Starting /dee2/code/volunteer_pipeline.sh SRR7180083 current disk space = 3057938784256 free memory = 986869112 SRR7180083 SRAfilesize 9b41bf3376b65ceeedd119c90ef47818 SRR7180083.sra SRR7180083.sra file validated SRR7180083 is paired end SRR7180083 is conventional basespace SRR7180083 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7180083_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 27.8875 33.0 25.0 33.0 18.0 34.0 2 31.308 33.0 30.0 33.0 27.0 34.0 3 31.5105 33.0 31.0 33.0 27.0 34.0 4 32.20325 33.0 32.0 33.0 32.0 34.0 5 32.90625 33.0 33.0 33.0 32.0 34.0 6 36.998 38.0 37.0 38.0 36.0 38.0 7 37.3475 38.0 38.0 38.0 36.0 38.0 8 37.606 38.0 38.0 38.0 37.0 38.0 9 37.71625 38.0 38.0 38.0 38.0 38.0 10-14 37.71095 38.0 38.0 38.0 38.0 38.0 15-19 37.692750000000004 38.0 38.0 38.0 38.0 38.0 20-24 37.6789 38.0 38.0 38.0 38.0 38.0 25-29 37.6733 38.0 38.0 38.0 38.0 38.0 30-34 37.636250000000004 38.0 38.0 38.0 38.0 38.0 35-39 37.6222 38.0 38.0 38.0 38.0 38.0 40-44 37.61985 38.0 38.0 38.0 38.0 38.0 45-49 37.600199999999994 38.0 38.0 38.0 38.0 38.0 50-54 37.5473 38.0 38.0 38.0 38.0 38.0 55-59 37.516450000000006 38.0 38.0 38.0 37.8 38.0 60-64 37.48545 38.0 38.0 38.0 37.4 38.0 65-69 37.438649999999996 38.0 38.0 38.0 37.0 38.0 70-74 37.40245 38.0 38.0 38.0 37.0 38.0 75-79 37.39405 38.0 38.0 38.0 37.0 38.0 80-84 37.351549999999996 38.0 38.0 38.0 37.0 38.0 85-89 37.282799999999995 38.0 38.0 38.0 37.0 38.0 90-94 37.183 38.0 38.0 38.0 36.6 38.0 95-99 37.173199999999994 38.0 38.0 38.0 36.0 38.0 100-104 37.0511 38.0 38.0 38.0 36.0 38.0 105-109 36.912549999999996 38.0 38.0 38.0 36.0 38.0 110-114 36.78575000000001 38.0 38.0 38.0 35.2 38.0 115-119 36.7442 38.0 38.0 38.0 34.8 38.0 120-124 36.6348 38.0 38.0 38.0 34.8 38.0 125-129 36.53315 38.0 38.0 38.0 34.2 38.0 130-134 36.288799999999995 38.0 38.0 38.0 34.0 38.0 135-139 36.062650000000005 38.0 37.4 38.0 33.4 38.0 140-144 35.794500000000006 38.0 36.8 38.0 33.0 38.0 145-149 35.4888 38.0 36.0 38.0 32.6 38.0 150-151 32.897875 37.0 33.5 38.0 16.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 1.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 1.0 16 0.0 17 0.0 18 3.0 19 2.0 20 1.0 21 1.0 22 3.0 23 2.0 24 6.0 25 6.0 26 9.0 27 7.0 28 16.0 29 20.0 30 19.0 31 28.0 32 32.0 33 51.0 34 91.0 35 193.0 36 520.0 37 2987.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.634794156706505 13.652058432934927 12.377158034528552 39.33598937583001 2 20.95 18.25 38.224999999999994 22.575 3 19.25 25.4 26.6 28.749999999999996 4 22.375 32.300000000000004 23.075000000000003 22.25 5 21.4 35.375 23.799999999999997 19.425 6 17.733866933466732 36.86843421710855 25.987993996998497 19.409704852426213 7 14.124999999999998 21.9 45.125 18.85 8 17.75 21.95 31.900000000000002 28.4 9 19.075 22.275 32.875 25.775 10-14 19.950000000000003 28.439999999999998 26.93 24.68 15-19 20.165 27.99 28.16 23.685000000000002 20-24 19.6 28.175 28.194999999999997 24.03 25-29 19.86 28.52 27.925 23.695 30-34 19.78 28.485 27.99 23.745 35-39 19.61 28.455000000000002 28.18 23.755000000000003 40-44 20.135 27.965 27.77 24.13 45-49 19.845 28.854999999999997 27.565 23.735 50-54 19.994999999999997 28.025 28.02 23.96 55-59 20.25 28.51 27.855 23.385 60-64 20.4 28.49 27.51 23.599999999999998 65-69 20.39 28.194999999999997 27.860000000000003 23.555 70-74 20.695 28.03 27.889999999999997 23.385 75-79 20.275000000000002 28.01 28.025 23.69 80-84 20.369999999999997 27.889999999999997 28.37 23.369999999999997 85-89 19.6 27.495000000000005 28.37 24.535 90-94 20.145 28.02 28.134999999999998 23.7 95-99 19.86 27.584999999999997 28.310000000000002 24.245 100-104 20.195 28.03 27.91 23.865 105-109 20.155 28.345 28.42 23.080000000000002 110-114 20.775 28.1 27.694999999999997 23.43 115-119 20.73 27.229999999999997 27.91 24.13 120-124 20.79 27.939999999999998 27.67 23.599999999999998 125-129 20.560000000000002 27.85 27.975 23.615 130-134 20.62 27.79 27.800000000000004 23.79 135-139 20.735 27.905 28.315 23.044999999999998 140-144 21.235 27.800000000000004 27.425 23.54 145-149 20.575 28.865000000000002 27.195000000000004 23.365 150-151 21.376720901126408 28.685857321652065 26.795994993742177 23.14142678347935 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.0 22 0.5 23 2.0 24 2.0 25 3.0 26 6.0 27 5.0 28 7.0 29 10.5 30 12.5 31 20.5 32 25.0 33 33.0 34 43.0 35 57.5 36 83.5 37 100.0 38 124.0 39 167.5 40 207.5 41 242.0 42 273.0 43 282.5 44 286.5 45 300.0 46 288.0 47 257.0 48 243.0 49 208.0 50 150.5 51 122.0 52 116.5 53 94.0 54 61.0 55 44.0 56 32.0 57 25.5 58 18.0 59 7.0 60 6.0 61 8.5 62 5.5 63 3.0 64 3.5 65 3.5 66 2.5 67 2.0 68 1.5 69 0.5 70 0.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 5.875 2 0.0 3 0.0 4 0.0 5 0.0 6 0.05 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.825 #Duplication Level Percentage of deduplicated Percentage of total 1 99.82469321312296 99.65 2 0.1753067868770348 0.35000000000000003 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.037500000000000006 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.0625 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.1125 0.0 0.0 0.0 0.0 90-91 0.1375 0.0 0.0 0.0 0.0 92-93 0.2 0.0 0.0 0.0 0.0 94-95 0.25 0.0 0.0 0.0 0.0 96-97 0.3375 0.0 0.0 0.0 0.0 98-99 0.45 0.0 0.0 0.0 0.0 100-101 0.525 0.0 0.0 0.0 0.0 102-103 0.5874999999999999 0.0 0.0 0.0 0.0 104-105 0.6499999999999999 0.0 0.0 0.0 0.0 106-107 0.875 0.0 0.0 0.0 0.0 108-109 0.9125000000000001 0.0 0.0 0.0 0.0 110-111 1.0625 0.0 0.0 0.0 0.0 112-113 1.175 0.0 0.0 0.0 0.0 114-115 1.3875000000000002 0.0 0.0 0.0 0.0 116-117 1.7375 0.0 0.0 0.0 0.0 118-119 2.0125 0.0 0.0 0.0 0.0 120-121 2.225 0.0 0.0 0.0 0.0 122-123 2.55 0.0 0.0 0.0 0.0 124-125 2.7625 0.0 0.0 0.0 0.0 126-127 3.0125 0.0 0.0 0.0 0.0 128-129 3.3499999999999996 0.0 0.0 0.0 0.0 130-131 3.6125 0.0 0.0 0.0 0.0 132-133 3.9625 0.0 0.0 0.0 0.0 134-135 4.5375 0.0 0.0 0.0 0.0 136-137 4.975 0.0 0.0 0.0 0.0 138-139 5.5625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTACCAT 10 0.0068378756 144.95 8 TACCATC 10 0.0068378756 144.95 9 >>END_MODULE SRR7180083 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7180083_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.05475 33.0 33.0 34.0 33.0 34.0 2 33.25 34.0 33.0 34.0 33.0 34.0 3 33.3205 34.0 33.0 34.0 33.0 34.0 4 33.29325 34.0 33.0 34.0 33.0 34.0 5 33.3245 34.0 33.0 34.0 33.0 34.0 6 37.46775 38.0 38.0 38.0 38.0 38.0 7 37.467 38.0 38.0 38.0 38.0 38.0 8 37.4965 38.0 38.0 38.0 38.0 38.0 9 37.44275 38.0 38.0 38.0 38.0 38.0 10-14 37.49570000000001 38.0 38.0 38.0 38.0 38.0 15-19 37.4336 38.0 38.0 38.0 38.0 38.0 20-24 37.40795 38.0 38.0 38.0 37.8 38.0 25-29 37.48775 38.0 38.0 38.0 38.0 38.0 30-34 37.436699999999995 38.0 38.0 38.0 37.8 38.0 35-39 37.3831 38.0 38.0 38.0 37.6 38.0 40-44 37.350049999999996 38.0 38.0 38.0 37.4 38.0 45-49 37.35375 38.0 38.0 38.0 37.2 38.0 50-54 37.3262 38.0 38.0 38.0 37.0 38.0 55-59 37.32854999999999 38.0 38.0 38.0 37.0 38.0 60-64 37.2436 38.0 38.0 38.0 37.0 38.0 65-69 37.1602 38.0 38.0 38.0 37.0 38.0 70-74 37.24045 38.0 38.0 38.0 37.0 38.0 75-79 37.1663 38.0 38.0 38.0 36.8 38.0 80-84 37.08205 38.0 38.0 38.0 36.2 38.0 85-89 36.9859 38.0 38.0 38.0 36.0 38.0 90-94 36.916599999999995 38.0 38.0 38.0 36.0 38.0 95-99 36.86195 38.0 38.0 38.0 35.8 38.0 100-104 36.666650000000004 38.0 38.0 38.0 35.0 38.0 105-109 36.63355 38.0 38.0 38.0 35.0 38.0 110-114 36.6416 38.0 38.0 38.0 35.0 38.0 115-119 36.5124 38.0 38.0 38.0 34.0 38.0 120-124 36.33045 38.0 38.0 38.0 34.0 38.0 125-129 35.994 38.0 37.4 38.0 33.4 38.0 130-134 35.83815 38.0 37.0 38.0 32.6 38.0 135-139 35.5566 38.0 36.0 38.0 31.2 38.0 140-144 35.35195 38.0 36.0 38.0 31.2 38.0 145-149 34.77135 38.0 35.8 38.0 29.0 38.0 150-151 30.967875 36.5 29.5 38.0 12.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 2.0 4 2.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 2.0 11 2.0 12 1.0 13 0.0 14 1.0 15 1.0 16 0.0 17 2.0 18 4.0 19 3.0 20 2.0 21 4.0 22 7.0 23 5.0 24 9.0 25 11.0 26 9.0 27 10.0 28 16.0 29 15.0 30 29.0 31 33.0 32 57.0 33 77.0 34 105.0 35 214.0 36 523.0 37 2853.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.212958312405824 15.5700652938222 16.52435961828227 31.6926167754897 2 24.73736868434217 21.735867933966986 35.042521260630316 18.48424212106053 3 20.930232558139537 26.30657664416104 31.407851962990748 21.355338834708675 4 23.925 34.849999999999994 21.0 20.225 5 23.400000000000002 38.025 21.6 16.975 6 18.925 38.425 23.575 19.075 7 18.5 17.474999999999998 41.9 22.125 8 20.225 23.25 27.075 29.45 9 22.25 24.325 29.075 24.349999999999998 10-14 23.21 28.444999999999997 25.525 22.82 15-19 23.23 28.910000000000004 26.96 20.9 20-24 22.91 28.825 27.1 21.165 25-29 23.235 28.51 27.12 21.135 30-34 22.984596919383876 28.570714142828567 27.440488097619525 21.004200840168032 35-39 23.253602882305845 28.56285028022418 27.35188150520416 20.83166533226581 40-44 23.5623842650518 28.30689154696962 27.931534958210303 20.19918922976828 45-49 23.595 28.854999999999997 26.875 20.674999999999997 50-54 22.515 28.560000000000002 28.08 20.845 55-59 23.145 28.255000000000003 28.055000000000003 20.544999999999998 60-64 23.32 28.535 27.415 20.73 65-69 23.59 28.055000000000003 27.725 20.630000000000003 70-74 23.43 28.194999999999997 27.935 20.44 75-79 23.505000000000003 28.505000000000003 27.71 20.28 80-84 23.135 28.155 27.860000000000003 20.849999999999998 85-89 23.849999999999998 28.050000000000004 27.534999999999997 20.565 90-94 23.200000000000003 28.92 27.715 20.165 95-99 23.705000000000002 28.175 27.87 20.25 100-104 23.94 28.23 27.355 20.474999999999998 105-109 23.49 28.615000000000002 27.29 20.605 110-114 23.7 28.544999999999998 27.834999999999997 19.919999999999998 115-119 24.33 28.15 27.235 20.285 120-124 24.25 28.23 27.43 20.09 125-129 24.14 29.235 26.919999999999998 19.705000000000002 130-134 24.57 28.015 27.200000000000003 20.215 135-139 24.295 28.32 27.384999999999998 20.0 140-144 24.485 27.99 27.235 20.29 145-149 24.775 28.325 27.310000000000002 19.59 150-151 24.53279819390443 28.157531669384174 27.2419415527405 20.0677285839709 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.0 23 0.0 24 0.0 25 1.0 26 1.5 27 1.5 28 2.5 29 5.0 30 9.0 31 11.0 32 14.0 33 23.0 34 33.0 35 48.5 36 74.0 37 108.0 38 134.5 39 165.0 40 209.5 41 254.0 42 284.0 43 298.5 44 306.5 45 307.5 46 304.0 47 274.0 48 225.0 49 193.0 50 168.5 51 135.0 52 104.0 53 76.5 54 54.0 55 44.0 56 35.5 57 22.5 58 12.0 59 10.5 60 14.0 61 9.5 62 6.0 63 5.5 64 4.5 65 3.5 66 2.0 67 1.5 68 1.0 69 0.5 70 0.0 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.44999999999999996 2 0.05 3 0.025 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.02 35-39 0.08 40-44 0.095 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.3375 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64877069744105 99.3 2 0.35122930255895635 0.7000000000000001 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.037500000000000006 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.0625 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.1125 0.0 0.0 0.0 0.0 90-91 0.1375 0.0 0.0 0.0 0.0 92-93 0.2 0.0 0.0 0.0 0.0 94-95 0.25 0.0 0.0 0.0 0.0 96-97 0.3375 0.0 0.0 0.0 0.0 98-99 0.475 0.0 0.0 0.0 0.0 100-101 0.55 0.0 0.0 0.0 0.0 102-103 0.6125 0.0 0.0 0.0 0.0 104-105 0.675 0.0 0.0 0.0 0.0 106-107 0.9 0.0 0.0 0.0 0.0 108-109 0.9375 0.0 0.0 0.0 0.0 110-111 1.0875 0.0 0.0 0.0 0.0 112-113 1.2 0.0 0.0 0.0 0.0 114-115 1.4125 0.0 0.0 0.0 0.0 116-117 1.7625 0.0 0.0 0.0 0.0 118-119 2.0375 0.0 0.0 0.0 0.0 120-121 2.25 0.0 0.0 0.0 0.0 122-123 2.575 0.0 0.0 0.0 0.0 124-125 2.7875 0.0 0.0 0.0 0.0 126-127 3.0375 0.0 0.0 0.0 0.0 128-129 3.375 0.0 0.0 0.0 0.0 130-131 3.6375 0.0 0.0 0.0 0.0 132-133 3.9875 0.0 0.0 0.0 0.0 134-135 4.5625 0.0 0.0 0.0 0.0 136-137 5.0 0.0 0.0 0.0 0.0 138-139 5.574999999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 805361 spots for SRR7180083.sra Written 805361 spots for SRR7180083.sra Read 805361 spots for SRR7180083.sra Written 805361 spots for SRR7180083.sra Read 805361 spots for SRR7180083.sra Written 805361 spots for SRR7180083.sra Read 805361 spots for SRR7180083.sra Read 805361 spots for SRR7180083.sra Written 805361 spots for SRR7180083.sra Written 805361 spots for SRR7180083.sra Read 805361 spots for SRR7180083.sra Written 805361 spots for SRR7180083.sra Read 805361 spots for SRR7180083.sra Written 805361 spots for SRR7180083.sra Read 805361 spots for SRR7180083.sra Written 805361 spots for SRR7180083.sra Read 805361 spots for SRR7180083.sra Written 805361 spots for SRR7180083.sra Read 805361 spots for SRR7180083.sra Written 805361 spots for SRR7180083.sra Read 805361 spots for SRR7180083.sra Written 805361 spots for SRR7180083.sra Read 805361 spots for SRR7180083.sra Written 805361 spots for SRR7180083.sra Read 805361 spots for SRR7180083.sra Written 805361 spots for SRR7180083.sra Read 805361 spots for SRR7180083.sra Written 805361 spots for SRR7180083.sra Read 805361 spots for SRR7180083.sra Written 805361 spots for SRR7180083.sra Read 805361 spots for SRR7180083.sra Written 805361 spots for SRR7180083.sra Read 805361 spots for SRR7180083.sra Written 805361 spots for SRR7180083.sra Read 805361 spots for SRR7180083.sra Written 805361 spots for SRR7180083.sra Read 805361 spots for SRR7180083.sra Written 805361 spots for SRR7180083.sra Read 805361 spots for SRR7180083.sra Written 805361 spots for SRR7180083.sra SRR ids: ['SRR7180083.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd__tqt2u0g SRR7180083.sra spots: 16107220 blocks: [[1, 805361], [805362, 1610722], [1610723, 2416083], [2416084, 3221444], [3221445, 4026805], [4026806, 4832166], [4832167, 5637527], [5637528, 6442888], [6442889, 7248249], [7248250, 8053610], [8053611, 8858971], [8858972, 9664332], [9664333, 10469693], [10469694, 11275054], [11275055, 12080415], [12080416, 12885776], [12885777, 13691137], [13691138, 14496498], [14496499, 15301859], [15301860, 16107220]] SRR7180083 file size 5436507 SRR7180083 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7180083 SRR7180083_1.fastq SRR7180083_2.fastq Input file: SRR7180083_1.fastq Paired file: SRR7180083_2.fastq trimmed: SRR7180083-trimmed-pair1.fastq, SRR7180083-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 17:49:47 2025 >> started Mon Feb 10 17:50:05 2025 >> done (18.094s) 16107220 read pairs processed; of these: 6963 ( 0.04%) short read pairs filtered out after trimming by size control 4445 ( 0.03%) empty read pairs filtered out after trimming by size control 16095812 (99.93%) read pairs available; of these: 5669816 (35.23%) trimmed read pairs available after processing 10425996 (64.77%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 20 4 0.00% 21 2 0.00% 22 1 0.00% 23 2 0.00% 24 2 0.00% 25 5 0.00% 26 1 0.00% 27 1 0.00% 28 1 0.00% 29 1 0.00% 30 3 0.00% 31 4 0.00% 32 2 0.00% 33 3 0.00% 34 0 0.00% 35 5 0.00% 36 2 0.00% 37 6 0.00% 38 14 0.00% 39 42 0.00% 40 9 0.00% 41 7 0.00% 42 13 0.00% 43 6 0.00% 44 7 0.00% 45 29 0.00% 46 10 0.00% 47 17 0.00% 48 9 0.00% 49 10 0.00% 50 11 0.00% 51 13 0.00% 52 21 0.00% 53 35 0.00% 54 24 0.00% 55 100 0.00% 56 123 0.00% 57 58 0.00% 58 45 0.00% 59 46 0.00% 60 52 0.00% 61 88 0.00% 62 162 0.00% 63 122 0.00% 64 114 0.00% 65 107 0.00% 66 110 0.00% 67 142 0.00% 68 169 0.00% 69 196 0.00% 70 205 0.00% 71 283 0.00% 72 333 0.00% 73 404 0.00% 74 420 0.00% 75 498 0.00% 76 563 0.00% 77 667 0.00% 78 775 0.00% 79 955 0.01% 80 957 0.01% 81 1021 0.01% 82 1220 0.01% 83 1446 0.01% 84 1887 0.01% 85 2289 0.01% 86 2453 0.02% 87 2967 0.02% 88 3258 0.02% 89 3443 0.02% 90 3706 0.02% 91 3959 0.02% 92 4355 0.03% 93 4726 0.03% 94 5218 0.03% 95 5877 0.04% 96 6263 0.04% 97 6793 0.04% 98 7116 0.04% 99 7665 0.05% 100 8143 0.05% 101 8649 0.05% 102 9235 0.06% 103 9840 0.06% 104 10451 0.06% 105 11500 0.07% 106 12176 0.08% 107 12975 0.08% 108 13644 0.08% 109 14658 0.09% 110 15267 0.09% 111 16472 0.10% 112 16862 0.10% 113 17782 0.11% 114 19047 0.12% 115 19950 0.12% 116 20991 0.13% 117 22006 0.14% 118 23414 0.15% 119 24813 0.15% 120 26645 0.17% 121 28283 0.18% 122 27341 0.17% 123 28815 0.18% 124 29863 0.19% 125 31111 0.19% 126 32201 0.20% 127 34244 0.21% 128 35247 0.22% 129 36768 0.23% 130 38516 0.24% 131 40295 0.25% 132 41982 0.26% 133 43895 0.27% 134 46265 0.29% 135 48026 0.30% 136 50381 0.31% 137 53162 0.33% 138 56061 0.35% 139 59583 0.37% 140 63139 0.39% 141 67748 0.42% 142 73961 0.46% 143 80834 0.50% 144 91578 0.57% 145 104129 0.65% 146 122044 0.76% 147 159416 0.99% 148 237236 1.47% 149 474101 2.95% 150 3015393 18.73% 151 10425996 64.77% 16095812 reads passed initial QC criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=5.67 fanout-score-rank=23 prefix-density=0.28 prefix-fanout=3.5 sequence=TCCTTGTCCTGGATCTTGGCCTT criterion=fanout-score sequence-density=0.08 sequence-density-rank=16 fanout-score=377.25 fanout-score-rank=1 prefix-density=0.91 prefix-fanout=32.6 sequence=CTTCTTCTTCTT criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=4.76 fanout-score-rank=23 prefix-density=0.28 prefix-fanout=3.6 sequence=TGCAAGTGCGGCAGTGGCTGCAA criterion=fanout-score sequence-density=0.08 sequence-density-rank=21 fanout-score=394.52 fanout-score-rank=1 prefix-density=0.96 prefix-fanout=32.4 sequence=AAGAAGAAGAAA SRR7180083 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 17:51:10 Started mapping on | Feb 10 17:51:10 Finished on | Feb 10 17:52:57 Mapping speed, Million of reads per hour | 541.54 Number of input reads | 16095812 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 15319884 Uniquely mapped reads % | 95.18% Average mapped length | 296.12 Number of splices: Total | 15433122 Number of splices: Annotated (sjdb) | 15143696 Number of splices: GT/AG | 15179121 Number of splices: GC/AG | 201732 Number of splices: AT/AC | 13024 Number of splices: Non-canonical | 39245 Mismatch rate per base, % | 0.32% Deletion rate per base | 0.03% Deletion average length | 2.72 Insertion rate per base | 0.02% Insertion average length | 2.70 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 359970 % of reads mapped to multiple loci | 2.24% Number of reads mapped to too many loci | 31747 % of reads mapped to too many loci | 0.20% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.32% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 422699 422699 422699 N_multimapping 359970 359970 359970 N_noFeature 352282 15179214 407901 N_ambiguous 166459 604 81154 UnstrandedReadsAssigned:14801143 PositiveStrandReadsAssigned:140066 NegativeStrandReadsAssigned:14830829 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7180083 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7180083-trimmed-pair1.fastq SRR7180083-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,095,812 reads, 14,707,125 reads pseudoaligned [quant] estimated average fragment length: 241.248 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,158 rounds 52401 SRR7180083.ke.tsv 34699 SRR7180083.se.tsv 87100 total ==> SRR7180083.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1777.75 966 38.1856 Potri.005G024800.1.v4.1 1035 794.752 164 14.5013 Potri.004G059700.1.v4.1 961 720.779 29 2.82741 Potri.007G009000.2.v4.1 1416 1175.75 0 0 Potri.003G141000.2.v4.1 2943 2702.75 586 15.2365 Potri.016G087400.1.v4.1 270 78.5457 1110 993.102 Potri.015G069301.1.v4.1 564 327.346 0 0 Potri.010G195200.1.v4.1 1773 1532.75 413 18.9353 Potri.012G127500.1.v4.1 977 736.759 9893 943.617 ==> SRR7180083.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 278 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 536 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 6684 Potri.001G452600.v4.1 246 SRR7180083 completed mapping pipeline successfully