Starting /dee2/code/volunteer_pipeline.sh SRR7180077 current disk space = 3058238722048 free memory = 1415990804 SRR7180077 SRAfilesize 0f1f1524b443604edda0109750b3ce63 SRR7180077.sra SRR7180077.sra file validated SRR7180077 is paired end SRR7180077 is conventional basespace SRR7180077 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7180077_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.29525 33.0 33.0 33.0 32.0 34.0 2 29.9485 31.0 30.0 33.0 18.0 33.0 3 32.096 33.0 33.0 33.0 29.0 33.0 4 30.9715 33.0 31.0 33.0 28.0 33.0 5 32.2255 33.0 33.0 33.0 31.0 33.0 6 36.253 38.0 36.0 38.0 33.0 38.0 7 37.16175 38.0 38.0 38.0 36.0 38.0 8 37.5835 38.0 38.0 38.0 37.0 38.0 9 37.664 38.0 38.0 38.0 38.0 38.0 10-14 37.683550000000004 38.0 38.0 38.0 38.0 38.0 15-19 37.6687 38.0 38.0 38.0 38.0 38.0 20-24 37.716449999999995 38.0 38.0 38.0 38.0 38.0 25-29 37.692099999999996 38.0 38.0 38.0 38.0 38.0 30-34 37.68805 38.0 38.0 38.0 38.0 38.0 35-39 37.663500000000006 38.0 38.0 38.0 38.0 38.0 40-44 37.61925 38.0 38.0 38.0 38.0 38.0 45-49 37.6274 38.0 38.0 38.0 38.0 38.0 50-54 37.582499999999996 38.0 38.0 38.0 38.0 38.0 55-59 37.5539 38.0 38.0 38.0 38.0 38.0 60-64 37.52885 38.0 38.0 38.0 37.8 38.0 65-69 37.4997 38.0 38.0 38.0 37.6 38.0 70-74 37.492599999999996 38.0 38.0 38.0 37.6 38.0 75-79 37.4403 38.0 38.0 38.0 37.0 38.0 80-84 37.39335 38.0 38.0 38.0 37.0 38.0 85-89 37.37005 38.0 38.0 38.0 37.0 38.0 90-94 37.331399999999995 38.0 38.0 38.0 37.0 38.0 95-99 37.22975 38.0 38.0 38.0 37.0 38.0 100-104 37.157450000000004 38.0 38.0 38.0 36.2 38.0 105-109 37.05495 38.0 38.0 38.0 36.0 38.0 110-114 36.95925 38.0 38.0 38.0 35.8 38.0 115-119 36.96105 38.0 38.0 38.0 35.8 38.0 120-124 36.768299999999996 38.0 38.0 38.0 35.0 38.0 125-129 36.705349999999996 38.0 38.0 38.0 35.0 38.0 130-134 36.53935 38.0 38.0 38.0 34.4 38.0 135-139 36.3032 38.0 37.8 38.0 34.0 38.0 140-144 36.153549999999996 38.0 38.0 38.0 33.4 38.0 145-149 35.739250000000006 38.0 37.0 38.0 32.8 38.0 150-151 32.927625 37.0 33.5 38.0 17.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 0.0 10 1.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 1.0 17 0.0 18 0.0 19 0.0 20 1.0 21 1.0 22 2.0 23 0.0 24 7.0 25 5.0 26 9.0 27 10.0 28 12.0 29 18.0 30 22.0 31 22.0 32 36.0 33 57.0 34 74.0 35 158.0 36 465.0 37 3098.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 30.267295597484278 14.20335429769392 14.177148846960167 41.35220125786164 2 19.900000000000002 18.35 36.375 25.374999999999996 3 19.8 24.2 25.15 30.85 4 21.275 30.025000000000002 21.75 26.950000000000003 5 21.7 34.025 24.3 19.975 6 17.75 34.75 26.650000000000002 20.849999999999998 7 14.424999999999999 23.925 42.449999999999996 19.2 8 17.4 23.025000000000002 32.1 27.474999999999998 9 17.525 22.8 34.275 25.4 10-14 19.64 29.14 26.99 24.23 15-19 19.45 27.295 28.970000000000002 24.285 20-24 19.105 28.65 28.665000000000003 23.580000000000002 25-29 19.585 28.000000000000004 27.73 24.685000000000002 30-34 19.885 28.810000000000002 27.51 23.794999999999998 35-39 19.34 27.99 28.48 24.19 40-44 19.625 28.175 27.88 24.32 45-49 19.48 27.88 28.685 23.955000000000002 50-54 19.725 28.015 28.205000000000002 24.055 55-59 19.695 28.060000000000002 27.88 24.365000000000002 60-64 19.305 27.779999999999998 28.215 24.7 65-69 19.885 28.215 27.555000000000003 24.345 70-74 20.325 28.475 27.439999999999998 23.76 75-79 19.759999999999998 27.83 28.470000000000002 23.94 80-84 20.215 27.755000000000003 28.215 23.815 85-89 20.135 28.27 27.63 23.965 90-94 20.169999999999998 26.97 28.865000000000002 23.995 95-99 20.685000000000002 27.544999999999998 27.495000000000005 24.275 100-104 20.419999999999998 27.88 27.875 23.825 105-109 20.595 28.01 27.575 23.82 110-114 20.755000000000003 27.415 27.615000000000002 24.215 115-119 20.625 28.285 27.185 23.905 120-124 21.015 27.994999999999997 26.995 23.995 125-129 20.835 28.194999999999997 26.740000000000002 24.23 130-134 21.16 28.375 26.900000000000002 23.565 135-139 20.955 27.939999999999998 26.939999999999998 24.165 140-144 21.515 27.76 26.674999999999997 24.05 145-149 21.33 28.07 26.505000000000003 24.095 150-151 21.9625 27.075 27.8625 23.1 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 1.0 19 1.0 20 0.5 21 1.5 22 2.5 23 2.5 24 1.5 25 2.0 26 4.5 27 6.0 28 7.0 29 11.5 30 14.5 31 21.5 32 32.5 33 38.5 34 44.0 35 51.5 36 71.0 37 105.0 38 127.0 39 152.0 40 198.0 41 233.5 42 257.0 43 276.5 44 287.5 45 303.5 46 305.5 47 267.0 48 232.0 49 201.5 50 157.0 51 128.5 52 106.5 53 84.5 54 69.0 55 57.0 56 42.5 57 25.0 58 14.0 59 11.5 60 10.5 61 7.5 62 6.0 63 5.0 64 4.0 65 2.5 66 1.0 67 1.5 68 3.0 69 2.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.6 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.825 #Duplication Level Percentage of deduplicated Percentage of total 1 99.82469321312296 99.65 2 0.1753067868770348 0.35000000000000003 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.037500000000000006 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.1375 0.0 0.0 0.0 0.0 88-89 0.2 0.0 0.0 0.0 0.0 90-91 0.25 0.0 0.0 0.0 0.0 92-93 0.3125 0.0 0.0 0.0 0.0 94-95 0.4625 0.0 0.0 0.0 0.0 96-97 0.5875 0.0 0.0 0.0 0.0 98-99 0.75 0.0 0.0 0.0 0.0 100-101 0.9875 0.0 0.0 0.0 0.0 102-103 1.125 0.0 0.0 0.0 0.0 104-105 1.4125 0.0 0.0 0.0 0.0 106-107 1.5875 0.0 0.0 0.0 0.0 108-109 1.85 0.0 0.0 0.0 0.0 110-111 2.0999999999999996 0.0 0.0 0.0 0.0 112-113 2.4 0.0 0.0 0.0 0.0 114-115 2.7375 0.0 0.0 0.0 0.0 116-117 3.05 0.0 0.0 0.0 0.0 118-119 3.3375000000000004 0.0 0.0 0.0 0.0 120-121 3.8625 0.0 0.0 0.0 0.0 122-123 4.325 0.0 0.0 0.0 0.0 124-125 4.775 0.0 0.0 0.0 0.0 126-127 5.324999999999999 0.0 0.0 0.0 0.0 128-129 5.75 0.0 0.0 0.0 0.0 130-131 6.35 0.0 0.0 0.0 0.0 132-133 7.025 0.0 0.0 0.0 0.0 134-135 7.525 0.0 0.0 0.0 0.0 136-137 8.175 0.0 0.0 0.0 0.0 138-139 8.925 0.025 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAAGCAG 10 0.006832588 144.9875 5 ATATACT 10 0.006832588 144.9875 4 >>END_MODULE SRR7180077 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7180077_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.07525 33.0 33.0 34.0 32.0 34.0 2 33.151 34.0 33.0 34.0 32.0 34.0 3 33.134 34.0 33.0 34.0 33.0 34.0 4 33.151 34.0 33.0 34.0 33.0 34.0 5 33.1665 34.0 33.0 34.0 33.0 34.0 6 37.2535 38.0 38.0 38.0 37.0 38.0 7 37.29575 38.0 38.0 38.0 37.0 38.0 8 37.15825 38.0 38.0 38.0 37.0 38.0 9 37.32025 38.0 38.0 38.0 37.0 38.0 10-14 37.32449999999999 38.0 38.0 38.0 37.0 38.0 15-19 37.2699 38.0 38.0 38.0 37.0 38.0 20-24 37.23225 38.0 38.0 38.0 37.0 38.0 25-29 37.179199999999994 38.0 38.0 38.0 37.0 38.0 30-34 37.15725 38.0 38.0 38.0 37.0 38.0 35-39 37.077600000000004 38.0 38.0 38.0 37.0 38.0 40-44 37.046549999999996 38.0 38.0 38.0 36.8 38.0 45-49 37.060249999999996 38.0 38.0 38.0 36.2 38.0 50-54 37.025299999999994 38.0 38.0 38.0 36.2 38.0 55-59 36.973299999999995 38.0 38.0 38.0 36.0 38.0 60-64 36.9327 38.0 38.0 38.0 36.0 38.0 65-69 36.8121 38.0 38.0 38.0 35.8 38.0 70-74 36.804449999999996 38.0 38.0 38.0 35.8 38.0 75-79 36.85905 38.0 38.0 38.0 36.0 38.0 80-84 36.7601 38.0 38.0 38.0 35.2 38.0 85-89 36.695 38.0 38.0 38.0 34.8 38.0 90-94 36.5557 38.0 38.0 38.0 34.6 38.0 95-99 36.48695 38.0 38.0 38.0 34.0 38.0 100-104 36.2016 38.0 38.0 38.0 34.0 38.0 105-109 36.040200000000006 38.0 37.2 38.0 33.4 38.0 110-114 35.943650000000005 38.0 37.0 38.0 33.0 38.0 115-119 35.88799999999999 38.0 37.0 38.0 32.6 38.0 120-124 35.5277 38.0 36.4 38.0 30.8 38.0 125-129 35.33755 38.0 36.0 38.0 29.8 38.0 130-134 35.0372 38.0 35.6 38.0 28.2 38.0 135-139 34.77355 38.0 35.0 38.0 27.8 38.0 140-144 34.246500000000005 38.0 35.0 38.0 24.4 38.0 145-149 33.61445 38.0 34.8 38.0 19.8 38.0 150-151 29.252875 36.0 27.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 3.0 4 0.0 5 4.0 6 1.0 7 2.0 8 1.0 9 0.0 10 0.0 11 1.0 12 0.0 13 1.0 14 2.0 15 5.0 16 0.0 17 4.0 18 1.0 19 5.0 20 4.0 21 2.0 22 9.0 23 10.0 24 15.0 25 20.0 26 14.0 27 23.0 28 25.0 29 28.0 30 43.0 31 52.0 32 55.0 33 106.0 34 150.0 35 280.0 36 666.0 37 2466.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.275 15.675 18.975 32.074999999999996 2 23.075000000000003 22.1 36.975 17.849999999999998 3 20.0 24.525 33.650000000000006 21.825 4 24.375 33.85 22.875 18.9 5 25.324999999999996 35.775 22.3 16.6 6 19.384692346173086 38.54427213606804 23.1615807903952 18.90945472736368 7 18.3295823955989 17.97949487371843 42.48562140535134 21.205301325331334 8 20.130032508127034 24.981245311327832 27.85696424106027 27.031757939484873 9 22.1 24.775 29.099999999999998 24.025 10-14 23.925981495373843 28.772193048262068 25.401350337584393 21.900475118779696 15-19 23.293152603411194 28.429950482668936 26.93942880008003 21.337468113839844 20-24 23.157051282051285 29.417067307692307 26.552483974358974 20.873397435897438 25-29 23.65532106872525 28.35229836082009 27.104115494511007 20.888265075943657 30-34 23.265142398716407 28.5148415563578 27.341556357801842 20.878459687123947 35-39 23.47128166541259 28.79859543516428 26.93253072485578 20.797592174567345 40-44 23.98796087283672 28.141459744168547 26.86731878605468 21.003260596940056 45-49 23.52616803689593 28.223380790054144 27.792259875676763 20.458191297373173 50-54 23.884185743625707 28.76321194209287 26.769523618694585 20.583078695586835 55-59 23.56799519327058 28.084318045263366 27.853995593831364 20.49369116763469 60-64 23.86961093585699 27.700165239597418 27.81032497120825 20.61989885333734 65-69 23.876038850505658 27.866226093922098 27.821167517773105 20.43656753779914 70-74 24.07629918894563 27.70601782317012 27.956343246220083 20.261339741664163 75-79 23.979183346677342 27.667133706965576 27.146717373899122 21.206965572457968 80-84 23.688426111333598 28.243892671205444 27.513015618742493 20.554665598718465 85-89 23.940349296902365 28.499224340689587 27.31321623379873 20.247210128609318 90-94 24.15086789055075 27.692461607723473 27.932569656345358 20.22410084538042 95-99 24.38987797559512 27.485497099419888 27.725545109021805 20.39907981596319 100-104 24.027208162448733 28.178453536060815 27.0481144343303 20.74622386716015 105-109 24.39609902475619 28.197049262315577 27.311827956989248 20.095023755938985 110-114 24.527452745274527 28.872887288728872 26.43764376437644 20.162016201620162 115-119 24.77995599119824 27.99059811962393 27.390478095619127 19.838967793558712 120-124 25.051273072882797 28.167675453954278 26.922114951728275 19.858936521434643 125-129 25.091327628484212 28.589300905769903 26.687684531852074 19.63168693389381 130-134 25.525525525525527 28.27827827827828 26.706706706706708 19.48948948948949 135-139 25.39642839277675 28.132659696863588 26.81706768045621 19.653844229903456 140-144 25.476464408984047 28.532839777900055 26.812065429443248 19.178630383672655 145-149 26.06433538446145 28.535694632047626 26.784731602381314 18.615238381109613 150-151 25.967681322810975 27.345609420017535 27.345609420017535 19.34109983715395 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 1.0 16 2.0 17 1.0 18 0.0 19 0.5 20 1.0 21 0.5 22 0.0 23 0.0 24 0.0 25 1.5 26 2.0 27 5.5 28 7.5 29 6.0 30 5.5 31 9.5 32 14.0 33 19.0 34 33.0 35 51.0 36 67.5 37 97.0 38 134.5 39 160.0 40 195.0 41 235.5 42 255.5 43 272.0 44 300.0 45 311.5 46 282.5 47 258.5 48 237.0 49 214.0 50 188.0 51 149.5 52 122.0 53 95.0 54 69.5 55 50.0 56 40.5 57 29.0 58 19.0 59 15.5 60 14.5 61 10.5 62 3.5 63 2.0 64 2.5 65 1.5 66 1.0 67 1.5 68 1.0 69 0.0 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.05 7 0.025 8 0.025 9 0.0 10-14 0.025 15-19 0.034999999999999996 20-24 0.16 25-29 0.255 30-34 0.27999999999999997 35-39 0.325 40-44 0.325 45-49 0.26 50-54 0.185 55-59 0.13999999999999999 60-64 0.145 65-69 0.13 70-74 0.13 75-79 0.08 80-84 0.12 85-89 0.08499999999999999 90-94 0.045 95-99 0.02 100-104 0.03 105-109 0.025 110-114 0.01 115-119 0.02 120-124 0.045 125-129 0.08499999999999999 130-134 0.1 135-139 0.045 140-144 0.045 145-149 0.055 150-151 0.21250000000000002 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.47500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62302085951245 99.1 2 0.30158331239004776 0.6 3 0.025131942699170642 0.075 4 0.025131942699170642 0.1 5 0.025131942699170642 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ACCAGCTTGAGCAAATTCAGTTTCTAAGCAAAAGCTTTCCAGGCCCCTTT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.037500000000000006 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.1375 0.0 0.0 0.0 0.0 88-89 0.2 0.0 0.0 0.0 0.0 90-91 0.25 0.0 0.0 0.0 0.0 92-93 0.3125 0.0 0.0 0.0 0.0 94-95 0.4625 0.0 0.0 0.0 0.0 96-97 0.575 0.0 0.0 0.0 0.0 98-99 0.7250000000000001 0.0 0.0 0.0 0.0 100-101 0.95 0.0 0.0 0.0 0.0 102-103 1.1 0.0 0.0 0.0 0.0 104-105 1.3875 0.0 0.0 0.0 0.0 106-107 1.5875 0.0 0.0 0.0 0.0 108-109 1.8375 0.0 0.0 0.0 0.0 110-111 2.075 0.0 0.0 0.0 0.0 112-113 2.3875 0.0 0.0 0.0 0.0 114-115 2.7125 0.0 0.0 0.0 0.0 116-117 3.0250000000000004 0.0 0.0 0.0 0.0 118-119 3.3375000000000004 0.0 0.0 0.0 0.0 120-121 3.85 0.0 0.0 0.0 0.0 122-123 4.3 0.0 0.0 0.0 0.0 124-125 4.775 0.0 0.0 0.0 0.0 126-127 5.324999999999999 0.0 0.0 0.0 0.0 128-129 5.699999999999999 0.0 0.0 0.0 0.0 130-131 6.2875 0.0 0.0 0.0 0.0 132-133 6.9625 0.0 0.0 0.0 0.0 134-135 7.475 0.0 0.0 0.0 0.0 136-137 8.0625 0.0 0.0 0.0 0.0 138-139 8.8 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AATCTAA 15 1.1844648E-4 143.65001 5 AAAATCT 40 0.005833349 53.86875 3 >>END_MODULE Read 787505 spots for SRR7180077.sra Written 787505 spots for SRR7180077.sra Read 787505 spots for SRR7180077.sra Written 787505 spots for SRR7180077.sra Read 787505 spots for SRR7180077.sra Written 787505 spots for SRR7180077.sra Read 787505 spots for SRR7180077.sra Written 787505 spots for SRR7180077.sra Read 787505 spots for SRR7180077.sra Written 787505 spots for SRR7180077.sra Read 787505 spots for SRR7180077.sra Written 787505 spots for SRR7180077.sra Read 787505 spots for SRR7180077.sra Written 787505 spots for SRR7180077.sra Read 787505 spots for SRR7180077.sra Written 787505 spots for SRR7180077.sra Read 787505 spots for SRR7180077.sra Written 787505 spots for SRR7180077.sra Read 787505 spots for SRR7180077.sra Written 787505 spots for SRR7180077.sra Read 787505 spots for SRR7180077.sra Written 787505 spots for SRR7180077.sra Read 787505 spots for SRR7180077.sra Written 787505 spots for SRR7180077.sra Read 787505 spots for SRR7180077.sra Written 787505 spots for SRR7180077.sra Read 787505 spots for SRR7180077.sra Written 787505 spots for SRR7180077.sra Read 787505 spots for SRR7180077.sra Written 787505 spots for SRR7180077.sra Read 787505 spots for SRR7180077.sra Written 787505 spots for SRR7180077.sra Read 787505 spots for SRR7180077.sra Written 787505 spots for SRR7180077.sra Read 787505 spots for SRR7180077.sra Written 787505 spots for SRR7180077.sra Read 787505 spots for SRR7180077.sra Written 787505 spots for SRR7180077.sra Read 787519 spots for SRR7180077.sra Written 787519 spots for SRR7180077.sra SRR ids: ['SRR7180077.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd__s2ofhgg SRR7180077.sra spots: 15750114 blocks: [[1, 787505], [787506, 1575010], [1575011, 2362515], [2362516, 3150020], [3150021, 3937525], [3937526, 4725030], [4725031, 5512535], [5512536, 6300040], [6300041, 7087545], [7087546, 7875050], [7875051, 8662555], [8662556, 9450060], [9450061, 10237565], [10237566, 11025070], [11025071, 11812575], [11812576, 12600080], [12600081, 13387585], [13387586, 14175090], [14175091, 14962595], [14962596, 15750114]] SRR7180077 file size 5315496 SRR7180077 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7180077 SRR7180077_1.fastq SRR7180077_2.fastq Input file: SRR7180077_1.fastq Paired file: SRR7180077_2.fastq trimmed: SRR7180077-trimmed-pair1.fastq, SRR7180077-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 17:00:36 2025 >> started Mon Feb 10 17:01:04 2025 >> done (28.321s) 15750114 read pairs processed; of these: 12363 ( 0.08%) short read pairs filtered out after trimming by size control 7090 ( 0.05%) empty read pairs filtered out after trimming by size control 15730661 (99.88%) read pairs available; of these: 6087237 (38.70%) trimmed read pairs available after processing 9643424 (61.30%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 3 0.00% 20 2 0.00% 21 5 0.00% 22 3 0.00% 23 1 0.00% 24 3 0.00% 25 3 0.00% 26 1 0.00% 27 2 0.00% 28 5 0.00% 29 6 0.00% 30 2 0.00% 31 1 0.00% 32 2 0.00% 33 1 0.00% 34 4 0.00% 35 4 0.00% 36 19 0.00% 37 13 0.00% 38 5 0.00% 39 9 0.00% 40 31 0.00% 41 24 0.00% 42 8 0.00% 43 10 0.00% 44 13 0.00% 45 46 0.00% 46 34 0.00% 47 71 0.00% 48 50 0.00% 49 47 0.00% 50 45 0.00% 51 112 0.00% 52 34 0.00% 53 38 0.00% 54 68 0.00% 55 124 0.00% 56 59 0.00% 57 60 0.00% 58 73 0.00% 59 118 0.00% 60 113 0.00% 61 106 0.00% 62 153 0.00% 63 178 0.00% 64 173 0.00% 65 207 0.00% 66 230 0.00% 67 289 0.00% 68 332 0.00% 69 384 0.00% 70 403 0.00% 71 528 0.00% 72 592 0.00% 73 770 0.00% 74 799 0.01% 75 1024 0.01% 76 1161 0.01% 77 1292 0.01% 78 1503 0.01% 79 1645 0.01% 80 1901 0.01% 81 2137 0.01% 82 2482 0.02% 83 2749 0.02% 84 3714 0.02% 85 4554 0.03% 86 4824 0.03% 87 5569 0.04% 88 6012 0.04% 89 6230 0.04% 90 6840 0.04% 91 7312 0.05% 92 8000 0.05% 93 8483 0.05% 94 9278 0.06% 95 10387 0.07% 96 11157 0.07% 97 11954 0.08% 98 12833 0.08% 99 13587 0.09% 100 14704 0.09% 101 15579 0.10% 102 16431 0.10% 103 17128 0.11% 104 18300 0.12% 105 19222 0.12% 106 20590 0.13% 107 22259 0.14% 108 23288 0.15% 109 24798 0.16% 110 25872 0.16% 111 27246 0.17% 112 28304 0.18% 113 29256 0.19% 114 30637 0.19% 115 31762 0.20% 116 33749 0.21% 117 35059 0.22% 118 36789 0.23% 119 38604 0.25% 120 39755 0.25% 121 42412 0.27% 122 43480 0.28% 123 44266 0.28% 124 45908 0.29% 125 46593 0.30% 126 48791 0.31% 127 50335 0.32% 128 51841 0.33% 129 54239 0.34% 130 55913 0.36% 131 58286 0.37% 132 60413 0.38% 133 62402 0.40% 134 64561 0.41% 135 65995 0.42% 136 68221 0.43% 137 71162 0.45% 138 74328 0.47% 139 77348 0.49% 140 80606 0.51% 141 85293 0.54% 142 91424 0.58% 143 98126 0.62% 144 107083 0.68% 145 118198 0.75% 146 136459 0.87% 147 166975 1.06% 148 232936 1.48% 149 432965 2.75% 150 2748302 17.47% 151 9643424 61.30% 15730661 reads passed initial QC criterion=sequence-density sequence-density=0.31 sequence-density-rank=1 fanout-score=4.19 fanout-score-rank=23 prefix-density=0.60 prefix-fanout=2.2 sequence=CACACTTGCAGCCATTCTCAGCACC criterion=fanout-score sequence-density=0.05 sequence-density-rank=33 fanout-score=20.70 fanout-score-rank=1 prefix-density=0.19 prefix-fanout=5.0 sequence=TTGTCAATGGTATCAGAGCTCTCCACCTCCAAGGTGATGGTCT criterion=sequence-density sequence-density=0.45 sequence-density-rank=1 fanout-score=4.40 fanout-score-rank=18 prefix-density=0.58 prefix-fanout=3.4 sequence=TGCAAGTGCGGCAGTG criterion=fanout-score sequence-density=0.01 sequence-density-rank=34 fanout-score=67.42 fanout-score-rank=1 prefix-density=0.14 prefix-fanout=5.1 sequence=TCTTTGAGAGTGCATAGATTTGTGTTGATATAGAAAACAATGGCACTACATGGAAAGATTGAGACAACATTAGAACTCAAGTCCTCCGCAGAGAAGTTCTACAAAGTGTGGAGGAGCCAGTCCTTCCATGTTCCCAAACATGCTTCCAAGCATATCCAAGGAGTTGATATACATGCAGGTGACTGGGAGACTGCGGGCTCTATCAGGATTTGGCAGTACACAATCGGAGGGAAAGCCGGGGTCTTTAAAGAGGAGGTTTCC SRR7180077 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 17:02:02 Started mapping on | Feb 10 17:02:02 Finished on | Feb 10 17:04:56 Mapping speed, Million of reads per hour | 325.46 Number of input reads | 15730661 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 14876468 Uniquely mapped reads % | 94.57% Average mapped length | 293.50 Number of splices: Total | 15179888 Number of splices: Annotated (sjdb) | 14907398 Number of splices: GT/AG | 14942434 Number of splices: GC/AG | 187870 Number of splices: AT/AC | 11444 Number of splices: Non-canonical | 38140 Mismatch rate per base, % | 0.31% Deletion rate per base | 0.03% Deletion average length | 2.63 Insertion rate per base | 0.02% Insertion average length | 2.65 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 384302 % of reads mapped to multiple loci | 2.44% Number of reads mapped to too many loci | 39181 % of reads mapped to too many loci | 0.25% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.67% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 478930 478930 478930 N_multimapping 384302 384302 384302 N_noFeature 333174 14736669 404275 N_ambiguous 140645 927 71363 UnstrandedReadsAssigned:14402649 PositiveStrandReadsAssigned:138872 NegativeStrandReadsAssigned:14400830 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7180077 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7180077-trimmed-pair1.fastq SRR7180077-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,730,661 reads, 14,304,499 reads pseudoaligned [quant] estimated average fragment length: 219.792 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,039 rounds 52401 SRR7180077.ke.tsv 34699 SRR7180077.se.tsv 87100 total ==> SRR7180077.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1799.21 1239 45.6405 Potri.005G024800.1.v4.1 1035 816.208 196 15.9153 Potri.004G059700.1.v4.1 961 742.222 50 4.46475 Potri.007G009000.2.v4.1 1416 1197.21 0 0 Potri.003G141000.2.v4.1 2943 2724.21 617 15.0109 Potri.016G087400.1.v4.1 270 86.5462 1109 849.267 Potri.015G069301.1.v4.1 564 347.135 0 0 Potri.010G195200.1.v4.1 1773 1554.21 269 11.4711 Potri.012G127500.1.v4.1 977 758.215 4236 370.275 ==> SRR7180077.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 25 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 436 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 387 SRR7180077 completed mapping pipeline successfully