Starting /dee2/code/volunteer_pipeline.sh SRR7180082 current disk space = 3058012332032 free memory = 1443853936 SRR7180082 SRAfilesize 8194d3680a735f0e5a52aae213b4f75b SRR7180082.sra SRR7180082.sra file validated SRR7180082 is paired end SRR7180082 is conventional basespace SRR7180082 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7180082_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 22.986 18.0 18.0 33.0 18.0 33.0 2 27.33575 28.0 25.0 33.0 18.0 33.0 3 29.79475 31.0 29.0 33.0 27.0 33.0 4 31.13325 33.0 31.0 33.0 29.0 33.0 5 31.89825 33.0 32.0 33.0 31.0 33.0 6 36.33175 38.0 36.0 38.0 34.0 38.0 7 36.30525 38.0 36.0 38.0 33.0 38.0 8 36.94225 38.0 37.0 38.0 35.0 38.0 9 37.32825 38.0 38.0 38.0 36.0 38.0 10-14 37.620000000000005 38.0 38.0 38.0 37.4 38.0 15-19 37.649 38.0 38.0 38.0 38.0 38.0 20-24 37.68085000000001 38.0 38.0 38.0 38.0 38.0 25-29 37.64765 38.0 38.0 38.0 38.0 38.0 30-34 37.63525 38.0 38.0 38.0 38.0 38.0 35-39 37.5915 38.0 38.0 38.0 38.0 38.0 40-44 37.5955 38.0 38.0 38.0 38.0 38.0 45-49 37.5901 38.0 38.0 38.0 38.0 38.0 50-54 37.53845 38.0 38.0 38.0 37.8 38.0 55-59 37.49425 38.0 38.0 38.0 37.8 38.0 60-64 37.502050000000004 38.0 38.0 38.0 37.4 38.0 65-69 37.458800000000004 38.0 38.0 38.0 37.0 38.0 70-74 37.39135 38.0 38.0 38.0 37.0 38.0 75-79 37.40575 38.0 38.0 38.0 37.0 38.0 80-84 37.32565 38.0 38.0 38.0 37.0 38.0 85-89 37.2704 38.0 38.0 38.0 36.8 38.0 90-94 37.1823 38.0 38.0 38.0 36.2 38.0 95-99 37.145950000000006 38.0 38.0 38.0 36.0 38.0 100-104 37.0181 38.0 38.0 38.0 36.0 38.0 105-109 36.89145 38.0 38.0 38.0 35.4 38.0 110-114 36.81695 38.0 38.0 38.0 35.0 38.0 115-119 36.77975 38.0 38.0 38.0 35.0 38.0 120-124 36.6394 38.0 38.0 38.0 34.8 38.0 125-129 36.485299999999995 38.0 38.0 38.0 34.0 38.0 130-134 36.292500000000004 38.0 37.8 38.0 34.0 38.0 135-139 36.14825 38.0 37.6 38.0 33.6 38.0 140-144 35.936 38.0 37.0 38.0 33.0 38.0 145-149 35.628049999999995 38.0 36.2 38.0 32.8 38.0 150-151 32.861125 37.0 33.5 38.0 16.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 1.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 1.0 15 1.0 16 3.0 17 1.0 18 1.0 19 4.0 20 0.0 21 3.0 22 2.0 23 0.0 24 3.0 25 6.0 26 5.0 27 8.0 28 13.0 29 13.0 30 21.0 31 27.0 32 48.0 33 64.0 34 103.0 35 210.0 36 613.0 37 2848.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.68260292164675 13.386454183266933 10.96945551128818 32.961487383798136 2 21.541155866900176 18.363772829622217 35.67675756817613 24.418313735301474 3 17.599999999999998 25.825 27.375 29.2 4 21.099999999999998 33.525 23.5 21.875 5 21.4 34.575 24.85 19.175 6 17.775 34.849999999999994 25.775 21.6 7 14.05 23.674999999999997 43.075 19.2 8 18.375 22.975 29.299999999999997 29.349999999999998 9 17.1 24.025 32.2 26.674999999999997 10-14 20.31 29.354999999999997 26.545 23.79 15-19 19.67 28.575 28.595 23.16 20-24 19.8 28.32 28.244999999999997 23.635 25-29 19.41 28.915000000000003 28.244999999999997 23.43 30-34 19.314999999999998 28.51 28.675 23.5 35-39 19.755 28.26 28.29 23.695 40-44 20.175 27.915 28.155 23.755000000000003 45-49 19.945 28.194999999999997 28.175 23.685000000000002 50-54 19.725 28.335 28.345 23.595 55-59 20.075000000000003 28.384999999999998 27.88 23.66 60-64 19.759999999999998 28.449999999999996 28.17 23.62 65-69 20.04 28.000000000000004 28.74 23.22 70-74 19.79 28.17 28.075 23.965 75-79 20.61 27.51 28.155 23.724999999999998 80-84 19.955000000000002 28.24 28.249999999999996 23.555 85-89 19.855 28.325 28.134999999999998 23.685000000000002 90-94 20.21 28.189999999999998 28.075 23.525 95-99 19.675 27.925 28.355000000000004 24.044999999999998 100-104 20.34 28.000000000000004 28.084999999999997 23.575 105-109 19.495 28.08 28.22 24.205 110-114 19.885 28.02 28.199999999999996 23.895 115-119 20.119999999999997 28.299999999999997 28.305000000000003 23.275000000000002 120-124 20.215 28.365000000000002 27.694999999999997 23.724999999999998 125-129 20.255000000000003 27.73 27.66 24.355 130-134 20.3 27.74 28.03 23.93 135-139 20.57 28.01 27.605 23.815 140-144 20.455000000000002 27.55 27.955000000000002 24.04 145-149 20.54 28.13 27.700000000000003 23.630000000000003 150-151 21.046700888944535 26.918742957305618 27.79516714661325 24.239389007136598 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.5 17 0.5 18 0.5 19 1.0 20 0.5 21 1.0 22 1.5 23 2.5 24 4.0 25 4.5 26 4.0 27 11.0 28 13.0 29 11.0 30 19.5 31 19.5 32 25.0 33 39.0 34 48.5 35 60.0 36 89.0 37 127.5 38 144.5 39 158.0 40 190.5 41 239.5 42 281.5 43 294.0 44 268.0 45 258.0 46 269.0 47 263.0 48 244.5 49 203.0 50 168.5 51 136.0 52 89.5 53 74.5 54 65.5 55 45.0 56 35.5 57 27.5 58 18.5 59 12.5 60 10.5 61 5.5 62 3.5 63 3.0 64 1.5 65 0.5 66 1.5 67 1.5 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 5.875 2 0.075 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.1625 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.775 #Duplication Level Percentage of deduplicated Percentage of total 1 99.77449260836883 99.55000000000001 2 0.22550739163117012 0.44999999999999996 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.037500000000000006 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.2 0.0 0.0 0.0 0.0 86-87 0.225 0.0 0.0 0.0 0.0 88-89 0.2375 0.0 0.0 0.0 0.0 90-91 0.2625 0.0 0.0 0.0 0.0 92-93 0.275 0.0 0.0 0.0 0.0 94-95 0.32499999999999996 0.0 0.0 0.0 0.0 96-97 0.3625 0.0 0.0 0.0 0.0 98-99 0.375 0.0 0.0 0.0 0.0 100-101 0.3875 0.0 0.0 0.0 0.0 102-103 0.5125 0.0 0.0 0.0 0.0 104-105 0.5874999999999999 0.0 0.0 0.0 0.0 106-107 0.7250000000000001 0.0 0.0 0.0 0.0 108-109 0.9375 0.0 0.0 0.0 0.0 110-111 1.0625 0.0 0.0 0.0 0.0 112-113 1.1749999999999998 0.0 0.0 0.0 0.0 114-115 1.35 0.0 0.0 0.0 0.0 116-117 1.625 0.0 0.0 0.0 0.0 118-119 1.8625 0.0 0.0 0.0 0.0 120-121 2.1500000000000004 0.0 0.0 0.0 0.0 122-123 2.4 0.0 0.0 0.0 0.0 124-125 2.5875 0.0 0.0 0.0 0.0 126-127 2.7375 0.0 0.0 0.0 0.0 128-129 2.975 0.0 0.0 0.0 0.0 130-131 3.325 0.0 0.0 0.0 0.0 132-133 3.6375 0.0 0.0 0.0 0.0 134-135 3.8625 0.0 0.0 0.0 0.0 136-137 4.3 0.0 0.0 0.0 0.0 138-139 4.7125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGGAGGT 10 0.0068396386 144.9375 7 >>END_MODULE SRR7180082 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7180082_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.0235 33.0 33.0 34.0 32.0 34.0 2 33.09775 34.0 33.0 34.0 33.0 34.0 3 33.175 34.0 33.0 34.0 33.0 34.0 4 33.16525 34.0 33.0 34.0 33.0 34.0 5 33.14025 34.0 33.0 34.0 33.0 34.0 6 37.208 38.0 38.0 38.0 37.0 38.0 7 37.32925 38.0 38.0 38.0 37.0 38.0 8 37.24525 38.0 38.0 38.0 37.0 38.0 9 37.18225 38.0 38.0 38.0 37.0 38.0 10-14 37.29115 38.0 38.0 38.0 37.8 38.0 15-19 37.201800000000006 38.0 38.0 38.0 37.2 38.0 20-24 37.195949999999996 38.0 38.0 38.0 37.2 38.0 25-29 37.2032 38.0 38.0 38.0 37.4 38.0 30-34 37.160700000000006 38.0 38.0 38.0 37.0 38.0 35-39 37.0698 38.0 38.0 38.0 37.0 38.0 40-44 37.069950000000006 38.0 38.0 38.0 37.0 38.0 45-49 37.076350000000005 38.0 38.0 38.0 37.0 38.0 50-54 37.14685000000001 38.0 38.0 38.0 37.0 38.0 55-59 37.03275000000001 38.0 38.0 38.0 37.0 38.0 60-64 37.0064 38.0 38.0 38.0 36.8 38.0 65-69 36.9533 38.0 38.0 38.0 36.2 38.0 70-74 36.89829999999999 38.0 38.0 38.0 36.0 38.0 75-79 36.893100000000004 38.0 38.0 38.0 36.0 38.0 80-84 36.84805 38.0 38.0 38.0 36.0 38.0 85-89 36.70455 38.0 38.0 38.0 35.8 38.0 90-94 36.63325 38.0 38.0 38.0 35.8 38.0 95-99 36.59895 38.0 38.0 38.0 35.4 38.0 100-104 36.45530000000001 38.0 38.0 38.0 34.6 38.0 105-109 36.3278 38.0 38.0 38.0 34.0 38.0 110-114 36.26885 38.0 38.0 38.0 34.0 38.0 115-119 36.118100000000005 38.0 38.0 38.0 34.0 38.0 120-124 35.9482 38.0 38.0 38.0 33.2 38.0 125-129 35.70495 38.0 37.2 38.0 32.6 38.0 130-134 35.4935 38.0 36.8 38.0 31.2 38.0 135-139 35.04995 38.0 36.0 38.0 29.8 38.0 140-144 34.730599999999995 38.0 35.6 38.0 28.6 38.0 145-149 34.18245 38.0 34.8 38.0 26.2 38.0 150-151 30.68725 36.5 29.0 38.0 8.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 11.0 3 4.0 4 4.0 5 2.0 6 0.0 7 2.0 8 1.0 9 2.0 10 0.0 11 0.0 12 4.0 13 3.0 14 2.0 15 4.0 16 3.0 17 6.0 18 4.0 19 4.0 20 6.0 21 10.0 22 5.0 23 9.0 24 5.0 25 6.0 26 6.0 27 16.0 28 22.0 29 28.0 30 26.0 31 37.0 32 54.0 33 58.0 34 106.0 35 205.0 36 547.0 37 2798.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.75556667500626 17.888416312234177 16.61245934450838 24.74355766825119 2 24.349999999999998 23.075000000000003 33.550000000000004 19.025 3 20.375 27.175 31.85 20.599999999999998 4 23.575 34.55 22.7 19.175 5 24.375 36.1 22.05 17.474999999999998 6 19.979994998749685 35.28382095523881 25.156289072268066 19.579894973743436 7 19.554888722180543 19.204801200300075 40.1850462615654 21.05526381595399 8 21.010505252626313 24.287143571785894 27.988994497248626 26.713356678339167 9 22.15 26.924999999999997 27.975 22.95 10-14 23.845 28.825 26.025 21.305 15-19 22.99074768692173 28.86721680420105 27.521880470117527 20.62015503875969 20-24 23.122341756317237 28.811608706529896 27.820865649236925 20.24518388791594 25-29 23.45252403846154 28.435496794871796 27.28866185897436 20.823317307692307 30-34 23.46427497745265 28.615091692554362 27.903597554865218 20.017035775127766 35-39 23.00671948651088 28.50767224952362 27.419516598134592 21.06609166583091 40-44 23.46836458437782 28.426752231023766 27.37390955580066 20.730973628797756 45-49 23.01452178267401 28.5878818227341 28.5778668002003 19.81972959439159 50-54 23.371685842921462 28.30915457728864 27.933966983491747 20.38519259629815 55-59 23.47673836918459 28.3991995997999 27.848924462231118 20.275137568784395 60-64 24.123618542781415 28.529279391908783 27.219082862429367 20.12801920288043 65-69 23.42968593718744 28.250650130026006 27.945589117823566 20.37407481496299 70-74 23.39850977646647 28.26924038605791 28.284242636395458 20.04800720108016 75-79 23.74 28.355000000000004 28.12 19.785 80-84 24.214842968593718 27.745549109821965 27.925585117023406 20.114022804560914 85-89 24.375 28.03 27.705000000000002 19.89 90-94 24.044999999999998 28.49 27.675 19.79 95-99 24.425 27.52 28.08 19.975 100-104 24.03 27.79 28.43 19.75 105-109 24.135 27.615000000000002 28.17 20.080000000000002 110-114 23.71 27.855 28.21 20.225 115-119 24.505 28.01 27.63 19.855 120-124 23.54 27.87 28.060000000000002 20.53 125-129 24.301215060753037 28.181409070453523 27.661383069153455 19.85599279963998 130-134 24.27 27.49 28.09 20.150000000000002 135-139 24.565 27.565 27.88 19.99 140-144 24.425 28.21 27.584999999999997 19.78 145-149 24.775 28.435 27.315 19.475 150-151 24.222277972905168 28.261414952333162 27.797290516808832 19.719016557952834 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 1.0 13 1.0 14 0.5 15 1.0 16 0.5 17 0.0 18 0.0 19 1.5 20 1.5 21 0.0 22 0.0 23 1.0 24 3.5 25 3.0 26 3.5 27 4.5 28 3.5 29 6.0 30 10.5 31 14.5 32 18.5 33 23.5 34 33.0 35 51.0 36 86.5 37 108.5 38 133.5 39 174.0 40 201.5 41 233.0 42 268.0 43 312.0 44 313.5 45 301.0 46 293.5 47 260.5 48 225.5 49 205.5 50 178.5 51 132.5 52 102.5 53 77.5 54 54.5 55 40.5 56 32.5 57 26.5 58 18.5 59 10.5 60 8.5 61 7.0 62 4.5 63 2.5 64 1.5 65 1.0 66 0.5 67 0.0 68 0.0 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.075 2 0.0 3 0.0 4 0.0 5 0.0 6 0.025 7 0.025 8 0.05 9 0.0 10-14 0.0 15-19 0.025 20-24 0.075 25-29 0.16 30-34 0.21 35-39 0.29 40-44 0.27 45-49 0.15 50-54 0.05 55-59 0.05 60-64 0.015 65-69 0.02 70-74 0.015 75-79 0.0 80-84 0.02 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.005 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.35000000000000003 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.5 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62311557788944 99.125 2 0.32663316582914576 0.65 3 0.02512562814070352 0.075 4 0.0 0.0 5 0.0 0.0 6 0.02512562814070352 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCTTGAGCAAATTCAGTTTCTAAGCAAAAGCTTTCCAGGCCCCTTTATCC 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.037500000000000006 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.2 0.0 0.0 0.0 0.0 86-87 0.225 0.0 0.0 0.0 0.0 88-89 0.2375 0.0 0.0 0.0 0.0 90-91 0.2625 0.0 0.0 0.0 0.0 92-93 0.275 0.0 0.0 0.0 0.0 94-95 0.32499999999999996 0.0 0.0 0.0 0.0 96-97 0.3625 0.0 0.0 0.0 0.0 98-99 0.375 0.0 0.0 0.0 0.0 100-101 0.3875 0.0 0.0 0.0 0.0 102-103 0.4875 0.0 0.0 0.0 0.0 104-105 0.5625 0.0 0.0 0.0 0.0 106-107 0.7 0.0 0.0 0.0 0.0 108-109 0.925 0.0 0.0 0.0 0.0 110-111 1.0625 0.0 0.0 0.0 0.0 112-113 1.1749999999999998 0.0 0.0 0.0 0.0 114-115 1.35 0.0 0.0 0.0 0.0 116-117 1.625 0.0 0.0 0.0 0.0 118-119 1.85 0.0 0.0 0.0 0.0 120-121 2.1125 0.0 0.0 0.0 0.0 122-123 2.3375 0.0 0.0 0.0 0.0 124-125 2.5375 0.0 0.0 0.0 0.0 126-127 2.6875 0.0 0.0 0.0 0.0 128-129 2.925 0.0 0.0 0.0 0.0 130-131 3.275 0.0 0.0 0.0 0.0 132-133 3.575 0.0 0.0 0.0 0.0 134-135 3.8 0.0 0.0 0.0 0.0 136-137 4.25 0.0 0.0 0.0 0.0 138-139 4.7125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCAGGCT 10 0.006830828 145.0 1 >>END_MODULE Read 811849 spots for SRR7180082.sra Written 811849 spots for SRR7180082.sra Read 811849 spots for SRR7180082.sra Written 811849 spots for SRR7180082.sra Read 811849 spots for SRR7180082.sra Written 811849 spots for SRR7180082.sra Read 811849 spots for SRR7180082.sra Written 811849 spots for SRR7180082.sra Read 811849 spots for SRR7180082.sra Written 811849 spots for SRR7180082.sra Read 811849 spots for SRR7180082.sra Written 811849 spots for SRR7180082.sra Read 811849 spots for SRR7180082.sra Written 811849 spots for SRR7180082.sra Read 811849 spots for SRR7180082.sra Written 811849 spots for SRR7180082.sra Read 811849 spots for SRR7180082.sra Written 811849 spots for SRR7180082.sra Read 811849 spots for SRR7180082.sra Written 811849 spots for SRR7180082.sra Read 811849 spots for SRR7180082.sra Written 811849 spots for SRR7180082.sra Read 811849 spots for SRR7180082.sra Written 811849 spots for SRR7180082.sra Read 811849 spots for SRR7180082.sra Written 811849 spots for SRR7180082.sra Read 811849 spots for SRR7180082.sra Written 811849 spots for SRR7180082.sra Read 811849 spots for SRR7180082.sra Written 811849 spots for SRR7180082.sra Read 811849 spots for SRR7180082.sra Written 811849 spots for SRR7180082.sra Read 811849 spots for SRR7180082.sra Written 811849 spots for SRR7180082.sra Read 811857 spots for SRR7180082.sra Written 811857 spots for SRR7180082.sra Read 811849 spots for SRR7180082.sra Written 811849 spots for SRR7180082.sra Read 811849 spots for SRR7180082.sra Written 811849 spots for SRR7180082.sra SRR ids: ['SRR7180082.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_vavu_z81 SRR7180082.sra spots: 16236988 blocks: [[1, 811849], [811850, 1623698], [1623699, 2435547], [2435548, 3247396], [3247397, 4059245], [4059246, 4871094], [4871095, 5682943], [5682944, 6494792], [6494793, 7306641], [7306642, 8118490], [8118491, 8930339], [8930340, 9742188], [9742189, 10554037], [10554038, 11365886], [11365887, 12177735], [12177736, 12989584], [12989585, 13801433], [13801434, 14613282], [14613283, 15425131], [15425132, 16236988]] SRR7180082 file size 5480482 SRR7180082 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7180082 SRR7180082_1.fastq SRR7180082_2.fastq Input file: SRR7180082_1.fastq Paired file: SRR7180082_2.fastq trimmed: SRR7180082-trimmed-pair1.fastq, SRR7180082-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 17:36:58 2025 >> started Mon Feb 10 17:37:25 2025 >> done (26.935s) 16236988 read pairs processed; of these: 24029 ( 0.15%) short read pairs filtered out after trimming by size control 14687 ( 0.09%) empty read pairs filtered out after trimming by size control 16198272 (99.76%) read pairs available; of these: 5774290 (35.65%) trimmed read pairs available after processing 10423982 (64.35%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 3 0.00% 20 4 0.00% 21 2 0.00% 22 3 0.00% 23 2 0.00% 24 4 0.00% 25 4 0.00% 26 3 0.00% 27 4 0.00% 28 5 0.00% 29 5 0.00% 30 4 0.00% 31 6 0.00% 32 2 0.00% 33 4 0.00% 34 4 0.00% 35 9 0.00% 36 3 0.00% 37 10 0.00% 38 6 0.00% 39 8 0.00% 40 5 0.00% 41 5 0.00% 42 4 0.00% 43 2 0.00% 44 9 0.00% 45 8 0.00% 46 16 0.00% 47 12 0.00% 48 9 0.00% 49 21 0.00% 50 15 0.00% 51 23 0.00% 52 30 0.00% 53 26 0.00% 54 26 0.00% 55 39 0.00% 56 31 0.00% 57 42 0.00% 58 54 0.00% 59 74 0.00% 60 54 0.00% 61 78 0.00% 62 110 0.00% 63 120 0.00% 64 133 0.00% 65 156 0.00% 66 154 0.00% 67 187 0.00% 68 223 0.00% 69 263 0.00% 70 284 0.00% 71 361 0.00% 72 393 0.00% 73 481 0.00% 74 543 0.00% 75 578 0.00% 76 775 0.00% 77 871 0.01% 78 901 0.01% 79 1057 0.01% 80 1249 0.01% 81 1412 0.01% 82 1522 0.01% 83 1954 0.01% 84 3033 0.02% 85 3925 0.02% 86 4341 0.03% 87 4780 0.03% 88 5036 0.03% 89 5214 0.03% 90 5423 0.03% 91 5732 0.04% 92 6263 0.04% 93 6678 0.04% 94 6895 0.04% 95 7311 0.05% 96 7968 0.05% 97 8271 0.05% 98 8845 0.05% 99 9557 0.06% 100 9932 0.06% 101 10631 0.07% 102 11237 0.07% 103 11857 0.07% 104 12611 0.08% 105 13692 0.08% 106 14334 0.09% 107 15208 0.09% 108 15929 0.10% 109 16551 0.10% 110 17534 0.11% 111 18408 0.11% 112 19202 0.12% 113 20839 0.13% 114 21620 0.13% 115 23262 0.14% 116 23914 0.15% 117 25107 0.15% 118 26639 0.16% 119 28044 0.17% 120 29458 0.18% 121 29999 0.19% 122 31487 0.19% 123 32474 0.20% 124 34055 0.21% 125 34722 0.21% 126 36379 0.22% 127 37959 0.23% 128 39160 0.24% 129 40158 0.25% 130 42268 0.26% 131 44609 0.28% 132 46285 0.29% 133 48162 0.30% 134 50449 0.31% 135 53412 0.33% 136 55288 0.34% 137 57265 0.35% 138 60282 0.37% 139 64490 0.40% 140 67727 0.42% 141 72250 0.45% 142 78738 0.49% 143 85453 0.53% 144 95564 0.59% 145 108591 0.67% 146 128184 0.79% 147 165112 1.02% 148 242260 1.50% 149 477829 2.95% 150 2913990 17.99% 151 10423982 64.35% 16198272 reads passed initial QC criterion=sequence-density sequence-density=0.85 sequence-density-rank=1 fanout-score=2.64 fanout-score-rank=34 prefix-density=0.89 prefix-fanout=2.5 sequence=CCACACTTGCAG criterion=fanout-score sequence-density=0.04 sequence-density-rank=37 fanout-score=19.48 fanout-score-rank=1 prefix-density=0.20 prefix-fanout=4.2 sequence=TTGTCAATGGTATCAGAGCTCTCCACCTCCAAGGTGATGGTCT criterion=sequence-density sequence-density=0.52 sequence-density-rank=1 fanout-score=5.38 fanout-score-rank=24 prefix-density=1.50 prefix-fanout=1.9 sequence=CTGCAAGTGCGGCAGTGACTGCAAATGTG criterion=fanout-score sequence-density=0.01 sequence-density-rank=39 fanout-score=33.38 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=6.0 sequence=CTGAGCTTGAGTGCATTCTTCTAAGTAAAAGAAATCCCTTAATTTCATCACACTTTCCTTCTTTTCCAACAGAAAATGTC SRR7180082 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 17:38:12 Started mapping on | Feb 10 17:38:13 Finished on | Feb 10 17:40:06 Mapping speed, Million of reads per hour | 516.05 Number of input reads | 16198272 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 15068364 Uniquely mapped reads % | 93.02% Average mapped length | 295.11 Number of splices: Total | 14886271 Number of splices: Annotated (sjdb) | 14614918 Number of splices: GT/AG | 14656116 Number of splices: GC/AG | 183637 Number of splices: AT/AC | 11716 Number of splices: Non-canonical | 34802 Mismatch rate per base, % | 0.32% Deletion rate per base | 0.03% Deletion average length | 2.73 Insertion rate per base | 0.02% Insertion average length | 2.50 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 349635 % of reads mapped to multiple loci | 2.16% Number of reads mapped to too many loci | 26064 % of reads mapped to too many loci | 0.16% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.62% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 803302 803302 803302 N_multimapping 349635 349635 349635 N_noFeature 376452 14930582 432605 N_ambiguous 154748 802 72850 UnstrandedReadsAssigned:14537164 PositiveStrandReadsAssigned:136980 NegativeStrandReadsAssigned:14562909 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7180082 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7180082-trimmed-pair1.fastq SRR7180082-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,198,272 reads, 14,382,518 reads pseudoaligned [quant] estimated average fragment length: 234.125 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,123 rounds 52401 SRR7180082.ke.tsv 34699 SRR7180082.se.tsv 87100 total ==> SRR7180082.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1784.87 1905 67.4356 Potri.005G024800.1.v4.1 1035 801.875 320 25.2142 Potri.004G059700.1.v4.1 961 727.904 13 1.12842 Potri.007G009000.2.v4.1 1416 1182.87 0 0 Potri.003G141000.2.v4.1 2943 2709.87 931.571 21.7204 Potri.016G087400.1.v4.1 270 79.9618 817.744 646.155 Potri.015G069301.1.v4.1 564 333.88 0 0 Potri.010G195200.1.v4.1 1773 1539.87 409 16.7818 Potri.012G127500.1.v4.1 977 743.904 3771 320.289 ==> SRR7180082.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 32 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 443 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 162 SRR7180082 completed mapping pipeline successfully