 31 1 0.00% 32 1 0.00% 33 1 0.00% 34 3 0.00% 35 3 0.00% 36 8 0.00% 37 40 0.00% 38 23 0.00% 39 8 0.00% 40 8 0.00% 41 10 0.00% 42 8 0.00% 43 14 0.00% 44 30 0.00% 45 32 0.00% 46 31 0.00% 47 79 0.00% 48 22 0.00% 49 72 0.00% 50 21 0.00% 51 73 0.00% 52 66 0.00% 53 71 0.00% 54 50 0.00% 55 115 0.00% 56 117 0.00% 57 66 0.00% 58 38 0.00% 59 33 0.00% 60 48 0.00% 61 83 0.00% 62 70 0.00% 63 78 0.00% 64 67 0.00% 65 87 0.00% 66 103 0.00% 67 124 0.00% 68 147 0.00% 69 160 0.00% 70 166 0.00% 71 226 0.00% 72 279 0.00% 73 278 0.00% 74 347 0.00% 75 440 0.00% 76 459 0.00% 77 515 0.00% 78 681 0.00% 79 676 0.00% 80 732 0.00% 81 844 0.01% 82 969 0.01% 83 1210 0.01% 84 1647 0.01% 85 2042 0.01% 86 2372 0.02% 87 2526 0.02% 88 2788 0.02% 89 2851 0.02% 90 3231 0.02% 91 3345 0.02% 92 3626 0.02% 93 3886 0.02% 94 4313 0.03% 95 4677 0.03% 96 5113 0.03% 97 5449 0.03% 98 5932 0.04% 99 6142 0.04% 100 6637 0.04% 101 7062 0.04% 102 7405 0.05% 103 7941 0.05% 104 8400 0.05% 105 9077 0.06% 106 9506 0.06% 107 10241 0.07% 108 10766 0.07% 109 11616 0.07% 110 12182 0.08% 111 12878 0.08% 112 13520 0.09% 113 14303 0.09% 114 14932 0.10% 115 15939 0.10% 116 17007 0.11% 117 17690 0.11% 118 18944 0.12% 119 21391 0.14% 120 21805 0.14% 121 22276 0.14% 122 21680 0.14% 123 22942 0.15% 124 24507 0.16% 125 24764 0.16% 126 26193 0.17% 127 27672 0.18% 128 28430 0.18% 129 30151 0.19% 130 31478 0.20% 131 32957 0.21% 132 34180 0.22% 133 36211 0.23% 134 38161 0.24% 135 39352 0.25% 136 41852 0.27% 137 43921 0.28% 138 46597 0.30% 139 49557 0.32% 140 53084 0.34% 141 56641 0.36% 142 62191 0.40% 143 67569 0.43% 144 76631 0.49% 145 86977 0.55% 146 103876 0.66% 147 135448 0.86% 148 201386 1.28% 149 405161 2.58% 150 2801585 17.83% 151 10698746 68.10% 15711210 reads passed initial QC criterion=sequence-density sequence-density=0.42 sequence-density-rank=1 fanout-score=3.26 fanout-score-rank=29 prefix-density=0.46 prefix-fanout=3.0 sequence=CCACATTTGCAGCCA criterion=fanout-score sequence-density=0.04 sequence-density-rank=34 fanout-score=24.85 fanout-score-rank=1 prefix-density=0.20 prefix-fanout=5.1 sequence=TTGTCAATGGTATCAGAGCTCTCCACCTCCAAGGTGATGGTCTT criterion=sequence-density sequence-density=0.63 sequence-density-rank=1 fanout-score=2.20 fanout-score-rank=33 prefix-density=0.66 prefix-fanout=2.1 sequence=GGCAGTGGCTGCAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=36 fanout-score=303.59 fanout-score-rank=1 prefix-density=0.18 prefix-fanout=14.8 sequence=TTTCTTTGAGAGTGCATAGATTTGTGTTGATATAGAAAACAATGGCACTACATGGAAAGATTGAGACAACATTAGAACTCAAGTCCTCCGCAGAGAAGTTCTACAAAGTGTGGAGGAGCCAGTCCTTCCATGTTCCCAAACATGCTTCCAAGCATATCCAAGGAGTTGATATACATGCAGGTGACTGGGAGACTGCGGGCTCTATCAGGATTTGGCAGTACACAATCGGAGGGAAAGCCGGGGTCTTTAAAGAGGAGGTTTCCTTCGATGATGAGAACAAGATCATAACTCTTAATGGTTTGGAAGGAGATGTCATGAAAATTTACAAGGTCTATA SRR7180076 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 17:24:05 Started mapping on | Feb 10 17:24:05 Finished on | Feb 10 17:25:39 Mapping speed, Million of reads per hour | 601.71 Number of input reads | 15711210 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 14970834 Uniquely mapped reads % | 95.29% Average mapped length | 296.94 Number of splices: Total | 15087329 Number of splices: Annotated (sjdb) | 14793097 Number of splices: GT/AG | 14842803 Number of splices: GC/AG | 192828 Number of splices: AT/AC | 12346 Number of splices: Non-canonical | 39352 Mismatch rate per base, % | 0.31% Deletion rate per base | 0.03% Deletion average length | 2.61 Insertion rate per base | 0.02% Insertion average length | 2.67 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 366006 % of reads mapped to multiple loci | 2.33% Number of reads mapped to too many loci | 35360 % of reads mapped to too many loci | 0.23% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.10% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 382588 382588 382588 N_multimapping 366006 366006 366006 N_noFeature 390159 14824131 453821 N_ambiguous 155228 1365 71205 UnstrandedReadsAssigned:14425447 PositiveStrandReadsAssigned:145338 NegativeStrandReadsAssigned:14445808 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7180076 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7180076-trimmed-pair1.fastq SRR7180076-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,711,210 reads, 14,311,072 reads pseudoaligned [quant] estimated average fragment length: 244.6 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,294 rounds 52401 SRR7180076.ke.tsv 34699 SRR7180076.se.tsv 87100 total ==> SRR7180076.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1774.4 1054 37.6429 Potri.005G024800.1.v4.1 1035 791.4 162 12.9722 Potri.004G059700.1.v4.1 961 717.419 44 3.88664 Potri.007G009000.2.v4.1 1416 1172.4 0 0 Potri.003G141000.2.v4.1 2943 2699.4 567.51 13.323 Potri.016G087400.1.v4.1 270 74.232 1319.66 1126.59 Potri.015G069301.1.v4.1 564 323.812 0 0 Potri.010G195200.1.v4.1 1773 1529.4 313 12.9693 Potri.012G127500.1.v4.1 977 733.413 8134 702.829 ==> SRR7180076.se.tsv <== Potri.001G166300.v4.1 1 Potri.001G448400.v4.1 156 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 503 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 4 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 306 SRR7180076 completed mapping pipeline successfully