Starting /dee2/code/volunteer_pipeline.sh SRR7180079 current disk space = 3057479438336 free memory = 1579823564 SRR7180079 SRAfilesize 77e836f3a9a60e88ed60e5de5d389244 SRR7180079.sra SRR7180079.sra file validated SRR7180079 is paired end SRR7180079 is conventional basespace SRR7180079 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7180079_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 22.0675 18.0 18.0 32.0 18.0 32.0 2 22.57675 18.0 18.0 27.0 18.0 31.0 3 24.92775 27.0 18.0 29.0 18.0 31.0 4 26.7095 27.0 25.0 30.0 15.0 33.0 5 30.6375 32.0 31.0 32.0 27.0 33.0 6 36.373 37.0 36.0 38.0 34.0 38.0 7 37.0155 38.0 37.0 38.0 35.0 38.0 8 37.4975 38.0 38.0 38.0 37.0 38.0 9 37.61625 38.0 38.0 38.0 38.0 38.0 10-14 37.692750000000004 38.0 38.0 38.0 38.0 38.0 15-19 37.70705 38.0 38.0 38.0 38.0 38.0 20-24 37.7005 38.0 38.0 38.0 38.0 38.0 25-29 37.68485 38.0 38.0 38.0 38.0 38.0 30-34 37.640049999999995 38.0 38.0 38.0 38.0 38.0 35-39 37.63244999999999 38.0 38.0 38.0 38.0 38.0 40-44 37.5835 38.0 38.0 38.0 38.0 38.0 45-49 37.55085 38.0 38.0 38.0 38.0 38.0 50-54 37.586149999999996 38.0 38.0 38.0 38.0 38.0 55-59 37.51774999999999 38.0 38.0 38.0 37.8 38.0 60-64 37.466300000000004 38.0 38.0 38.0 37.4 38.0 65-69 37.4627 38.0 38.0 38.0 37.0 38.0 70-74 37.412099999999995 38.0 38.0 38.0 37.0 38.0 75-79 37.40725 38.0 38.0 38.0 37.0 38.0 80-84 37.321450000000006 38.0 38.0 38.0 37.0 38.0 85-89 37.27065 38.0 38.0 38.0 37.0 38.0 90-94 37.30055 38.0 38.0 38.0 37.0 38.0 95-99 37.16455 38.0 38.0 38.0 36.2 38.0 100-104 37.0629 38.0 38.0 38.0 36.0 38.0 105-109 36.96724999999999 38.0 38.0 38.0 36.0 38.0 110-114 36.86415 38.0 38.0 38.0 35.4 38.0 115-119 36.77374999999999 38.0 38.0 38.0 35.0 38.0 120-124 36.7154 38.0 38.0 38.0 35.0 38.0 125-129 36.5302 38.0 38.0 38.0 34.4 38.0 130-134 36.372699999999995 38.0 38.0 38.0 34.0 38.0 135-139 36.12455 38.0 38.0 38.0 33.4 38.0 140-144 35.9131 38.0 37.2 38.0 33.0 38.0 145-149 35.637950000000004 38.0 36.8 38.0 32.6 38.0 150-151 32.976375 37.0 33.5 38.0 17.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 1.0 8 0.0 9 1.0 10 0.0 11 0.0 12 0.0 13 0.0 14 1.0 15 0.0 16 1.0 17 1.0 18 0.0 19 1.0 20 1.0 21 1.0 22 0.0 23 6.0 24 9.0 25 9.0 26 7.0 27 12.0 28 16.0 29 12.0 30 24.0 31 26.0 32 38.0 33 53.0 34 85.0 35 218.0 36 651.0 37 2825.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.33176838810642 6.494522691705789 13.849765258215962 37.32394366197183 2 23.317488116087066 18.714035526644984 37.828371278458846 20.140105078809107 3 21.099999999999998 25.0 26.325 27.575 4 22.35 31.525 23.275000000000002 22.85 5 22.35 34.949999999999996 24.55 18.15 6 17.599999999999998 36.05 25.074999999999996 21.275 7 14.45 22.775000000000002 43.7 19.075 8 18.125 22.650000000000002 30.15 29.075 9 18.825 22.6 31.924999999999997 26.650000000000002 10-14 20.349999999999998 28.749999999999996 26.529999999999998 24.37 15-19 20.36 27.815 28.105000000000004 23.72 20-24 20.169999999999998 28.244999999999997 27.815 23.77 25-29 19.935 28.425 27.750000000000004 23.89 30-34 20.365 28.044999999999998 27.52 24.07 35-39 20.62 28.310000000000002 27.485 23.585 40-44 19.845 28.585 27.71 23.86 45-49 20.44 27.92 27.415 24.224999999999998 50-54 20.275000000000002 27.71 28.015 24.0 55-59 20.544999999999998 28.444999999999997 27.255000000000003 23.755000000000003 60-64 19.939999999999998 28.42 28.185 23.455000000000002 65-69 20.41 27.76 28.43 23.400000000000002 70-74 20.54 28.199999999999996 27.13 24.13 75-79 20.544999999999998 28.32 27.189999999999998 23.945 80-84 20.655 27.655 27.515 24.175 85-89 20.02 27.884999999999998 27.845 24.25 90-94 20.61 28.095 28.000000000000004 23.294999999999998 95-99 20.055 28.139999999999997 27.625 24.18 100-104 20.995 27.38 27.650000000000002 23.974999999999998 105-109 20.599999999999998 28.465 27.075 23.86 110-114 20.755000000000003 27.029999999999998 27.99 24.224999999999998 115-119 21.01 27.894999999999996 27.525 23.57 120-124 20.605 27.42 28.244999999999997 23.73 125-129 21.02 27.48 27.405 24.095 130-134 21.115000000000002 27.55 27.825 23.51 135-139 21.255 26.825 27.634999999999998 24.285 140-144 21.09 27.944999999999997 27.750000000000004 23.215 145-149 21.17 27.725 27.284999999999997 23.82 150-151 20.915686765073804 27.195396547410557 27.558168626469854 24.330748061045785 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 1.0 16 0.5 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.0 24 0.5 25 1.0 26 3.5 27 7.0 28 10.0 29 11.5 30 15.5 31 22.0 32 29.0 33 32.0 34 41.5 35 68.5 36 84.0 37 101.0 38 119.5 39 146.0 40 174.5 41 201.0 42 252.0 43 271.0 44 265.0 45 264.0 46 259.0 47 264.5 48 256.5 49 225.0 50 195.5 51 172.0 52 135.5 53 97.5 54 70.0 55 52.0 56 40.5 57 30.5 58 23.0 59 13.0 60 9.5 61 9.0 62 8.0 63 6.0 64 4.5 65 3.0 66 1.0 67 0.5 68 0.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.15 2 0.075 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.075 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.725 #Duplication Level Percentage of deduplicated Percentage of total 1 99.72424166457759 99.45 2 0.2757583354224116 0.5499999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0125 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.0625 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.1125 0.0 0.0 0.0 0.0 94-95 0.175 0.0 0.0 0.0 0.0 96-97 0.25 0.0 0.0 0.0 0.0 98-99 0.3125 0.0 0.0 0.0 0.0 100-101 0.35 0.0 0.0 0.0 0.0 102-103 0.42500000000000004 0.0 0.0 0.0 0.0 104-105 0.5375 0.0 0.0 0.0 0.0 106-107 0.6625 0.0 0.0 0.0 0.0 108-109 0.7875 0.0 0.0 0.0 0.0 110-111 0.95 0.0 0.0 0.0 0.0 112-113 1.1375 0.0 0.0 0.0 0.0 114-115 1.3250000000000002 0.0 0.0 0.0 0.0 116-117 1.5125 0.0 0.0 0.0 0.0 118-119 1.675 0.0 0.0 0.0 0.0 120-121 1.85 0.0 0.0 0.0 0.0 122-123 2.0125 0.0 0.0 0.0 0.0 124-125 2.2 0.0 0.0 0.0 0.0 126-127 2.375 0.0 0.0 0.0 0.0 128-129 2.575 0.0 0.0 0.0 0.0 130-131 2.8375 0.0 0.0 0.0 0.0 132-133 3.2125 0.0 0.0 0.0 0.0 134-135 3.6375 0.0 0.0 0.0 0.0 136-137 4.1625 0.0 0.0 0.0 0.0 138-139 4.6125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTCACGT 20 0.005950134 28.985 140-144 TCCAGTC 20 0.005950134 28.985 135-139 >>END_MODULE SRR7180079 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7180079_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.09325 33.0 33.0 34.0 33.0 34.0 2 33.2265 34.0 33.0 34.0 33.0 34.0 3 33.3085 34.0 33.0 34.0 33.0 34.0 4 33.24825 34.0 33.0 34.0 33.0 34.0 5 33.29475 34.0 33.0 34.0 33.0 34.0 6 37.50725 38.0 38.0 38.0 38.0 38.0 7 37.502 38.0 38.0 38.0 38.0 38.0 8 37.5795 38.0 38.0 38.0 38.0 38.0 9 37.5065 38.0 38.0 38.0 38.0 38.0 10-14 37.46575 38.0 38.0 38.0 38.0 38.0 15-19 37.39175 38.0 38.0 38.0 37.8 38.0 20-24 37.390100000000004 38.0 38.0 38.0 37.8 38.0 25-29 37.3849 38.0 38.0 38.0 38.0 38.0 30-34 37.36555 38.0 38.0 38.0 37.6 38.0 35-39 37.34119999999999 38.0 38.0 38.0 37.4 38.0 40-44 37.2466 38.0 38.0 38.0 37.0 38.0 45-49 37.28255 38.0 38.0 38.0 37.0 38.0 50-54 37.280950000000004 38.0 38.0 38.0 37.0 38.0 55-59 37.27045 38.0 38.0 38.0 37.0 38.0 60-64 37.15865 38.0 38.0 38.0 36.8 38.0 65-69 37.1414 38.0 38.0 38.0 36.6 38.0 70-74 37.0831 38.0 38.0 38.0 36.2 38.0 75-79 37.02095 38.0 38.0 38.0 36.2 38.0 80-84 36.98375 38.0 38.0 38.0 36.0 38.0 85-89 36.9049 38.0 38.0 38.0 36.0 38.0 90-94 36.84805 38.0 38.0 38.0 35.8 38.0 95-99 36.7924 38.0 38.0 38.0 35.6 38.0 100-104 36.6716 38.0 38.0 38.0 35.0 38.0 105-109 36.535700000000006 38.0 38.0 38.0 34.4 38.0 110-114 36.469 38.0 38.0 38.0 34.0 38.0 115-119 36.3079 38.0 38.0 38.0 34.0 38.0 120-124 36.174899999999994 38.0 37.8 38.0 33.6 38.0 125-129 35.9839 38.0 37.8 38.0 33.4 38.0 130-134 35.7518 38.0 36.8 38.0 33.0 38.0 135-139 35.3943 38.0 36.0 38.0 30.6 38.0 140-144 35.13655000000001 38.0 36.0 38.0 30.6 38.0 145-149 34.70525 38.0 36.0 38.0 28.0 38.0 150-151 31.3245 36.5 31.5 38.0 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 3.0 4 0.0 5 0.0 6 1.0 7 1.0 8 1.0 9 0.0 10 3.0 11 2.0 12 0.0 13 2.0 14 4.0 15 1.0 16 3.0 17 3.0 18 1.0 19 7.0 20 2.0 21 3.0 22 6.0 23 7.0 24 3.0 25 12.0 26 12.0 27 18.0 28 17.0 29 20.0 30 28.0 31 32.0 32 52.0 33 71.0 34 109.0 35 202.0 36 519.0 37 2854.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.675000000000004 16.025 17.325 30.975 2 23.95 22.125 36.25 17.675 3 21.175 26.35 31.225 21.25 4 25.025 33.0 22.075 19.900000000000002 5 23.875 36.8 21.6 17.724999999999998 6 19.15957978989495 37.768884442221115 23.336668334167083 19.734867433716857 7 19.18459229614807 17.808904452226113 41.9959979989995 21.010505252626313 8 20.724999999999998 23.925 27.200000000000003 28.15 9 21.635817908954476 24.987493746873437 28.789394697348676 24.58729364682341 10-14 23.601800900450225 27.548774387193596 26.31815907953977 22.531265632816407 15-19 23.519111466880126 27.636581949169504 27.296377826696016 21.547928757254354 20-24 23.29596636973276 28.150335301771594 26.839155239715744 21.7145430887799 25-29 22.57337473705299 27.94751076830612 27.9324852248823 21.54662926975859 30-34 22.995991983967937 28.642284569138276 27.194388777555112 21.16733466933868 35-39 24.05811623246493 27.83066132264529 27.62024048096192 20.490981963927858 40-44 23.528822055137844 27.463659147869674 27.328320802005013 21.67919799498747 45-49 23.484355444305383 27.664580725907385 27.23404255319149 21.617021276595743 50-54 23.477912852068638 27.820301165641105 27.13492420831457 21.56686177397569 55-59 23.432888088448646 28.105458001901045 27.610185602081145 20.851468307569164 60-64 23.736868434217108 27.763881940970485 27.298649324662332 21.200600300150075 65-69 24.047023511755878 28.01400700350175 27.063531765882942 20.87543771885943 70-74 23.81190595297649 28.054027013506754 26.948474237118557 21.1855927963982 75-79 23.75687843921961 28.52426213106553 27.6088044022011 20.110055027513756 80-84 23.836918459229615 28.36418209104552 26.988494247123562 20.810405202601302 85-89 24.09704852426213 28.194097048524263 27.39369684842421 20.315157578789396 90-94 23.91358703805571 28.034205130769614 27.359103865579836 20.69310396559484 95-99 23.951197559877993 27.796389819490976 27.30636531826591 20.946047302365116 100-104 23.26965393078616 28.205641128225643 27.095419083816765 21.429285857171436 105-109 24.216210810540527 28.006400320016 27.246362318115906 20.531026551327567 110-114 24.392439243924393 28.007800780078007 27.477747774777477 20.122012201220123 115-119 24.188628294244136 28.249237385607838 27.014052107816173 20.54808221233185 120-124 24.768715307296095 27.634145121768267 27.33910086512977 20.25803870580587 125-129 24.61115278819705 27.076769192298073 27.60690172543136 20.705176294073517 130-134 24.65986394557823 27.836134453781515 27.35094037615046 20.153061224489797 135-139 24.119823964792957 28.030606121224245 27.370474094818963 20.479095819163835 140-144 24.402440244024405 27.69276927692769 27.462746274627463 20.442044204420444 145-149 24.515 27.265 28.115000000000002 20.105 150-151 24.169903520862047 27.866182182683875 27.00162886856284 20.962285427891242 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 1.0 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 1.0 24 1.0 25 1.0 26 1.0 27 2.0 28 4.5 29 4.5 30 5.5 31 8.5 32 11.0 33 22.5 34 30.5 35 41.0 36 51.0 37 75.5 38 114.5 39 142.0 40 184.0 41 228.0 42 268.0 43 298.5 44 299.5 45 296.0 46 296.0 47 282.0 48 264.5 49 226.0 50 178.0 51 166.0 52 130.5 53 89.0 54 74.0 55 53.5 56 39.5 57 29.0 58 22.5 59 17.5 60 13.5 61 9.0 62 5.0 63 3.5 64 2.0 65 0.5 66 1.0 67 1.5 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.5 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.05 7 0.05 8 0.0 9 0.05 10-14 0.05 15-19 0.06 20-24 0.09 25-29 0.16999999999999998 30-34 0.2 35-39 0.2 40-44 0.25 45-49 0.125 50-54 0.055 55-59 0.055 60-64 0.05 65-69 0.05 70-74 0.05 75-79 0.05 80-84 0.05 85-89 0.05 90-94 0.015 95-99 0.005 100-104 0.02 105-109 0.005 110-114 0.01 115-119 0.015 120-124 0.015 125-129 0.025 130-134 0.04 135-139 0.02 140-144 0.01 145-149 0.0 150-151 0.2375 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.5 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57286432160805 99.075 2 0.35175879396984927 0.7000000000000001 3 0.07537688442211055 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0125 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.0625 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.1125 0.0 0.0 0.0 0.0 94-95 0.175 0.0 0.0 0.0 0.0 96-97 0.25 0.0 0.0 0.0 0.0 98-99 0.3125 0.0 0.0 0.0 0.0 100-101 0.35 0.0 0.0 0.0 0.0 102-103 0.42500000000000004 0.0 0.0 0.0 0.0 104-105 0.5375 0.0 0.0 0.0 0.0 106-107 0.6875 0.0 0.0 0.0 0.0 108-109 0.8125 0.0 0.0 0.0 0.0 110-111 0.9625 0.0 0.0 0.0 0.0 112-113 1.1375 0.0 0.0 0.0 0.0 114-115 1.2999999999999998 0.0 0.0 0.0 0.0 116-117 1.4875 0.0 0.0 0.0 0.0 118-119 1.65 0.0 0.0 0.0 0.0 120-121 1.825 0.0 0.0 0.0 0.0 122-123 1.9625 0.0 0.0 0.0 0.0 124-125 2.1500000000000004 0.0 0.0 0.0 0.0 126-127 2.325 0.0 0.0 0.0 0.0 128-129 2.525 0.0 0.0 0.0 0.0 130-131 2.8 0.0 0.0 0.0 0.0 132-133 3.1875 0.0 0.0 0.0 0.0 134-135 3.6125 0.0 0.0 0.0 0.0 136-137 4.125 0.0 0.0 0.0 0.0 138-139 4.6125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAACTAT 10 0.006830828 145.0 3 AATCAAC 10 0.006830828 145.0 5 AACTATT 10 0.006830828 145.0 4 AAGAGTG 20 0.00593511 29.0 135-139 GTGTGTT 25 4.977651E-4 29.0 140-144 AAAGAGT 20 0.00593511 29.0 135-139 >>END_MODULE Read 833833 spots for SRR7180079.sra Written 833833 spots for SRR7180079.sra Read 833833 spots for SRR7180079.sra Written 833833 spots for SRR7180079.sra Read 833833 spots for SRR7180079.sra Written 833833 spots for SRR7180079.sra Read 833833 spots for SRR7180079.sra Written 833833 spots for SRR7180079.sra Read 833833 spots for SRR7180079.sra Written 833833 spots for SRR7180079.sra Read 833833 spots for SRR7180079.sra Written 833833 spots for SRR7180079.sra Read 833833 spots for SRR7180079.sra Written 833833 spots for SRR7180079.sra Read 833833 spots for SRR7180079.sra Written 833833 spots for SRR7180079.sra Read 833833 spots for SRR7180079.sra Written 833833 spots for SRR7180079.sra Read 833833 spots for SRR7180079.sra Written 833833 spots for SRR7180079.sra Read 833833 spots for SRR7180079.sra Written 833833 spots for SRR7180079.sra Read 833833 spots for SRR7180079.sra Written 833833 spots for SRR7180079.sra Read 833833 spots for SRR7180079.sra Written 833833 spots for SRR7180079.sra Read 833833 spots for SRR7180079.sra Written 833833 spots for SRR7180079.sra Read 833833 spots for SRR7180079.sra Written 833833 spots for SRR7180079.sra Read 833833 spots for SRR7180079.sra Written 833833 spots for SRR7180079.sra Read 833847 spots for SRR7180079.sra Written 833847 spots for SRR7180079.sra Read 833833 spots for SRR7180079.sra Written 833833 spots for SRR7180079.sra Read 833833 spots for SRR7180079.sra Written 833833 spots for SRR7180079.sra Read 833833 spots for SRR7180079.sra Written 833833 spots for SRR7180079.sra SRR ids: ['SRR7180079.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_pyji_187 SRR7180079.sra spots: 16676674 blocks: [[1, 833833], [833834, 1667666], [1667667, 2501499], [2501500, 3335332], [3335333, 4169165], [4169166, 5002998], [5002999, 5836831], [5836832, 6670664], [6670665, 7504497], [7504498, 8338330], [8338331, 9172163], [9172164, 10005996], [10005997, 10839829], [10839830, 11673662], [11673663, 12507495], [12507496, 13341328], [13341329, 14175161], [14175162, 15008994], [15008995, 15842827], [15842828, 16676674]] SRR7180079 file size 5629477 SRR7180079 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7180079 SRR7180079_1.fastq SRR7180079_2.fastq Input file: SRR7180079_1.fastq Paired file: SRR7180079_2.fastq trimmed: SRR7180079-trimmed-pair1.fastq, SRR7180079-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 18:30:30 2025 >> started Mon Feb 10 18:30:49 2025 >> done (18.595s) 16676674 read pairs processed; of these: 16838 ( 0.10%) short read pairs filtered out after trimming by size control 9779 ( 0.06%) empty read pairs filtered out after trimming by size control 16650057 (99.84%) read pairs available; of these: 5660024 (33.99%) trimmed read pairs available after processing 10990033 (66.01%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 1 0.00% 20 2 0.00% 21 4 0.00% 22 1 0.00% 23 0 0.00% 24 2 0.00% 25 3 0.00% 26 4 0.00% 27 6 0.00% 28 4 0.00% 29 5 0.00% 30 5 0.00% 31 4 0.00% 32 3 0.00% 33 4 0.00% 34 2 0.00% 35 3 0.00% 36 12 0.00% 37 27 0.00% 38 12 0.00% 39 13 0.00% 40 7 0.00% 41 5 0.00% 42 19 0.00% 43 9 0.00% 44 28 0.00% 45 34 0.00% 46 29 0.00% 47 49 0.00% 48 33 0.00% 49 63 0.00% 50 24 0.00% 51 82 0.00% 52 60 0.00% 53 105 0.00% 54 65 0.00% 55 131 0.00% 56 120 0.00% 57 78 0.00% 58 34 0.00% 59 56 0.00% 60 69 0.00% 61 92 0.00% 62 88 0.00% 63 102 0.00% 64 95 0.00% 65 101 0.00% 66 119 0.00% 67 145 0.00% 68 148 0.00% 69 203 0.00% 70 240 0.00% 71 269 0.00% 72 317 0.00% 73 368 0.00% 74 443 0.00% 75 513 0.00% 76 548 0.00% 77 639 0.00% 78 725 0.00% 79 832 0.00% 80 941 0.01% 81 1117 0.01% 82 1263 0.01% 83 1442 0.01% 84 2208 0.01% 85 2660 0.02% 86 2954 0.02% 87 3336 0.02% 88 3693 0.02% 89 3806 0.02% 90 4018 0.02% 91 4325 0.03% 92 4649 0.03% 93 4858 0.03% 94 5278 0.03% 95 5756 0.03% 96 6099 0.04% 97 6493 0.04% 98 7009 0.04% 99 7358 0.04% 100 7857 0.05% 101 8471 0.05% 102 8835 0.05% 103 9517 0.06% 104 10069 0.06% 105 10838 0.07% 106 11388 0.07% 107 12134 0.07% 108 12809 0.08% 109 13438 0.08% 110 14285 0.09% 111 15070 0.09% 112 15934 0.10% 113 16680 0.10% 114 17879 0.11% 115 18920 0.11% 116 19855 0.12% 117 20629 0.12% 118 22293 0.13% 119 24346 0.15% 120 25379 0.15% 121 25895 0.16% 122 25531 0.15% 123 26628 0.16% 124 27640 0.17% 125 28589 0.17% 126 30120 0.18% 127 31789 0.19% 128 32788 0.20% 129 34670 0.21% 130 36085 0.22% 131 37599 0.23% 132 39904 0.24% 133 41752 0.25% 134 43656 0.26% 135 45550 0.27% 136 48087 0.29% 137 50451 0.30% 138 53036 0.32% 139 56533 0.34% 140 60265 0.36% 141 65031 0.39% 142 71093 0.43% 143 77502 0.47% 144 88634 0.53% 145 100910 0.61% 146 120272 0.72% 147 157077 0.94% 148 237031 1.42% 149 480752 2.89% 150 3082061 18.51% 151 10990033 66.01% 16650057 reads passed initial QC criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=7.98 fanout-score-rank=15 prefix-density=0.32 prefix-fanout=4.2 sequence=TCCTTGTCCTGGATCTTGGCCTTCAC criterion=fanout-score sequence-density=0.10 sequence-density-rank=15 fanout-score=366.55 fanout-score-rank=1 prefix-density=1.02 prefix-fanout=35.1 sequence=CTTCTTCTTCCT criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=6.60 fanout-score-rank=24 prefix-density=0.33 prefix-fanout=4.1 sequence=CTGCAAATGTGG criterion=fanout-score sequence-density=0.10 sequence-density-rank=21 fanout-score=112.07 fanout-score-rank=1 prefix-density=0.56 prefix-fanout=20.8 sequence=CAAAGAAGAAGAT SRR7180079 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 18:31:34 Started mapping on | Feb 10 18:31:34 Finished on | Feb 10 18:33:29 Mapping speed, Million of reads per hour | 521.22 Number of input reads | 16650057 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 15622798 Uniquely mapped reads % | 93.83% Average mapped length | 296.43 Number of splices: Total | 16490430 Number of splices: Annotated (sjdb) | 16237012 Number of splices: GT/AG | 16243469 Number of splices: GC/AG | 201008 Number of splices: AT/AC | 11631 Number of splices: Non-canonical | 34322 Mismatch rate per base, % | 0.31% Deletion rate per base | 0.03% Deletion average length | 2.50 Insertion rate per base | 0.02% Insertion average length | 2.70 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 419582 % of reads mapped to multiple loci | 2.52% Number of reads mapped to too many loci | 47030 % of reads mapped to too many loci | 0.28% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.31% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 620083 620083 620083 N_multimapping 419582 419582 419582 N_noFeature 252939 15491914 312225 N_ambiguous 140839 951 68675 UnstrandedReadsAssigned:15229020 PositiveStrandReadsAssigned:129933 NegativeStrandReadsAssigned:15241898 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7180079 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7180079-trimmed-pair1.fastq SRR7180079-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,650,057 reads, 15,107,031 reads pseudoaligned [quant] estimated average fragment length: 244.593 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,103 rounds 52401 SRR7180079.ke.tsv 34699 SRR7180079.se.tsv 87100 total ==> SRR7180079.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1774.41 766 26.5884 Potri.005G024800.1.v4.1 1035 791.407 177 13.775 Potri.004G059700.1.v4.1 961 717.459 23 1.97446 Potri.007G009000.2.v4.1 1416 1172.41 0 0 Potri.003G141000.2.v4.1 2943 2699.41 498 11.3626 Potri.016G087400.1.v4.1 270 74.9301 1522 1251.05 Potri.015G069301.1.v4.1 564 324.474 0 0 Potri.010G195200.1.v4.1 1773 1529.41 101 4.06738 Potri.012G127500.1.v4.1 977 733.407 2688 225.736 ==> SRR7180079.se.tsv <== Potri.001G166300.v4.1 1 Potri.001G448400.v4.1 14 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 268 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 3 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 169 SRR7180079 completed mapping pipeline successfully