Starting /dee2/code/volunteer_pipeline.sh SRR7180081 current disk space = 3058152341504 free memory = 1413200164 SRR7180081 SRAfilesize f08e770b9891fc2212ff592a4fc4475c SRR7180081.sra SRR7180081.sra file validated SRR7180081 is paired end SRR7180081 is conventional basespace SRR7180081 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7180081_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 27.63025 32.0 18.0 33.0 18.0 33.0 2 29.5395 32.0 27.0 33.0 18.0 34.0 3 29.8235 31.0 29.0 33.0 25.0 33.0 4 31.9085 33.0 32.0 33.0 31.0 33.0 5 32.58025 33.0 33.0 33.0 32.0 34.0 6 36.902 38.0 37.0 38.0 35.0 38.0 7 37.5245 38.0 38.0 38.0 37.0 38.0 8 37.58275 38.0 38.0 38.0 38.0 38.0 9 37.60725 38.0 38.0 38.0 38.0 38.0 10-14 37.641149999999996 38.0 38.0 38.0 38.0 38.0 15-19 37.6541 38.0 38.0 38.0 38.0 38.0 20-24 37.59095000000001 38.0 38.0 38.0 38.0 38.0 25-29 37.6052 38.0 38.0 38.0 38.0 38.0 30-34 37.5592 38.0 38.0 38.0 38.0 38.0 35-39 37.54585 38.0 38.0 38.0 38.0 38.0 40-44 37.52875 38.0 38.0 38.0 38.0 38.0 45-49 37.4944 38.0 38.0 38.0 38.0 38.0 50-54 37.44615 38.0 38.0 38.0 37.4 38.0 55-59 37.317449999999994 38.0 38.0 38.0 37.0 38.0 60-64 37.32285 38.0 38.0 38.0 37.0 38.0 65-69 36.811 38.0 38.0 38.0 36.4 38.0 70-74 36.8161 38.0 38.0 38.0 36.2 38.0 75-79 37.055400000000006 38.0 38.0 38.0 36.0 38.0 80-84 37.1254 38.0 38.0 38.0 36.0 38.0 85-89 37.08225 38.0 38.0 38.0 36.0 38.0 90-94 36.86025 38.0 38.0 38.0 35.2 38.0 95-99 36.77905 38.0 38.0 38.0 35.0 38.0 100-104 36.53535 38.0 38.0 38.0 34.2 38.0 105-109 36.56795000000001 38.0 38.0 38.0 34.0 38.0 110-114 36.27645 38.0 37.6 38.0 33.8 38.0 115-119 36.1664 38.0 37.2 38.0 33.6 38.0 120-124 35.91905 38.0 37.0 38.0 32.8 38.0 125-129 35.7228 38.0 36.4 38.0 31.8 38.0 130-134 35.41025 38.0 36.0 38.0 30.6 38.0 135-139 35.09519999999999 38.0 35.4 38.0 28.8 38.0 140-144 34.7073 38.0 34.6 38.0 27.6 38.0 145-149 33.3715 38.0 34.0 38.0 19.6 38.0 150-151 28.547125 35.0 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 0.0 10 1.0 11 0.0 12 2.0 13 0.0 14 0.0 15 1.0 16 0.0 17 0.0 18 2.0 19 1.0 20 4.0 21 5.0 22 2.0 23 7.0 24 4.0 25 7.0 26 8.0 27 12.0 28 28.0 29 35.0 30 39.0 31 36.0 32 79.0 33 93.0 34 141.0 35 317.0 36 841.0 37 2334.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.354354354354356 16.466466466466468 13.338338338338337 40.84084084084084 2 18.95 20.325 35.525 25.2 3 18.9 24.224999999999998 25.5 31.374999999999996 4 23.275000000000002 29.725 22.95 24.05 5 21.375 32.550000000000004 25.874999999999996 20.200000000000003 6 17.9 34.725 26.75 20.625 7 14.2 22.6 44.625 18.575 8 16.900000000000002 22.95 31.25 28.9 9 18.224999999999998 24.474999999999998 32.800000000000004 24.5 10-14 19.634999999999998 29.04 27.250000000000004 24.075 15-19 19.77 28.585 27.755000000000003 23.89 20-24 19.55282112845138 28.98159263705482 27.876150460184075 23.589435774309724 25-29 19.46 28.345 28.449999999999996 23.745 30-34 20.085 28.425 27.794999999999998 23.695 35-39 20.29 28.275 28.07 23.365 40-44 19.75 28.860000000000003 27.63 23.76 45-49 19.81 28.055000000000003 27.96 24.175 50-54 19.985 28.1 27.560000000000002 24.355 55-59 19.49 27.93 28.16 24.42 60-64 20.75953167217052 27.619333533473434 27.929550685479835 23.691584108876214 65-69 20.457310890285946 28.13323869397688 27.600892313932263 23.80855810180491 70-74 20.14959316723101 27.952696214686412 27.84656592712387 24.051144690958708 75-79 20.68 27.905 27.315 24.099999999999998 80-84 19.955000000000002 28.410000000000004 27.389999999999997 24.245 85-89 20.119999999999997 27.700000000000003 27.91 24.27 90-94 20.185 27.845 27.810000000000002 24.16 95-99 20.424999999999997 27.57 27.884999999999998 24.12 100-104 19.909977494373592 28.142035508877218 27.551887971993 24.39609902475619 105-109 20.095 28.095 27.62 24.19 110-114 20.54924716122255 28.592866790055528 26.972137461857837 23.88574858686409 115-119 20.815 27.805000000000003 27.339999999999996 24.04 120-124 21.154999999999998 27.915 26.755000000000003 24.175 125-129 21.11 28.285 26.540000000000003 24.065 130-134 20.925 27.884999999999998 27.065 24.125 135-139 21.255 27.860000000000003 27.16 23.724999999999998 140-144 21.185000000000002 27.095000000000002 27.744999999999997 23.974999999999998 145-149 21.709999999999997 27.744999999999997 26.305 24.240000000000002 150-151 21.775 28.025 26.4625 23.7375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 1.5 20 3.5 21 2.5 22 3.0 23 4.0 24 3.0 25 3.0 26 4.5 27 7.0 28 8.0 29 16.0 30 27.5 31 33.5 32 35.0 33 42.0 34 52.0 35 67.5 36 88.0 37 101.0 38 116.5 39 149.5 40 197.0 41 217.5 42 224.5 43 253.0 44 276.5 45 273.0 46 260.0 47 263.5 48 237.0 49 189.0 50 175.5 51 141.5 52 110.0 53 97.0 54 77.0 55 60.0 56 39.5 57 27.5 58 26.0 59 22.5 60 15.0 61 11.0 62 8.5 63 7.5 64 6.5 65 4.5 66 1.5 67 1.0 68 1.5 69 1.0 70 0.5 71 1.5 72 1.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.1 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.04 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.06999999999999999 65-69 1.38 70-74 1.065 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.025 105-109 0.0 110-114 0.045 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57318604067285 99.15 2 0.42681395932714034 0.8500000000000001 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0125 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.037500000000000006 0.0 0.0 0.0 0.0 86-87 0.0625 0.0 0.0 0.0 0.0 88-89 0.0875 0.0 0.0 0.0 0.0 90-91 0.1125 0.0 0.0 0.0 0.0 92-93 0.16249999999999998 0.0 0.0 0.0 0.0 94-95 0.3 0.0 0.0 0.0 0.0 96-97 0.4375 0.0 0.0 0.0 0.0 98-99 0.5 0.0 0.0 0.0 0.0 100-101 0.6 0.0 0.0 0.0 0.0 102-103 0.7375 0.0 0.0 0.0 0.0 104-105 0.85 0.0 0.0 0.0 0.0 106-107 0.95 0.0 0.0 0.0 0.0 108-109 1.1749999999999998 0.0 0.0 0.0 0.0 110-111 1.2875 0.0 0.0 0.0 0.0 112-113 1.4125 0.0 0.0 0.0 0.0 114-115 1.6625 0.0 0.0 0.0 0.0 116-117 1.8625 0.0 0.0 0.0 0.0 118-119 2.1375 0.0 0.0 0.0 0.0 120-121 2.475 0.0 0.0 0.0 0.0 122-123 2.95 0.0 0.0 0.0 0.0 124-125 3.3875 0.0 0.0 0.0 0.0 126-127 3.775 0.0 0.0 0.0 0.0 128-129 4.15 0.0 0.0 0.0 0.0 130-131 4.6875 0.0 0.0 0.0 0.0 132-133 5.15 0.0 0.0 0.0 0.0 134-135 5.550000000000001 0.0 0.0 0.0 0.0 136-137 6.362500000000001 0.0 0.0 0.0 0.0 138-139 6.925000000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAAAAAA 60 2.0807495E-4 17.110126 60-64 >>END_MODULE SRR7180081 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7180081_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.75675 34.0 33.0 34.0 32.0 34.0 2 32.8565 34.0 33.0 34.0 33.0 34.0 3 32.87075 34.0 33.0 34.0 33.0 34.0 4 32.8125 34.0 33.0 34.0 33.0 34.0 5 32.883 34.0 33.0 34.0 33.0 34.0 6 36.98 38.0 38.0 38.0 37.0 38.0 7 36.9355 38.0 38.0 38.0 38.0 38.0 8 36.968 38.0 38.0 38.0 38.0 38.0 9 36.8055 38.0 38.0 38.0 37.0 38.0 10-14 36.83255 38.0 38.0 38.0 37.0 38.0 15-19 37.1728 38.0 38.0 38.0 37.2 38.0 20-24 37.1728 38.0 38.0 38.0 37.6 38.0 25-29 37.25175 38.0 38.0 38.0 37.8 38.0 30-34 37.230399999999996 38.0 38.0 38.0 37.8 38.0 35-39 37.16805000000001 38.0 38.0 38.0 37.2 38.0 40-44 37.109849999999994 38.0 38.0 38.0 37.0 38.0 45-49 37.16245 38.0 38.0 38.0 37.2 38.0 50-54 37.067449999999994 38.0 38.0 38.0 37.0 38.0 55-59 37.077200000000005 38.0 38.0 38.0 37.0 38.0 60-64 36.95804999999999 38.0 38.0 38.0 36.4 38.0 65-69 36.88605 38.0 38.0 38.0 35.8 38.0 70-74 36.90205 38.0 38.0 38.0 36.0 38.0 75-79 36.8703 38.0 38.0 38.0 36.0 38.0 80-84 36.7274 38.0 38.0 38.0 36.0 38.0 85-89 36.64014999999999 38.0 38.0 38.0 35.6 38.0 90-94 36.561099999999996 38.0 38.0 38.0 35.0 38.0 95-99 36.4179 38.0 38.0 38.0 34.2 38.0 100-104 36.29045 38.0 38.0 38.0 34.0 38.0 105-109 36.25265 38.0 38.0 38.0 34.0 38.0 110-114 35.9856 38.0 37.8 38.0 33.2 38.0 115-119 35.77935 38.0 37.2 38.0 32.2 38.0 120-124 35.60770000000001 38.0 37.0 38.0 31.8 38.0 125-129 35.35809999999999 38.0 36.0 38.0 31.0 38.0 130-134 35.10645 38.0 36.2 38.0 29.2 38.0 135-139 34.5304 38.0 35.2 38.0 27.2 38.0 140-144 34.0594 38.0 33.8 38.0 23.8 38.0 145-149 33.27835 38.0 33.0 38.0 17.6 38.0 150-151 28.24525 35.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 10.0 3 1.0 4 4.0 5 0.0 6 1.0 7 1.0 8 0.0 9 2.0 10 1.0 11 1.0 12 3.0 13 1.0 14 4.0 15 4.0 16 2.0 17 1.0 18 4.0 19 5.0 20 5.0 21 9.0 22 14.0 23 9.0 24 9.0 25 17.0 26 10.0 27 22.0 28 26.0 29 38.0 30 34.0 31 43.0 32 71.0 33 103.0 34 153.0 35 223.0 36 590.0 37 2579.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.07217016966321 15.01645986325652 19.01747277791846 30.893897189161812 2 24.570273003033368 21.840242669362993 36.349848331648126 17.23963599595551 3 22.11271165024008 25.67601718473591 29.946929492039427 22.264341672984582 4 24.393326592517695 33.54398382204246 21.840242669362993 20.222446916076844 5 24.949443882709808 35.9201213346815 22.37108190091001 16.759352881698685 6 21.170830179157203 36.714610143830434 23.2147363108756 18.899823366136765 7 18.923698837796866 17.887822132390095 42.344618494188985 20.843860535624053 8 21.809451604751075 22.517058377558758 28.91079100328532 26.762699014404852 9 22.56917999492257 24.21934501142422 27.92586951002793 25.285605483625282 10-14 23.35965978128797 28.0224787363305 26.65046577561766 21.967395706763874 15-19 23.680920230057513 27.811952988247064 27.286821705426355 21.220305076269067 20-24 23.61 28.29 27.250000000000004 20.849999999999998 25-29 23.86 28.155 27.060000000000002 20.925 30-34 23.785 27.68 27.675 20.86 35-39 23.955000000000002 28.29 26.855 20.9 40-44 24.05 27.779999999999998 27.529999999999998 20.64 45-49 23.849999999999998 27.705000000000002 27.77 20.674999999999997 50-54 23.575 27.685 27.49 21.25 55-59 24.03 27.735 27.779999999999998 20.455000000000002 60-64 23.64 28.335 27.51 20.515 65-69 23.935000000000002 28.13 27.18 20.755000000000003 70-74 23.56 27.825 27.805000000000003 20.810000000000002 75-79 23.628544281642245 27.69415412311847 28.019202880432065 20.65809871480722 80-84 23.981379517469218 28.170988086895587 27.415156672339574 20.432475723295624 85-89 23.709483793517407 27.956182472989195 27.73609443777511 20.598239295718287 90-94 24.13 27.800000000000004 27.735 20.335 95-99 24.09 27.49 27.58 20.84 100-104 23.815 28.549999999999997 27.169999999999998 20.465 105-109 23.76 28.244999999999997 27.62 20.375 110-114 24.415 27.935 27.705000000000002 19.945 115-119 24.224999999999998 28.360000000000003 26.995 20.419999999999998 120-124 24.465 27.965 27.47 20.1 125-129 24.435000000000002 28.115000000000002 27.355 20.095 130-134 24.95 28.325 26.63 20.095 135-139 25.055 28.49 27.029999999999998 19.425 140-144 25.22 28.249999999999996 26.655 19.875 145-149 25.91 27.505000000000003 26.905 19.68 150-151 25.4625 27.5875 26.875 20.075000000000003 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.5 16 0.5 17 0.0 18 0.0 19 1.0 20 1.0 21 0.5 22 1.0 23 1.5 24 2.5 25 2.0 26 1.5 27 6.0 28 7.5 29 8.5 30 16.0 31 18.5 32 18.5 33 31.0 34 40.5 35 52.0 36 67.5 37 86.0 38 113.5 39 149.5 40 182.0 41 210.0 42 245.5 43 270.5 44 277.0 45 277.0 46 285.0 47 276.5 48 241.5 49 224.0 50 198.0 51 155.5 52 127.5 53 98.0 54 74.0 55 53.0 56 41.0 57 33.5 58 22.0 59 20.0 60 18.5 61 12.5 62 7.0 63 4.5 64 4.5 65 2.0 66 2.5 67 3.0 68 1.5 69 1.5 70 1.5 71 0.5 72 0.0 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.275 2 1.0999999999999999 3 1.075 4 1.0999999999999999 5 1.0999999999999999 6 0.9249999999999999 7 1.05 8 1.075 9 1.525 10-14 1.24 15-19 0.025 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.015 80-84 0.11 85-89 0.04 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.47500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.52249308871576 99.0 2 0.42724302588590096 0.8500000000000001 3 0.050263885398341285 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0125 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.037500000000000006 0.0 0.0 0.0 0.0 86-87 0.0625 0.0 0.0 0.0 0.0 88-89 0.0875 0.0 0.0 0.0 0.0 90-91 0.1125 0.0 0.0 0.0 0.0 92-93 0.16249999999999998 0.0 0.0 0.0 0.0 94-95 0.3 0.0 0.0 0.0 0.0 96-97 0.4375 0.0 0.0 0.0 0.0 98-99 0.5 0.0 0.0 0.0 0.0 100-101 0.6 0.0 0.0 0.0 0.0 102-103 0.7375 0.0 0.0 0.0 0.0 104-105 0.85 0.0 0.0 0.0 0.0 106-107 0.95 0.0 0.0 0.0 0.0 108-109 1.2000000000000002 0.0 0.0 0.0 0.0 110-111 1.3125 0.0 0.0 0.0 0.0 112-113 1.4500000000000002 0.0 0.0 0.0 0.0 114-115 1.6875 0.0 0.0 0.0 0.0 116-117 1.875 0.0 0.0 0.0 0.0 118-119 2.1375 0.0 0.0 0.0 0.0 120-121 2.4875 0.0 0.0 0.0 0.0 122-123 2.9875 0.0 0.0 0.0 0.0 124-125 3.4375 0.0 0.0 0.0 0.0 126-127 3.8375000000000004 0.0 0.0 0.0 0.0 128-129 4.2 0.0 0.0 0.0 0.0 130-131 4.7125 0.0 0.0 0.0 0.0 132-133 5.1625 0.0 0.0 0.0 0.0 134-135 5.550000000000001 0.0 0.0 0.0 0.0 136-137 6.375 0.0 0.0 0.0 0.0 138-139 6.975 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGACATG 10 0.0065959026 146.68355 4 >>END_MODULE Read 720666 spots for SRR7180081.sra Written 720666 spots for SRR7180081.sra Read 720666 spots for SRR7180081.sra Written 720666 spots for SRR7180081.sra Read 720666 spots for SRR7180081.sra Written 720666 spots for SRR7180081.sra Read 720666 spots for SRR7180081.sra Written 720666 spots for SRR7180081.sra Read 720666 spots for SRR7180081.sra Written 720666 spots for SRR7180081.sra Read 720666 spots for SRR7180081.sra Written 720666 spots for SRR7180081.sra Read 720666 spots for SRR7180081.sra Written 720666 spots for SRR7180081.sra Read 720666 spots for SRR7180081.sra Written 720666 spots for SRR7180081.sra Read 720666 spots for SRR7180081.sra Written 720666 spots for SRR7180081.sra Read 720666 spots for SRR7180081.sra Written 720666 spots for SRR7180081.sra Read 720666 spots for SRR7180081.sra Written 720666 spots for SRR7180081.sra Read 720666 spots for SRR7180081.sra Written 720666 spots for SRR7180081.sra Read 720666 spots for SRR7180081.sra Written 720666 spots for SRR7180081.sra Read 720666 spots for SRR7180081.sra Written 720666 spots for SRR7180081.sra Read 720666 spots for SRR7180081.sra Written 720666 spots for SRR7180081.sra Read 720666 spots for SRR7180081.sra Written 720666 spots for SRR7180081.sra Read 720672 spots for SRR7180081.sra Written 720672 spots for SRR7180081.sra Read 720666 spots for SRR7180081.sra Written 720666 spots for SRR7180081.sra Read 720666 spots for SRR7180081.sra Written 720666 spots for SRR7180081.sra Read 720666 spots for SRR7180081.sra Written 720666 spots for SRR7180081.sra SRR ids: ['SRR7180081.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_svhnkk5z SRR7180081.sra spots: 14413326 blocks: [[1, 720666], [720667, 1441332], [1441333, 2161998], [2161999, 2882664], [2882665, 3603330], [3603331, 4323996], [4323997, 5044662], [5044663, 5765328], [5765329, 6485994], [6485995, 7206660], [7206661, 7927326], [7927327, 8647992], [8647993, 9368658], [9368659, 10089324], [10089325, 10809990], [10809991, 11530656], [11530657, 12251322], [12251323, 12971988], [12971989, 13692654], [13692655, 14413326]] SRR7180081 file size 4862502 SRR7180081 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7180081 SRR7180081_1.fastq SRR7180081_2.fastq Input file: SRR7180081_1.fastq Paired file: SRR7180081_2.fastq trimmed: SRR7180081-trimmed-pair1.fastq, SRR7180081-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 17:21:15 2025 >> started Mon Feb 10 17:21:43 2025 >> done (27.981s) 14413326 read pairs processed; of these: 17414 ( 0.12%) short read pairs filtered out after trimming by size control 12708 ( 0.09%) empty read pairs filtered out after trimming by size control 14383204 (99.79%) read pairs available; of these: 7341218 (51.04%) trimmed read pairs available after processing 7041986 (48.96%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 2 0.00% 20 5 0.00% 21 4 0.00% 22 3 0.00% 23 7 0.00% 24 6 0.00% 25 4 0.00% 26 4 0.00% 27 5 0.00% 28 8 0.00% 29 8 0.00% 30 5 0.00% 31 3 0.00% 32 1 0.00% 33 2 0.00% 34 6 0.00% 35 4 0.00% 36 4 0.00% 37 4 0.00% 38 6 0.00% 39 5 0.00% 40 7 0.00% 41 3 0.00% 42 0 0.00% 43 10 0.00% 44 13 0.00% 45 10 0.00% 46 18 0.00% 47 16 0.00% 48 19 0.00% 49 20 0.00% 50 24 0.00% 51 31 0.00% 52 25 0.00% 53 35 0.00% 54 45 0.00% 55 53 0.00% 56 40 0.00% 57 43 0.00% 58 70 0.00% 59 66 0.00% 60 72 0.00% 61 84 0.00% 62 95 0.00% 63 123 0.00% 64 125 0.00% 65 163 0.00% 66 186 0.00% 67 210 0.00% 68 257 0.00% 69 272 0.00% 70 290 0.00% 71 347 0.00% 72 431 0.00% 73 474 0.00% 74 517 0.00% 75 609 0.00% 76 733 0.01% 77 815 0.01% 78 891 0.01% 79 1100 0.01% 80 1186 0.01% 81 1491 0.01% 82 1645 0.01% 83 1947 0.01% 84 2967 0.02% 85 3576 0.02% 86 3890 0.03% 87 4449 0.03% 88 4479 0.03% 89 4798 0.03% 90 5055 0.04% 91 5348 0.04% 92 5768 0.04% 93 6332 0.04% 94 6880 0.05% 95 7247 0.05% 96 7999 0.06% 97 8390 0.06% 98 9050 0.06% 99 9724 0.07% 100 10339 0.07% 101 11024 0.08% 102 11876 0.08% 103 12610 0.09% 104 13463 0.09% 105 14448 0.10% 106 15440 0.11% 107 16579 0.12% 108 17594 0.12% 109 18335 0.13% 110 19537 0.14% 111 20403 0.14% 112 21414 0.15% 113 22536 0.16% 114 23687 0.16% 115 25011 0.17% 116 26310 0.18% 117 27507 0.19% 118 28635 0.20% 119 30188 0.21% 120 31293 0.22% 121 32750 0.23% 122 34110 0.24% 123 35588 0.25% 124 37395 0.26% 125 38500 0.27% 126 40093 0.28% 127 42089 0.29% 128 44051 0.31% 129 46407 0.32% 130 48487 0.34% 131 50403 0.35% 132 53110 0.37% 133 55311 0.38% 134 58197 0.40% 135 60709 0.42% 136 64048 0.45% 137 67531 0.47% 138 71896 0.50% 139 76785 0.53% 140 83571 0.58% 141 89302 0.62% 142 98689 0.69% 143 109865 0.76% 144 125730 0.87% 145 147668 1.03% 146 186376 1.30% 147 276286 1.92% 148 417561 2.90% 149 725883 5.05% 150 3593937 24.99% 151 7041986 48.96% 14383204 reads passed initial QC criterion=sequence-density sequence-density=0.42 sequence-density-rank=1 fanout-score=3.63 fanout-score-rank=25 prefix-density=0.67 prefix-fanout=2.3 sequence=CACTTGCAGCCATTCTCAGCACC criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=210.91 fanout-score-rank=1 prefix-density=0.17 prefix-fanout=11.2 sequence=CATTTTCATTAATAATCATCAACTCCACATAGTTCAAGTTTCCAAGCATACATGAAAACACCTTGAAAGTTGAAGCAGCCAACAAAGCAGTGACGCGTACACAAGACAAAGGATTTATAGGAACCCTTTGCTGTTTATTATTATTTAACAA criterion=sequence-density sequence-density=0.55 sequence-density-rank=1 fanout-score=2.76 fanout-score-rank=26 prefix-density=0.56 prefix-fanout=2.7 sequence=ATGTACCCTGACTTAGGTTTCTCAGA criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=17.68 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=2.4 sequence=AGCTAGCTGGAAACAATCCTATAAGGTGAAAAGGAGAAGAAATGGCATCTATCTGTCAAGGTAAGAGTTCATGGCC SRR7180081 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 17:22:50 Started mapping on | Feb 10 17:22:50 Finished on | Feb 10 17:26:35 Mapping speed, Million of reads per hour | 230.13 Number of input reads | 14383204 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 13019116 Uniquely mapped reads % | 90.52% Average mapped length | 293.84 Number of splices: Total | 12109068 Number of splices: Annotated (sjdb) | 11851454 Number of splices: GT/AG | 11913747 Number of splices: GC/AG | 148350 Number of splices: AT/AC | 8870 Number of splices: Non-canonical | 38101 Mismatch rate per base, % | 0.43% Deletion rate per base | 0.03% Deletion average length | 2.70 Insertion rate per base | 0.02% Insertion average length | 2.53 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 357197 % of reads mapped to multiple loci | 2.48% Number of reads mapped to too many loci | 36533 % of reads mapped to too many loci | 0.25% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.65% % of reads unmapped: other | 0.09% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1021837 1021837 1021837 N_multimapping 357197 357197 357197 N_noFeature 344612 12889307 395232 N_ambiguous 145127 700 65510 UnstrandedReadsAssigned:12529377 PositiveStrandReadsAssigned:129109 NegativeStrandReadsAssigned:12558374 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7180081 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7180081-trimmed-pair1.fastq SRR7180081-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,383,204 reads, 12,487,702 reads pseudoaligned [quant] estimated average fragment length: 225.594 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,154 rounds 52401 SRR7180081.ke.tsv 34699 SRR7180081.se.tsv 87100 total ==> SRR7180081.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1793.41 1683 70.4849 Potri.005G024800.1.v4.1 1035 810.406 2440 226.14 Potri.004G059700.1.v4.1 961 736.411 5 0.509965 Potri.007G009000.2.v4.1 1416 1191.41 0 0 Potri.003G141000.2.v4.1 2943 2718.41 742 20.5012 Potri.016G087400.1.v4.1 270 82.0377 1026 939.343 Potri.015G069301.1.v4.1 564 341.239 0 0 Potri.010G195200.1.v4.1 1773 1548.41 1054.8 51.1652 Potri.012G127500.1.v4.1 977 752.411 2699 269.425 ==> SRR7180081.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 0 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 541 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 230 SRR7180081 completed mapping pipeline successfully