Starting /dee2/code/volunteer_pipeline.sh SRR7180080 current disk space = 3057945907200 free memory = 1286774604 SRR7180080 SRAfilesize 3e6e7eac239bb7a4dfb5fc94ae00cbcb SRR7180080.sra SRR7180080.sra file validated SRR7180080 is paired end SRR7180080 is conventional basespace SRR7180080 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7180080_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 27.0995 31.0 25.0 33.0 18.0 33.0 2 30.952 33.0 29.0 33.0 27.0 33.0 3 31.05775 33.0 31.0 33.0 27.0 33.0 4 32.51175 33.0 33.0 33.0 32.0 34.0 5 32.833 33.0 33.0 34.0 32.0 34.0 6 36.58575 38.0 37.0 38.0 34.0 38.0 7 36.81525 38.0 37.0 38.0 34.0 38.0 8 37.22525 38.0 38.0 38.0 36.0 38.0 9 37.3515 38.0 38.0 38.0 37.0 38.0 10-14 37.507600000000004 38.0 38.0 38.0 37.2 38.0 15-19 37.5058 38.0 38.0 38.0 37.4 38.0 20-24 37.4981 38.0 38.0 38.0 37.2 38.0 25-29 37.483050000000006 38.0 38.0 38.0 37.6 38.0 30-34 37.40795 38.0 38.0 38.0 37.2 38.0 35-39 37.378949999999996 38.0 38.0 38.0 37.0 38.0 40-44 37.3763 38.0 38.0 38.0 37.0 38.0 45-49 37.3378 38.0 38.0 38.0 37.0 38.0 50-54 37.299400000000006 38.0 38.0 38.0 37.0 38.0 55-59 37.2781 38.0 38.0 38.0 37.0 38.0 60-64 37.20745 38.0 38.0 38.0 36.8 38.0 65-69 37.16374999999999 38.0 38.0 38.0 36.0 38.0 70-74 37.13785 38.0 38.0 38.0 36.0 38.0 75-79 37.0255 38.0 38.0 38.0 36.0 38.0 80-84 37.01005 38.0 38.0 38.0 36.0 38.0 85-89 36.936699999999995 38.0 38.0 38.0 35.6 38.0 90-94 36.95305 38.0 38.0 38.0 36.0 38.0 95-99 36.756350000000005 38.0 38.0 38.0 35.0 38.0 100-104 36.740449999999996 38.0 38.0 38.0 35.2 38.0 105-109 36.665800000000004 38.0 38.0 38.0 34.4 38.0 110-114 36.444950000000006 38.0 38.0 38.0 34.0 38.0 115-119 36.3191 38.0 38.0 38.0 34.0 38.0 120-124 36.1872 38.0 37.6 38.0 33.6 38.0 125-129 36.104 38.0 37.8 38.0 33.0 38.0 130-134 35.82235 38.0 36.8 38.0 32.2 38.0 135-139 35.5647 38.0 36.0 38.0 31.2 38.0 140-144 35.19509999999999 38.0 36.0 38.0 29.6 38.0 145-149 34.82355 38.0 36.0 38.0 29.2 38.0 150-151 31.98525 36.5 32.5 38.0 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 3.0 8 0.0 9 0.0 10 0.0 11 1.0 12 0.0 13 0.0 14 1.0 15 0.0 16 0.0 17 4.0 18 1.0 19 2.0 20 3.0 21 1.0 22 4.0 23 9.0 24 2.0 25 9.0 26 10.0 27 16.0 28 24.0 29 27.0 30 36.0 31 51.0 32 72.0 33 68.0 34 133.0 35 223.0 36 607.0 37 2693.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.329992086520704 12.793458190451068 12.002110261144816 35.874439461883405 2 21.275 18.025 35.225 25.474999999999998 3 20.05 22.5 28.050000000000004 29.4 4 22.35 29.725 23.799999999999997 24.125 5 21.3 33.2 24.925 20.575 6 17.599999999999998 35.15 27.450000000000003 19.8 7 13.875000000000002 24.275 42.6 19.25 8 18.125 23.625 29.575000000000003 28.675 9 17.1 23.400000000000002 33.45 26.05 10-14 19.555 29.17 27.055 24.22 15-19 20.185 27.515 28.18 24.12 20-24 19.59 27.6 28.53 24.279999999999998 25-29 19.72 28.194999999999997 27.83 24.255 30-34 19.595000000000002 28.685 27.57 24.15 35-39 19.905 28.144999999999996 27.36 24.59 40-44 19.82 28.105000000000004 27.625 24.45 45-49 20.135 27.71 27.91 24.245 50-54 19.655 27.965 27.735 24.645 55-59 20.095 27.755000000000003 28.005000000000003 24.145 60-64 19.955000000000002 27.855 28.185 24.005000000000003 65-69 20.7 27.83 27.72 23.75 70-74 20.375 27.884999999999998 27.43 24.310000000000002 75-79 20.11 28.265 27.675 23.95 80-84 20.225 27.62 27.950000000000003 24.205 85-89 20.125 27.750000000000004 27.700000000000003 24.425 90-94 20.4 27.48 27.85 24.27 95-99 20.200000000000003 27.525 28.1 24.175 100-104 20.28 27.155 28.265 24.3 105-109 20.255000000000003 27.71 27.765 24.27 110-114 20.785 28.055000000000003 27.534999999999997 23.625 115-119 20.875 27.694999999999997 27.389999999999997 24.04 120-124 20.62 28.435 27.310000000000002 23.635 125-129 21.115000000000002 27.565 27.605 23.715 130-134 21.09 27.935 27.235 23.74 135-139 20.49 28.075 27.229999999999997 24.205 140-144 20.625 27.99 26.58 24.805 145-149 20.905 28.34 26.72 24.035 150-151 20.375 27.8625 26.687499999999996 25.074999999999996 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.5 4 0.5 5 0.0 6 1.0 7 1.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 1.5 23 2.0 24 1.5 25 2.0 26 3.0 27 7.0 28 7.5 29 9.0 30 15.0 31 21.0 32 26.5 33 36.5 34 50.0 35 59.0 36 75.5 37 97.5 38 122.0 39 149.5 40 164.0 41 205.5 42 256.0 43 276.0 44 289.0 45 274.0 46 265.5 47 260.5 48 231.0 49 210.0 50 196.5 51 155.0 52 120.0 53 101.0 54 76.5 55 59.5 56 47.5 57 35.0 58 23.0 59 20.0 60 14.0 61 7.5 62 6.0 63 5.0 64 3.5 65 4.0 66 1.5 67 1.0 68 1.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 5.225 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.775 #Duplication Level Percentage of deduplicated Percentage of total 1 99.77449260836883 99.55000000000001 2 0.22550739163117012 0.44999999999999996 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.037500000000000006 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.0875 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.1375 0.0 0.0 0.0 0.0 96-97 0.23750000000000002 0.0 0.0 0.0 0.0 98-99 0.38749999999999996 0.0 0.0 0.0 0.0 100-101 0.5625 0.0 0.0 0.0 0.0 102-103 0.7125 0.0 0.0 0.0 0.0 104-105 0.825 0.0 0.0 0.0 0.0 106-107 1.0125 0.0 0.0 0.0 0.0 108-109 1.2875 0.0 0.0 0.0 0.0 110-111 1.55 0.0 0.0 0.0 0.0 112-113 1.6749999999999998 0.0 0.0 0.0 0.0 114-115 1.8375 0.0 0.0 0.0 0.0 116-117 2.0625 0.0 0.0 0.0 0.0 118-119 2.3125 0.0 0.0 0.0 0.0 120-121 2.4749999999999996 0.0 0.0 0.0 0.0 122-123 2.825 0.0 0.0 0.0 0.0 124-125 3.1875 0.0 0.0 0.0 0.0 126-127 3.6 0.0 0.0 0.0 0.0 128-129 4.0375 0.0 0.0 0.0 0.0 130-131 4.4625 0.0 0.0 0.0 0.0 132-133 4.875 0.0 0.0 0.0 0.0 134-135 5.225 0.0 0.0 0.0 0.0 136-137 5.550000000000001 0.0 0.0 0.0 0.0 138-139 6.0625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7180080 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7180080_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.7255 33.0 33.0 34.0 32.0 34.0 2 32.884 33.0 33.0 34.0 32.0 34.0 3 32.8725 34.0 33.0 34.0 32.0 34.0 4 32.7725 34.0 33.0 34.0 32.0 34.0 5 32.78675 34.0 33.0 34.0 32.0 34.0 6 36.90425 38.0 38.0 38.0 36.0 38.0 7 37.00575 38.0 38.0 38.0 36.0 38.0 8 36.8945 38.0 38.0 38.0 36.0 38.0 9 36.959 38.0 38.0 38.0 36.0 38.0 10-14 36.9605 38.0 38.0 38.0 36.2 38.0 15-19 36.8907 38.0 38.0 38.0 36.0 38.0 20-24 36.85510000000001 38.0 38.0 38.0 36.0 38.0 25-29 36.88285 38.0 38.0 38.0 36.0 38.0 30-34 36.8401 38.0 38.0 38.0 36.2 38.0 35-39 36.8103 38.0 38.0 38.0 36.0 38.0 40-44 36.79975 38.0 38.0 38.0 36.0 38.0 45-49 36.72495 38.0 38.0 38.0 36.0 38.0 50-54 36.85705 38.0 38.0 38.0 36.0 38.0 55-59 36.7353 38.0 38.0 38.0 35.8 38.0 60-64 36.5136 38.0 38.0 38.0 34.8 38.0 65-69 36.56675 38.0 38.0 38.0 35.0 38.0 70-74 36.5637 38.0 38.0 38.0 35.0 38.0 75-79 36.4767 38.0 38.0 38.0 34.8 38.0 80-84 36.3726 38.0 38.0 38.0 34.2 38.0 85-89 36.2573 38.0 38.0 38.0 34.0 38.0 90-94 36.1339 38.0 38.0 38.0 33.8 38.0 95-99 36.03455 38.0 38.0 38.0 33.4 38.0 100-104 35.88315 38.0 37.4 38.0 32.6 38.0 105-109 35.7338 38.0 37.0 38.0 31.8 38.0 110-114 35.75795 38.0 37.0 38.0 32.4 38.0 115-119 35.6186 38.0 37.0 38.0 31.4 38.0 120-124 35.411199999999994 38.0 36.6 38.0 31.0 38.0 125-129 35.1734 38.0 36.0 38.0 29.4 38.0 130-134 34.80605 38.0 35.8 38.0 28.0 38.0 135-139 34.573699999999995 38.0 35.0 38.0 27.4 38.0 140-144 34.2483 38.0 35.0 38.0 24.4 38.0 145-149 33.55415 38.0 35.0 38.0 19.2 38.0 150-151 29.86575 36.5 28.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 9.0 3 4.0 4 4.0 5 2.0 6 2.0 7 2.0 8 3.0 9 1.0 10 1.0 11 1.0 12 5.0 13 4.0 14 2.0 15 3.0 16 4.0 17 5.0 18 5.0 19 7.0 20 5.0 21 5.0 22 7.0 23 10.0 24 14.0 25 27.0 26 17.0 27 24.0 28 32.0 29 36.0 30 47.0 31 53.0 32 75.0 33 102.0 34 152.0 35 230.0 36 631.0 37 2469.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.769884942471236 17.483741870935468 15.457728864432216 27.288644322161083 2 24.88744372186093 24.61230615307654 32.44122061030515 18.05902951475738 3 20.560280140070038 26.988494247123562 32.04102051025512 20.410205102551277 4 23.925 33.35 23.400000000000002 19.325 5 24.037018509254626 35.217608804402204 23.06153076538269 17.68384192096048 6 19.70985492746373 36.84342171085543 23.43671835917959 20.01000500250125 7 19.809904952476238 19.409704852426213 39.394697348674335 21.38569284642321 8 20.05501375343836 24.056014003500874 27.68192048012003 28.207051762940733 9 21.810905452726363 25.912956478239117 28.96448224112056 23.311655827913956 10-14 23.59117955897795 28.281414070703537 26.251312565628282 21.876093804690232 15-19 23.291645822911455 28.33416708354177 27.498749374687343 20.87543771885943 20-24 22.932932932932935 28.548548548548546 27.402402402402405 21.116116116116114 25-29 23.686451289757073 28.394690708740296 26.947157525669923 20.97170047583271 30-34 23.445095975542525 28.21129654688518 27.63995389164537 20.70365358592693 35-39 22.516423449175065 28.11293315280076 27.69169048693646 21.67895291108771 40-44 23.79806487191056 28.390234120419112 26.981500977590617 20.830200030079713 45-49 24.02022123229391 27.44882126232544 27.593973672355975 20.936983833024676 50-54 22.726363181590795 28.789394697348676 27.733866933466732 20.750375187593797 55-59 23.55588897224306 28.937234308577143 26.74668667166792 20.760190047511877 60-64 23.65709712913874 28.27848354506352 27.7333199959988 20.331099329798942 65-69 24.302430243024304 27.787778777877786 27.447744774477446 20.462046204620464 70-74 23.971198559928 28.07640382019101 27.1963598179909 20.756037801890095 75-79 23.85619280964048 27.731386569328464 27.826391319565978 20.58602930146507 80-84 24.321216060803042 28.331416570828544 26.741337066853344 20.606030301515077 85-89 23.91119555977799 27.991399569978498 27.611380569028455 20.48602430121506 90-94 23.505000000000003 28.065 27.26 21.17 95-99 24.175 28.055000000000003 27.250000000000004 20.52 100-104 24.125 28.52 26.76 20.595 105-109 24.85 26.939999999999998 27.92 20.29 110-114 24.44 27.82 26.779999999999998 20.96 115-119 24.6 28.144999999999996 27.315 19.939999999999998 120-124 24.62 27.58 27.305 20.495 125-129 24.13 27.915 27.21 20.745 130-134 24.740000000000002 28.42 26.905 19.935 135-139 24.935 28.244999999999997 26.8 20.02 140-144 24.47 28.165000000000003 26.865 20.5 145-149 25.365 27.88 27.215 19.54 150-151 24.731182795698924 28.157039259814955 26.756689172293076 20.355088772193046 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 1.0 15 1.0 16 0.0 17 0.0 18 0.5 19 1.0 20 1.0 21 0.5 22 0.5 23 2.5 24 3.0 25 1.5 26 2.0 27 3.0 28 3.5 29 7.5 30 13.0 31 13.5 32 15.0 33 24.0 34 40.5 35 55.5 36 70.5 37 90.5 38 125.5 39 159.0 40 163.0 41 196.5 42 242.0 43 275.0 44 308.5 45 318.0 46 293.5 47 272.0 48 263.5 49 227.0 50 175.0 51 139.5 52 118.5 53 97.5 54 75.0 55 51.5 56 41.5 57 35.5 58 23.0 59 14.5 60 9.5 61 4.5 62 4.0 63 3.0 64 2.5 65 3.5 66 2.5 67 1.0 68 1.0 69 0.5 70 0.0 71 1.0 72 1.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.05 3 0.05 4 0.0 5 0.05 6 0.05 7 0.05 8 0.025 9 0.05 10-14 0.005 15-19 0.05 20-24 0.1 25-29 0.17500000000000002 30-34 0.23500000000000001 35-39 0.295 40-44 0.265 45-49 0.105 50-54 0.05 55-59 0.025 60-64 0.03 65-69 0.01 70-74 0.005 75-79 0.005 80-84 0.005 85-89 0.005 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.77420973406925 99.425 2 0.17561465127947817 0.35000000000000003 3 0.025087807325639738 0.075 4 0.0 0.0 5 0.0 0.0 6 0.025087807325639738 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTTAGGCTTGAGCAGATTCATTCGCCAACTAACCCTTTAATTTATCCTAT 6 0.15 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.037500000000000006 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.1125 0.0 0.0 0.0 0.0 92-93 0.15 0.0 0.0 0.0 0.0 94-95 0.15 0.0 0.0 0.0 0.0 96-97 0.23750000000000002 0.0 0.0 0.0 0.0 98-99 0.375 0.0 0.0 0.0 0.0 100-101 0.55 0.0 0.0 0.0 0.0 102-103 0.7125 0.0 0.0 0.0 0.0 104-105 0.825 0.0 0.0 0.0 0.0 106-107 1.0 0.0 0.0 0.0 0.0 108-109 1.2625000000000002 0.0 0.0 0.0 0.0 110-111 1.525 0.0 0.0 0.0 0.0 112-113 1.6125 0.0 0.0 0.0 0.0 114-115 1.775 0.0 0.0 0.0 0.0 116-117 2.0125 0.0 0.0 0.0 0.0 118-119 2.2625 0.0 0.0 0.0 0.0 120-121 2.425 0.0 0.0 0.0 0.0 122-123 2.7625 0.0 0.0 0.0 0.0 124-125 3.1375 0.0 0.0 0.0 0.0 126-127 3.5625 0.0 0.0 0.0 0.0 128-129 3.9875 0.0 0.0 0.0 0.0 130-131 4.4375 0.0 0.0 0.0 0.0 132-133 4.9125 0.0 0.0 0.0 0.0 134-135 5.25 0.0 0.0 0.0 0.0 136-137 5.5875 0.0 0.0 0.0 0.0 138-139 6.112500000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCAGCCT 10 0.00687326 144.7 2 CAAGGGT 25 8.78529E-4 86.82 8 >>END_MODULE Read 976750 spots for SRR7180080.sra Written 976750 spots for SRR7180080.sra Read 976750 spots for SRR7180080.sra Written 976750 spots for SRR7180080.sra Read 976750 spots for SRR7180080.sra Written 976750 spots for SRR7180080.sra Read 976750 spots for SRR7180080.sra Written 976750 spots for SRR7180080.sra Read 976750 spots for SRR7180080.sra Written 976750 spots for SRR7180080.sra Read 976750 spots for SRR7180080.sra Written 976750 spots for SRR7180080.sra Read 976750 spots for SRR7180080.sra Written 976750 spots for SRR7180080.sra Read 976750 spots for SRR7180080.sra Written 976750 spots for SRR7180080.sra Read 976750 spots for SRR7180080.sra Written 976750 spots for SRR7180080.sra Read 976750 spots for SRR7180080.sra Written 976750 spots for SRR7180080.sra Read 976750 spots for SRR7180080.sra Written 976750 spots for SRR7180080.sra Read 976750 spots for SRR7180080.sra Written 976750 spots for SRR7180080.sra Read 976750 spots for SRR7180080.sra Written 976750 spots for SRR7180080.sra Read 976762 spots for SRR7180080.sra Written 976762 spots for SRR7180080.sra Read 976750 spots for SRR7180080.sra Written 976750 spots for SRR7180080.sra Read 976750 spots for SRR7180080.sra Written 976750 spots for SRR7180080.sra Read 976750 spots for SRR7180080.sra Written 976750 spots for SRR7180080.sra Read 976750 spots for SRR7180080.sra Written 976750 spots for SRR7180080.sra Read 976750 spots for SRR7180080.sra Written 976750 spots for SRR7180080.sra Read 976750 spots for SRR7180080.sra Written 976750 spots for SRR7180080.sra SRR ids: ['SRR7180080.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_0lt63gyr SRR7180080.sra spots: 19535012 blocks: [[1, 976750], [976751, 1953500], [1953501, 2930250], [2930251, 3907000], [3907001, 4883750], [4883751, 5860500], [5860501, 6837250], [6837251, 7814000], [7814001, 8790750], [8790751, 9767500], [9767501, 10744250], [10744251, 11721000], [11721001, 12697750], [12697751, 13674500], [13674501, 14651250], [14651251, 15628000], [15628001, 16604750], [16604751, 17581500], [17581501, 18558250], [18558251, 19535012]] SRR7180080 file size 6598074 SRR7180080 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7180080 SRR7180080_1.fastq SRR7180080_2.fastq Input file: SRR7180080_1.fastq Paired file: SRR7180080_2.fastq trimmed: SRR7180080-trimmed-pair1.fastq, SRR7180080-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 17:49:09 2025 >> started Mon Feb 10 17:49:30 2025 >> done (21.195s) 19535012 read pairs processed; of these: 35390 ( 0.18%) short read pairs filtered out after trimming by size control 29176 ( 0.15%) empty read pairs filtered out after trimming by size control 19470446 (99.67%) read pairs available; of these: 7874004 (40.44%) trimmed read pairs available after processing 11596442 (59.56%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 5 0.00% 20 6 0.00% 21 7 0.00% 22 4 0.00% 23 5 0.00% 24 12 0.00% 25 3 0.00% 26 14 0.00% 27 8 0.00% 28 12 0.00% 29 4 0.00% 30 7 0.00% 31 9 0.00% 32 9 0.00% 33 7 0.00% 34 7 0.00% 35 2 0.00% 36 14 0.00% 37 31 0.00% 38 8 0.00% 39 10 0.00% 40 37 0.00% 41 38 0.00% 42 14 0.00% 43 11 0.00% 44 33 0.00% 45 91 0.00% 46 72 0.00% 47 26 0.00% 48 32 0.00% 49 76 0.00% 50 142 0.00% 51 95 0.00% 52 64 0.00% 53 48 0.00% 54 119 0.00% 55 172 0.00% 56 40 0.00% 57 60 0.00% 58 78 0.00% 59 220 0.00% 60 116 0.00% 61 93 0.00% 62 124 0.00% 63 133 0.00% 64 159 0.00% 65 169 0.00% 66 195 0.00% 67 209 0.00% 68 251 0.00% 69 334 0.00% 70 326 0.00% 71 386 0.00% 72 462 0.00% 73 487 0.00% 74 568 0.00% 75 668 0.00% 76 783 0.00% 77 928 0.00% 78 1105 0.01% 79 1098 0.01% 80 1219 0.01% 81 1472 0.01% 82 1691 0.01% 83 2108 0.01% 84 3621 0.02% 85 4859 0.02% 86 5147 0.03% 87 5578 0.03% 88 5896 0.03% 89 6169 0.03% 90 6494 0.03% 91 6710 0.03% 92 7309 0.04% 93 7502 0.04% 94 7984 0.04% 95 8577 0.04% 96 9085 0.05% 97 9980 0.05% 98 10386 0.05% 99 11213 0.06% 100 11896 0.06% 101 12763 0.07% 102 13483 0.07% 103 14506 0.07% 104 15327 0.08% 105 16328 0.08% 106 17528 0.09% 107 18751 0.10% 108 19952 0.10% 109 21039 0.11% 110 22143 0.11% 111 23633 0.12% 112 24861 0.13% 113 26000 0.13% 114 27376 0.14% 115 29040 0.15% 116 30669 0.16% 117 32237 0.17% 118 33669 0.17% 119 35787 0.18% 120 37020 0.19% 121 39788 0.20% 122 41067 0.21% 123 42335 0.22% 124 44334 0.23% 125 45185 0.23% 126 47563 0.24% 127 49417 0.25% 128 51694 0.27% 129 53255 0.27% 130 56151 0.29% 131 58870 0.30% 132 61257 0.31% 133 64564 0.33% 134 67962 0.35% 135 71104 0.37% 136 74604 0.38% 137 77672 0.40% 138 82309 0.42% 139 87101 0.45% 140 92442 0.47% 141 100193 0.51% 142 108698 0.56% 143 120634 0.62% 144 136723 0.70% 145 158146 0.81% 146 192485 0.99% 147 248414 1.28% 148 370726 1.90% 149 706667 3.63% 150 3905387 20.06% 151 11596442 59.56% 19470446 reads passed initial QC criterion=sequence-density sequence-density=0.52 sequence-density-rank=1 fanout-score=3.06 fanout-score-rank=23 prefix-density=0.76 prefix-fanout=2.1 sequence=CACTTGCAGCCATTCTCAGCACCA criterion=fanout-score sequence-density=0.01 sequence-density-rank=29 fanout-score=172.34 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=8.2 sequence=AGCAACACTACCATTTTAATTATACATGAAAGATAAACAGGACGACAAGCAGCTAACACGACTTGAGACTTGATACTTGATACTAGAGAGGAAGCCCCAGAGCTGCAAATCCAAGAAGATTTGCAGAAAACAAGCCATGAATATATACTAGCTACTTTATTGAAACTTGTTGAAGACAAGAGACAACCCTTATAAACGCCTAGTAGATGAAATATTATTTCTTGTCAATCCGTCGATGCGATGATCATTTCTTGAATCAACGCAGCCAGCGGATCGCTCTCATTTACAAGTGCAAGGATCGCAGGTACAGCTGGCTCCACACTTGC criterion=sequence-density sequence-density=0.67 sequence-density-rank=1 fanout-score=2.86 fanout-score-rank=20 prefix-density=0.68 prefix-fanout=2.8 sequence=ATGTACCCTGACTTAGGTTTCTCAGA criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=273.99 fanout-score-rank=1 prefix-density=0.19 prefix-fanout=12.4 sequence=TTTCTTTGAGAGTGCATAGATTTGTGTTGATATAGAAAACAATGGCACTACATGGAAAGATTGAGACAACATTAGAACTCAAGTCCTCCGCAGAGAAGTTCTACAAAGTGTGGAGGAGCCAGTCCTTCCATGTTCCCAAACATGCTTCCAAGCATATCCAAGGAGTTGATATACATGCAGGTGACTGGGAGACTGCGGGCTCTATCAGGATTTGGCAGTACACAATCGGAGGGAAAGCCGGGGTCTTTAAAGAGGAGGTTTCCTTCGATGATGAGAACAAGATCATAACTCTTAATGGTTTGGAAGGAGATGTCATGAAAATTTACAAGGTCTATAGGCCCGTCTGGCAGCTTACACCAAAAGGCTCGGGCTGCTTGGCAAAACTGACCATTGAATACGAAAAACTCCATCCTGAAGTCCCGGTTCCAGAGATTTATGTTGATCTTATGGTTCATATGACTAAAGACATCGACGAAGCCCTTAGCACGGAGTAATAGAAGGGGTCATCGAT SRR7180080 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 17:50:17 Started mapping on | Feb 10 17:50:20 Finished on | Feb 10 17:52:33 Mapping speed, Million of reads per hour | 527.02 Number of input reads | 19470446 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 18029325 Uniquely mapped reads % | 92.60% Average mapped length | 294.70 Number of splices: Total | 18294405 Number of splices: Annotated (sjdb) | 17926318 Number of splices: GT/AG | 18004650 Number of splices: GC/AG | 229875 Number of splices: AT/AC | 14336 Number of splices: Non-canonical | 45544 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.65 Insertion rate per base | 0.02% Insertion average length | 2.56 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 452111 % of reads mapped to multiple loci | 2.32% Number of reads mapped to too many loci | 37260 % of reads mapped to too many loci | 0.19% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.82% % of reads unmapped: other | 0.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1021992 1021992 1021992 N_multimapping 452111 452111 452111 N_noFeature 452412 17867306 523804 N_ambiguous 183315 688 92421 UnstrandedReadsAssigned:17393598 PositiveStrandReadsAssigned:161331 NegativeStrandReadsAssigned:17413100 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7180080 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7180080-trimmed-pair1.fastq SRR7180080-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,470,446 reads, 17,299,225 reads pseudoaligned [quant] estimated average fragment length: 235.449 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,115 rounds 52401 SRR7180080.ke.tsv 34699 SRR7180080.se.tsv 87100 total ==> SRR7180080.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1783.55 1936 58.2362 Potri.005G024800.1.v4.1 1035 800.551 886 59.377 Potri.004G059700.1.v4.1 961 726.566 7 0.516888 Potri.007G009000.2.v4.1 1416 1181.55 0 0 Potri.003G141000.2.v4.1 2943 2708.55 893 17.6884 Potri.016G087400.1.v4.1 270 80.4128 1513 1009.45 Potri.015G069301.1.v4.1 564 332.908 0 0 Potri.010G195200.1.v4.1 1773 1538.55 679 23.6773 Potri.012G127500.1.v4.1 977 742.561 10370 749.238 ==> SRR7180080.se.tsv <== Potri.001G166300.v4.1 1 Potri.001G448400.v4.1 17 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 407 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 3 Potri.001G452600.v4.1 258 SRR7180080 completed mapping pipeline successfully