Starting /dee2/code/volunteer_pipeline.sh SRR7180078 current disk space = 3058160119808 free memory = 1121951196 SRR7180078 SRAfilesize 43478857c7fca6f1db78c1183e15c98f SRR7180078.sra SRR7180078.sra file validated SRR7180078 is paired end SRR7180078 is conventional basespace SRR7180078 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7180078_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.4395 33.0 33.0 34.0 32.0 34.0 2 33.039 34.0 33.0 34.0 32.0 34.0 3 32.07625 33.0 32.0 33.0 30.0 34.0 4 33.097 33.0 33.0 34.0 32.0 34.0 5 33.2815 34.0 33.0 34.0 33.0 34.0 6 37.27975 38.0 38.0 38.0 36.0 38.0 7 37.55725 38.0 38.0 38.0 37.0 38.0 8 37.6535 38.0 38.0 38.0 38.0 38.0 9 37.6995 38.0 38.0 38.0 38.0 38.0 10-14 37.723 38.0 38.0 38.0 38.0 38.0 15-19 37.715999999999994 38.0 38.0 38.0 38.0 38.0 20-24 37.6884 38.0 38.0 38.0 38.0 38.0 25-29 37.67355 38.0 38.0 38.0 38.0 38.0 30-34 37.6547 38.0 38.0 38.0 38.0 38.0 35-39 37.630250000000004 38.0 38.0 38.0 38.0 38.0 40-44 37.6219 38.0 38.0 38.0 38.0 38.0 45-49 37.58825 38.0 38.0 38.0 38.0 38.0 50-54 37.5678 38.0 38.0 38.0 38.0 38.0 55-59 37.5521 38.0 38.0 38.0 38.0 38.0 60-64 37.4801 38.0 38.0 38.0 37.6 38.0 65-69 37.4636 38.0 38.0 38.0 37.0 38.0 70-74 37.3743 38.0 38.0 38.0 37.0 38.0 75-79 37.3683 38.0 38.0 38.0 37.0 38.0 80-84 37.357150000000004 38.0 38.0 38.0 37.0 38.0 85-89 37.296200000000006 38.0 38.0 38.0 37.0 38.0 90-94 37.187 38.0 38.0 38.0 36.4 38.0 95-99 37.125899999999994 38.0 38.0 38.0 36.2 38.0 100-104 37.0603 38.0 38.0 38.0 36.0 38.0 105-109 36.903150000000004 38.0 38.0 38.0 35.8 38.0 110-114 36.78605 38.0 38.0 38.0 35.0 38.0 115-119 36.626349999999995 38.0 38.0 38.0 35.0 38.0 120-124 36.54805 38.0 38.0 38.0 34.2 38.0 125-129 36.38935 38.0 38.0 38.0 34.0 38.0 130-134 36.176100000000005 38.0 38.0 38.0 33.8 38.0 135-139 35.98315 38.0 37.8 38.0 33.0 38.0 140-144 35.7868 38.0 37.0 38.0 33.0 38.0 145-149 35.266549999999995 38.0 36.0 38.0 31.8 38.0 150-151 32.351 36.5 33.5 38.0 16.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 2.0 16 3.0 17 0.0 18 1.0 19 2.0 20 4.0 21 1.0 22 0.0 23 4.0 24 9.0 25 10.0 26 9.0 27 17.0 28 7.0 29 19.0 30 21.0 31 30.0 32 38.0 33 53.0 34 90.0 35 158.0 36 429.0 37 3092.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.80327435965144 12.226036440454186 12.542909955109586 40.42777924478479 2 20.1 15.725 37.875 26.3 3 19.5 20.150000000000002 26.525 33.825 4 22.35 27.325 22.900000000000002 27.425 5 21.875 31.225 26.1 20.8 6 18.7 33.25 27.425 20.625 7 15.425 25.05 40.925 18.6 8 16.75 26.25 31.65 25.35 9 17.175 26.125 32.85 23.849999999999998 10-14 19.43 29.29 27.97 23.31 15-19 19.15 28.955 28.275 23.62 20-24 19.72 29.189999999999998 28.110000000000003 22.98 25-29 19.685 28.425 28.935 22.955000000000002 30-34 19.650000000000002 28.925 27.744999999999997 23.68 35-39 19.34 28.04 29.049999999999997 23.57 40-44 19.3 28.62 28.285 23.794999999999998 45-49 20.14 28.415000000000003 27.750000000000004 23.695 50-54 19.585 28.215 28.07 24.13 55-59 19.35 28.365000000000002 28.694999999999997 23.59 60-64 19.84 27.700000000000003 28.494999999999997 23.965 65-69 20.075000000000003 28.389999999999997 27.98 23.555 70-74 20.06 28.1 27.810000000000002 24.03 75-79 20.185 27.725 28.285 23.805 80-84 19.435 28.310000000000002 28.294999999999998 23.96 85-89 20.285 27.779999999999998 28.13 23.805 90-94 20.23 28.23 27.925 23.615 95-99 20.169999999999998 27.985 27.815 24.03 100-104 20.330000000000002 28.17 27.76 23.74 105-109 20.205000000000002 28.07 28.13 23.595 110-114 20.155 27.939999999999998 28.18 23.724999999999998 115-119 20.71 27.815 28.005000000000003 23.47 120-124 20.69 28.305000000000003 27.655 23.35 125-129 20.39 27.555000000000003 28.255000000000003 23.799999999999997 130-134 20.24 27.935 27.97 23.855 135-139 20.375 27.74 28.02 23.865 140-144 20.585 27.900000000000002 27.389999999999997 24.125 145-149 20.78 28.139999999999997 27.555000000000003 23.525 150-151 21.2375 27.962500000000002 27.025 23.775 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.5 4 0.5 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 1.5 17 2.0 18 0.5 19 0.5 20 0.5 21 0.5 22 1.5 23 1.0 24 1.5 25 3.5 26 4.5 27 6.0 28 8.5 29 12.5 30 20.0 31 24.5 32 27.5 33 43.0 34 67.0 35 80.0 36 98.0 37 127.0 38 144.5 39 173.0 40 200.5 41 228.0 42 259.0 43 267.5 44 289.5 45 285.0 46 252.5 47 234.0 48 214.0 49 185.5 50 149.0 51 120.0 52 107.5 53 90.0 54 57.5 55 40.0 56 34.5 57 28.0 58 22.5 59 19.5 60 16.5 61 10.5 62 7.5 63 8.0 64 5.5 65 5.0 66 5.0 67 4.0 68 2.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 5.325 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.47500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.47222920331743 98.95 2 0.5277707966825836 1.05 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0125 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.025 0.0 0.0 0.0 86-87 0.07500000000000001 0.025 0.0 0.0 0.0 88-89 0.1 0.025 0.0 0.0 0.0 90-91 0.15 0.025 0.0 0.0 0.0 92-93 0.275 0.025 0.0 0.0 0.0 94-95 0.275 0.025 0.0 0.0 0.0 96-97 0.36250000000000004 0.025 0.0 0.0 0.0 98-99 0.4375 0.025 0.0 0.0 0.0 100-101 0.55 0.025 0.0 0.0 0.0 102-103 0.6625 0.025 0.0 0.0 0.0 104-105 0.825 0.025 0.0 0.0 0.0 106-107 0.975 0.025 0.0 0.0 0.0 108-109 1.1625 0.025 0.0 0.0 0.0 110-111 1.4875 0.025 0.0 0.0 0.0 112-113 1.5875 0.025 0.0 0.0 0.0 114-115 1.8 0.025 0.0 0.0 0.0 116-117 2.0250000000000004 0.025 0.0 0.0 0.0 118-119 2.3125 0.025 0.0 0.0 0.0 120-121 2.6500000000000004 0.025 0.0 0.0 0.0 122-123 2.925 0.025 0.0 0.0 0.0 124-125 3.225 0.025 0.0 0.0 0.0 126-127 3.7 0.025 0.0 0.0 0.0 128-129 4.237500000000001 0.025 0.0 0.0 0.0 130-131 4.637499999999999 0.025 0.0 0.0 0.0 132-133 4.9 0.025 0.0 0.0 0.0 134-135 5.375 0.025 0.0 0.0 0.0 136-137 5.8125 0.025 0.0 0.0 0.0 138-139 6.3 0.025 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACCTCCT 10 0.0068343505 144.975 8 GGCTACC 10 0.0068343505 144.975 145 >>END_MODULE SRR7180078 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7180078_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.175 34.0 33.0 34.0 33.0 34.0 2 33.209 34.0 33.0 34.0 33.0 34.0 3 33.316 34.0 33.0 34.0 33.0 34.0 4 33.233 34.0 33.0 34.0 33.0 34.0 5 33.32125 34.0 33.0 34.0 33.0 34.0 6 37.489 38.0 38.0 38.0 38.0 38.0 7 37.451 38.0 38.0 38.0 38.0 38.0 8 37.3715 38.0 38.0 38.0 38.0 38.0 9 37.38825 38.0 38.0 38.0 38.0 38.0 10-14 37.4392 38.0 38.0 38.0 38.0 38.0 15-19 37.41605 38.0 38.0 38.0 38.0 38.0 20-24 37.3899 38.0 38.0 38.0 37.8 38.0 25-29 37.4042 38.0 38.0 38.0 37.8 38.0 30-34 37.379200000000004 38.0 38.0 38.0 37.8 38.0 35-39 37.302550000000004 38.0 38.0 38.0 37.2 38.0 40-44 37.29065000000001 38.0 38.0 38.0 37.0 38.0 45-49 37.32445 38.0 38.0 38.0 37.0 38.0 50-54 37.2766 38.0 38.0 38.0 37.0 38.0 55-59 37.2977 38.0 38.0 38.0 37.0 38.0 60-64 37.20790000000001 38.0 38.0 38.0 37.0 38.0 65-69 37.122949999999996 38.0 38.0 38.0 36.6 38.0 70-74 37.04424999999999 38.0 38.0 38.0 36.0 38.0 75-79 37.00265 38.0 38.0 38.0 36.2 38.0 80-84 37.00495 38.0 38.0 38.0 36.0 38.0 85-89 36.8492 38.0 38.0 38.0 36.0 38.0 90-94 36.739549999999994 38.0 38.0 38.0 35.6 38.0 95-99 36.72295 38.0 38.0 38.0 35.0 38.0 100-104 36.5952 38.0 38.0 38.0 35.0 38.0 105-109 36.281949999999995 38.0 38.0 38.0 33.8 38.0 110-114 36.25665 38.0 38.0 38.0 34.0 38.0 115-119 36.1783 38.0 38.0 38.0 34.0 38.0 120-124 35.88205 38.0 37.2 38.0 32.6 38.0 125-129 35.7 38.0 37.0 38.0 32.0 38.0 130-134 35.55029999999999 38.0 36.2 38.0 31.4 38.0 135-139 35.24615 38.0 36.0 38.0 30.6 38.0 140-144 34.935500000000005 38.0 36.0 38.0 28.6 38.0 145-149 34.24294999999999 38.0 35.0 38.0 26.4 38.0 150-151 30.289625 35.5 28.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 2.0 4 2.0 5 2.0 6 1.0 7 0.0 8 0.0 9 1.0 10 0.0 11 0.0 12 0.0 13 2.0 14 3.0 15 4.0 16 0.0 17 2.0 18 2.0 19 3.0 20 5.0 21 8.0 22 7.0 23 5.0 24 9.0 25 6.0 26 17.0 27 22.0 28 20.0 29 21.0 30 27.0 31 41.0 32 71.0 33 69.0 34 119.0 35 205.0 36 520.0 37 2801.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.45 17.349999999999998 18.35 30.85 2 24.825 24.975 33.324999999999996 16.875 3 21.125 27.650000000000002 29.975 21.25 4 25.124999999999996 32.15 23.575 19.15 5 24.6 35.099999999999994 23.45 16.85 6 17.95 37.7 25.8 18.55 7 19.225 19.325 41.0 20.45 8 21.8 24.099999999999998 28.125 25.974999999999998 9 22.55 24.85 28.325 24.275 10-14 23.185 28.99 26.195 21.63 15-19 23.72 28.03 27.83 20.419999999999998 20-24 22.36 29.049999999999997 28.249999999999996 20.34 25-29 22.84 28.835 27.275 21.05 30-34 22.945 28.549999999999997 27.58 20.925 35-39 23.225 28.595 27.655 20.525 40-44 23.69 28.804999999999996 27.22 20.285 45-49 23.24 28.29 27.339999999999996 21.13 50-54 23.66 28.42 27.785 20.135 55-59 23.455000000000002 28.115000000000002 28.33 20.1 60-64 23.27 28.33 27.985 20.415 65-69 23.62 28.38 27.529999999999998 20.47 70-74 23.974999999999998 28.13 27.625 20.27 75-79 23.61 28.4 27.76 20.23 80-84 23.91 28.435 27.49 20.165 85-89 23.855 28.075 27.889999999999997 20.18 90-94 24.46 28.410000000000004 27.250000000000004 19.88 95-99 23.605 28.825 27.55 20.02 100-104 24.095 28.68 26.86 20.365 105-109 23.68 28.084999999999997 27.665 20.57 110-114 24.37 28.854999999999997 27.060000000000002 19.715 115-119 24.19 28.244999999999997 27.655 19.91 120-124 24.32 28.58 27.279999999999998 19.82 125-129 23.9 29.270000000000003 27.089999999999996 19.74 130-134 24.05 29.18 27.0 19.77 135-139 24.895 29.035 27.045 19.025 140-144 24.9 28.345 27.315 19.439999999999998 145-149 25.575 27.98 27.16 19.285 150-151 26.16577072134017 28.55356919614952 26.303287910988875 18.977372171521438 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.5 17 0.5 18 0.0 19 0.0 20 0.0 21 0.5 22 1.5 23 2.0 24 3.5 25 3.5 26 3.0 27 5.0 28 7.0 29 7.5 30 11.0 31 21.5 32 26.0 33 32.5 34 48.5 35 62.0 36 80.0 37 102.5 38 128.5 39 163.5 40 209.5 41 235.5 42 261.0 43 297.5 44 307.0 45 301.0 46 290.0 47 251.0 48 222.0 49 202.0 50 150.0 51 115.0 52 96.5 53 78.5 54 65.0 55 46.5 56 36.0 57 32.0 58 22.5 59 16.5 60 12.5 61 8.0 62 6.5 63 4.5 64 3.0 65 4.5 66 3.5 67 2.0 68 2.5 69 3.0 70 1.5 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.3 #Duplication Level Percentage of deduplicated Percentage of total 1 99.37059415911381 98.675 2 0.5790533736153072 1.15 3 0.025176233635448138 0.075 4 0.025176233635448138 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.1375 0.0 0.0 0.0 0.0 92-93 0.275 0.0 0.0 0.0 0.0 94-95 0.275 0.0 0.0 0.0 0.0 96-97 0.36250000000000004 0.0 0.0 0.0 0.0 98-99 0.4375 0.0 0.0 0.0 0.0 100-101 0.55 0.0 0.0 0.0 0.0 102-103 0.6625 0.0 0.0 0.0 0.0 104-105 0.825 0.0 0.0 0.0 0.0 106-107 0.975 0.0 0.0 0.0 0.0 108-109 1.1625 0.0 0.0 0.0 0.0 110-111 1.4875 0.0 0.0 0.0 0.0 112-113 1.5875 0.0 0.0 0.0 0.0 114-115 1.7875 0.0 0.0 0.0 0.0 116-117 2.0375 0.0 0.0 0.0 0.0 118-119 2.3 0.0 0.0 0.0 0.0 120-121 2.625 0.0 0.0 0.0 0.0 122-123 2.9000000000000004 0.0 0.0 0.0 0.0 124-125 3.2 0.0 0.0 0.0 0.0 126-127 3.675 0.0 0.0 0.0 0.0 128-129 4.2125 0.0 0.0 0.0 0.0 130-131 4.612500000000001 0.0 0.0 0.0 0.0 132-133 4.8875 0.0 0.0 0.0 0.0 134-135 5.362500000000001 0.0 0.0 0.0 0.0 136-137 5.824999999999999 0.0 0.0 0.0 0.0 138-139 6.325 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 760242 spots for SRR7180078.sra Written 760242 spots for SRR7180078.sra Read 760242 spots for SRR7180078.sra Written 760242 spots for SRR7180078.sra Read 760242 spots for SRR7180078.sra Written 760242 spots for SRR7180078.sra Read 760242 spots for SRR7180078.sra Written 760242 spots for SRR7180078.sra Read 760242 spots for SRR7180078.sra Written 760242 spots for SRR7180078.sra Read 760242 spots for SRR7180078.sra Written 760242 spots for SRR7180078.sra Read 760242 spots for SRR7180078.sra Written 760242 spots for SRR7180078.sra Read 760242 spots for SRR7180078.sra Written 760242 spots for SRR7180078.sra Read 760242 spots for SRR7180078.sra Written 760242 spots for SRR7180078.sra Read 760255 spots for SRR7180078.sra Written 760255 spots for SRR7180078.sra Read 760242 spots for SRR7180078.sra Written 760242 spots for SRR7180078.sra Read 760242 spots for SRR7180078.sra Written 760242 spots for SRR7180078.sra Read 760242 spots for SRR7180078.sra Written 760242 spots for SRR7180078.sra Read 760242 spots for SRR7180078.sra Written 760242 spots for SRR7180078.sra Read 760242 spots for SRR7180078.sra Written 760242 spots for SRR7180078.sra Read 760242 spots for SRR7180078.sra Written 760242 spots for SRR7180078.sra Read 760242 spots for SRR7180078.sra Written 760242 spots for SRR7180078.sra Read 760242 spots for SRR7180078.sra Written 760242 spots for SRR7180078.sra Read 760242 spots for SRR7180078.sra Written 760242 spots for SRR7180078.sra Read 760242 spots for SRR7180078.sra Written 760242 spots for SRR7180078.sra SRR ids: ['SRR7180078.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_wtinlp2a SRR7180078.sra spots: 15204853 blocks: [[1, 760242], [760243, 1520484], [1520485, 2280726], [2280727, 3040968], [3040969, 3801210], [3801211, 4561452], [4561453, 5321694], [5321695, 6081936], [6081937, 6842178], [6842179, 7602420], [7602421, 8362662], [8362663, 9122904], [9122905, 9883146], [9883147, 10643388], [10643389, 11403630], [11403631, 12163872], [12163873, 12924114], [12924115, 13684356], [13684357, 14444598], [14444599, 15204853]] SRR7180078 file size 5130725 SRR7180078 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7180078 SRR7180078_1.fastq SRR7180078_2.fastq Input file: SRR7180078_1.fastq Paired file: SRR7180078_2.fastq trimmed: SRR7180078-trimmed-pair1.fastq, SRR7180078-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 17:16:18 2025 >> started Mon Feb 10 17:16:38 2025 >> done (19.831s) 15204853 read pairs processed; of these: 18219 ( 0.12%) short read pairs filtered out after trimming by size control 13119 ( 0.09%) empty read pairs filtered out after trimming by size control 15173515 (99.79%) read pairs available; of these: 5596654 (36.88%) trimmed read pairs available after processing 9576861 (63.12%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 1 0.00% 20 3 0.00% 21 4 0.00% 22 5 0.00% 23 2 0.00% 24 4 0.00% 25 6 0.00% 26 4 0.00% 27 4 0.00% 28 2 0.00% 29 4 0.00% 30 5 0.00% 31 5 0.00% 32 2 0.00% 33 7 0.00% 34 10 0.00% 35 0 0.00% 36 8 0.00% 37 4 0.00% 38 4 0.00% 39 3 0.00% 40 8 0.00% 41 6 0.00% 42 6 0.00% 43 8 0.00% 44 6 0.00% 45 16 0.00% 46 16 0.00% 47 23 0.00% 48 28 0.00% 49 22 0.00% 50 24 0.00% 51 28 0.00% 52 34 0.00% 53 42 0.00% 54 54 0.00% 55 41 0.00% 56 39 0.00% 57 54 0.00% 58 62 0.00% 59 82 0.00% 60 68 0.00% 61 99 0.00% 62 98 0.00% 63 108 0.00% 64 132 0.00% 65 140 0.00% 66 162 0.00% 67 204 0.00% 68 222 0.00% 69 251 0.00% 70 268 0.00% 71 351 0.00% 72 391 0.00% 73 458 0.00% 74 504 0.00% 75 595 0.00% 76 767 0.01% 77 866 0.01% 78 980 0.01% 79 1018 0.01% 80 1181 0.01% 81 1315 0.01% 82 1474 0.01% 83 1831 0.01% 84 2701 0.02% 85 3542 0.02% 86 3859 0.03% 87 4303 0.03% 88 4789 0.03% 89 4960 0.03% 90 5166 0.03% 91 5720 0.04% 92 5924 0.04% 93 6601 0.04% 94 6988 0.05% 95 7397 0.05% 96 8148 0.05% 97 8540 0.06% 98 9096 0.06% 99 9911 0.07% 100 10519 0.07% 101 11342 0.07% 102 11915 0.08% 103 12663 0.08% 104 13299 0.09% 105 14367 0.09% 106 15486 0.10% 107 16222 0.11% 108 17146 0.11% 109 18396 0.12% 110 19265 0.13% 111 20276 0.13% 112 21369 0.14% 113 22516 0.15% 114 23398 0.15% 115 25074 0.17% 116 26109 0.17% 117 26993 0.18% 118 28767 0.19% 119 30332 0.20% 120 31806 0.21% 121 33450 0.22% 122 34120 0.22% 123 34534 0.23% 124 36080 0.24% 125 37291 0.25% 126 38827 0.26% 127 40547 0.27% 128 41929 0.28% 129 43337 0.29% 130 45009 0.30% 131 47634 0.31% 132 49259 0.32% 133 51334 0.34% 134 53583 0.35% 135 55765 0.37% 136 58046 0.38% 137 60364 0.40% 138 63743 0.42% 139 66519 0.44% 140 69714 0.46% 141 74401 0.49% 142 79578 0.52% 143 85781 0.57% 144 94830 0.62% 145 107597 0.71% 146 124834 0.82% 147 156954 1.03% 148 224508 1.48% 149 429648 2.83% 150 2728363 17.98% 151 9576861 63.12% 15173515 reads passed initial QC criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=3.34 fanout-score-rank=24 prefix-density=0.35 prefix-fanout=2.3 sequence=CACTTGCAGCCATTCTCAGCACCA criterion=fanout-score sequence-density=0.06 sequence-density-rank=30 fanout-score=41.22 fanout-score-rank=1 prefix-density=0.40 prefix-fanout=5.7 sequence=ATCTCCTTCCAGGCCAGTGAGAGCCAGTGTGTTCTTTTCTTCATCCACTACCACCTTCTCTTTAAAGA criterion=sequence-density sequence-density=0.30 sequence-density-rank=1 fanout-score=2.82 fanout-score-rank=33 prefix-density=0.30 prefix-fanout=2.8 sequence=ATGTACCCTGAC criterion=fanout-score sequence-density=0.01 sequence-density-rank=34 fanout-score=60.75 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=6.4 sequence=ATTTTCTTTGAGAGTGCATAGATTTGTGTTGATATAGAAAACAATGGCACTACATGGAAAGATTGAGACAACATTAGAACTCAAGTCCTCCGCAGAGAAGTTCTACAAAGTGTGGAGGAGCCAGTCCTTCCATGTTCCCAAACATGCTTCCAAGCATATCCAAGGAGTTGATATACATGCAGGTGACTGGGAGACTGCGGGCTCTATCAGGATTTGGCAGTACACAATCGGAGGGAAAGCCGGGGTCTTTAAAGAGGAGGTTTCCTTCGATGATGAGAACAAGATCATAACTCTTAATGGTTTGGAAGGAGATGTCATGAAAATTTACAAGGTCTATAGGCCCGTCTGGCAGCTTACACCAAAAGGCTCGGGCTGCTTGGCAAAACTGACCATTGAATACGAAAAACTCCATCCTGAAGTCCCGGTTCCAGAGATTTATGTTGATCTTATGGTTCATATGACTAAAGACATCGACGAAGCCCTTAGCACGGAGTAATAGAAGGGGTCATCG SRR7180078 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 17:17:29 Started mapping on | Feb 10 17:17:30 Finished on | Feb 10 17:19:36 Mapping speed, Million of reads per hour | 433.53 Number of input reads | 15173515 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 14222398 Uniquely mapped reads % | 93.73% Average mapped length | 294.80 Number of splices: Total | 13371921 Number of splices: Annotated (sjdb) | 13072078 Number of splices: GT/AG | 13147047 Number of splices: GC/AG | 173713 Number of splices: AT/AC | 10755 Number of splices: Non-canonical | 40406 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.77 Insertion rate per base | 0.02% Insertion average length | 2.49 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 336057 % of reads mapped to multiple loci | 2.21% Number of reads mapped to too many loci | 62274 % of reads mapped to too many loci | 0.41% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.56% % of reads unmapped: other | 0.09% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 632926 632926 632926 N_multimapping 336057 336057 336057 N_noFeature 463961 14085606 522716 N_ambiguous 153255 608 74859 UnstrandedReadsAssigned:13605182 PositiveStrandReadsAssigned:136184 NegativeStrandReadsAssigned:13624823 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7180078 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7180078-trimmed-pair1.fastq SRR7180078-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,173,515 reads, 13,548,247 reads pseudoaligned [quant] estimated average fragment length: 226.984 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,124 rounds 52401 SRR7180078.ke.tsv 34699 SRR7180078.se.tsv 87100 total ==> SRR7180078.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1792.02 1566 62.9314 Potri.005G024800.1.v4.1 1035 809.016 689 61.3309 Potri.004G059700.1.v4.1 961 735.036 4 0.391894 Potri.007G009000.2.v4.1 1416 1190.02 0 0 Potri.003G141000.2.v4.1 2943 2717.02 714 18.9245 Potri.016G087400.1.v4.1 270 81.8384 947.851 834.066 Potri.015G069301.1.v4.1 564 340.006 0 0 Potri.010G195200.1.v4.1 1773 1547.02 515 23.9734 Potri.012G127500.1.v4.1 977 751.026 13294 1274.73 ==> SRR7180078.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 76 Potri.001G233950.v4.1 4 Potri.001G122700.v4.1 508 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 103 SRR7180078 completed mapping pipeline successfully