Starting /dee2/code/volunteer_pipeline.sh SRR7180084 current disk space = 3057571098624 free memory = 1517957920 SRR7180084 SRAfilesize 75b3cf784736c076d410018a347e57cb SRR7180084.sra SRR7180084.sra file validated SRR7180084 is paired end SRR7180084 is conventional basespace SRR7180084 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7180084_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.60975 33.0 33.0 34.0 32.0 34.0 2 33.06725 34.0 33.0 34.0 32.0 34.0 3 32.20925 33.0 32.0 34.0 31.0 34.0 4 33.07075 33.0 33.0 34.0 32.0 34.0 5 33.03375 33.0 33.0 34.0 32.0 34.0 6 37.141 38.0 37.0 38.0 36.0 38.0 7 37.608 38.0 38.0 38.0 37.0 38.0 8 37.648 38.0 38.0 38.0 38.0 38.0 9 37.73025 38.0 38.0 38.0 38.0 38.0 10-14 37.7284 38.0 38.0 38.0 38.0 38.0 15-19 37.712900000000005 38.0 38.0 38.0 38.0 38.0 20-24 37.6785 38.0 38.0 38.0 38.0 38.0 25-29 37.67845 38.0 38.0 38.0 38.0 38.0 30-34 37.6579 38.0 38.0 38.0 38.0 38.0 35-39 37.64035 38.0 38.0 38.0 38.0 38.0 40-44 37.5638 38.0 38.0 38.0 38.0 38.0 45-49 37.569449999999996 38.0 38.0 38.0 38.0 38.0 50-54 37.5505 38.0 38.0 38.0 38.0 38.0 55-59 37.5043 38.0 38.0 38.0 37.8 38.0 60-64 37.511199999999995 38.0 38.0 38.0 38.0 38.0 65-69 37.44245 38.0 38.0 38.0 37.6 38.0 70-74 37.4029 38.0 38.0 38.0 37.0 38.0 75-79 37.3857 38.0 38.0 38.0 37.0 38.0 80-84 37.340199999999996 38.0 38.0 38.0 37.0 38.0 85-89 37.281800000000004 38.0 38.0 38.0 37.0 38.0 90-94 37.1613 38.0 38.0 38.0 36.4 38.0 95-99 37.13985 38.0 38.0 38.0 36.4 38.0 100-104 37.11145 38.0 38.0 38.0 36.4 38.0 105-109 36.97805 38.0 38.0 38.0 36.0 38.0 110-114 36.94670000000001 38.0 38.0 38.0 35.8 38.0 115-119 36.74720000000001 38.0 38.0 38.0 35.0 38.0 120-124 36.6707 38.0 38.0 38.0 35.0 38.0 125-129 36.543400000000005 38.0 38.0 38.0 34.4 38.0 130-134 36.335899999999995 38.0 38.0 38.0 34.0 38.0 135-139 36.20295 38.0 38.0 38.0 33.8 38.0 140-144 36.0375 38.0 38.0 38.0 33.4 38.0 145-149 35.70695 38.0 36.6 38.0 33.0 38.0 150-151 32.959374999999994 37.0 33.5 38.0 17.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 4 1.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 1.0 14 0.0 15 1.0 16 2.0 17 1.0 18 2.0 19 2.0 20 2.0 21 0.0 22 3.0 23 6.0 24 2.0 25 3.0 26 9.0 27 13.0 28 16.0 29 18.0 30 23.0 31 30.0 32 27.0 33 50.0 34 79.0 35 146.0 36 410.0 37 3153.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.65560491246407 12.934413378625557 14.528351188920826 38.88163051998955 2 20.45 17.95 39.0 22.6 3 19.625 24.0 27.950000000000003 28.425 4 21.525 31.674999999999997 22.925 23.875 5 21.725 34.9 24.5 18.875 6 17.4 34.449999999999996 28.075 20.075000000000003 7 13.350000000000001 23.575 43.475 19.6 8 18.475 23.525 30.725 27.275 9 17.275 24.45 33.1 25.174999999999997 10-14 19.885 29.134999999999998 27.575 23.405 15-19 19.375 28.73 28.255000000000003 23.64 20-24 20.22 28.685 28.194999999999997 22.900000000000002 25-29 19.765 28.560000000000002 28.535 23.14 30-34 19.75 28.46 27.985 23.805 35-39 19.785 28.025 28.139999999999997 24.05 40-44 19.425 29.13 27.87 23.575 45-49 19.72 28.43 28.27 23.580000000000002 50-54 19.53 28.660000000000004 28.475 23.335 55-59 19.91 28.549999999999997 27.98 23.56 60-64 20.445 27.865000000000002 27.705000000000002 23.985 65-69 20.22 28.335 27.905 23.54 70-74 19.66 28.12 28.23 23.990000000000002 75-79 19.605 28.67 28.175 23.549999999999997 80-84 20.14 28.16 27.88 23.82 85-89 20.11 27.41 28.315 24.165 90-94 20.625 27.87 28.005000000000003 23.5 95-99 20.66 27.694999999999997 28.02 23.625 100-104 20.09 28.425 28.17 23.315 105-109 20.13 28.305000000000003 27.994999999999997 23.57 110-114 20.755000000000003 28.189999999999998 27.765 23.29 115-119 20.755000000000003 28.21 27.37 23.665 120-124 20.369999999999997 28.21 27.92 23.5 125-129 20.49 27.575 28.15 23.785 130-134 20.785 27.875 27.505000000000003 23.835 135-139 20.905 28.165000000000003 26.735 24.195 140-144 20.8 28.110000000000003 27.215 23.875 145-149 20.965 29.099999999999998 26.405 23.53 150-151 20.0375 28.075 27.275 24.6125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 1.0 17 1.0 18 0.5 19 0.0 20 1.0 21 1.0 22 0.5 23 1.5 24 2.5 25 6.0 26 9.5 27 13.0 28 20.0 29 21.0 30 18.5 31 25.0 32 37.5 33 47.0 34 63.0 35 88.5 36 97.5 37 102.0 38 128.5 39 164.0 40 204.0 41 228.5 42 246.0 43 273.0 44 278.0 45 266.5 46 268.0 47 249.5 48 205.5 49 169.0 50 147.0 51 132.5 52 109.5 53 83.0 54 61.5 55 50.0 56 45.5 57 35.5 58 22.5 59 18.0 60 14.0 61 10.0 62 9.0 63 8.5 64 4.0 65 1.5 66 2.0 67 1.5 68 2.0 69 1.0 70 0.5 71 1.0 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.324999999999999 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.225 #Duplication Level Percentage of deduplicated Percentage of total 1 99.21894683799447 98.45 2 0.781053162005543 1.55 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0125 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.037500000000000006 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.0625 0.0 0.0 0.0 0.0 88-89 0.0875 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.125 0.0 0.0 0.0 0.0 96-97 0.175 0.0 0.0 0.0 0.0 98-99 0.2 0.0 0.0 0.0 0.0 100-101 0.275 0.0 0.0 0.0 0.0 102-103 0.4 0.0 0.0 0.0 0.0 104-105 0.55 0.0 0.0 0.0 0.0 106-107 0.75 0.0 0.0 0.0 0.0 108-109 0.8625 0.0 0.0 0.0 0.0 110-111 1.05 0.0 0.0 0.0 0.0 112-113 1.125 0.0 0.0 0.0 0.0 114-115 1.25 0.0 0.0 0.0 0.0 116-117 1.3625 0.0 0.0 0.0 0.0 118-119 1.5625 0.0 0.0 0.0 0.0 120-121 1.8625 0.0 0.0 0.0 0.0 122-123 2.175 0.0 0.0 0.0 0.0 124-125 2.325 0.0 0.0 0.0 0.0 126-127 2.7375 0.0 0.0 0.0 0.0 128-129 3.0625 0.0 0.0 0.0 0.0 130-131 3.425 0.0 0.0 0.0 0.0 132-133 4.0125 0.0 0.0 0.0 0.0 134-135 4.475 0.0 0.0 0.0 0.0 136-137 5.0875 0.0 0.0 0.0 0.0 138-139 5.775 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTGCTAT 10 0.0060887975 150.61038 1 >>END_MODULE SRR7180084 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7180084_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.185 34.0 33.0 34.0 33.0 34.0 2 33.20525 34.0 33.0 34.0 33.0 34.0 3 33.3255 34.0 33.0 34.0 33.0 34.0 4 33.3035 34.0 33.0 34.0 33.0 34.0 5 33.33875 34.0 33.0 34.0 33.0 34.0 6 37.52725 38.0 38.0 38.0 38.0 38.0 7 37.5215 38.0 38.0 38.0 38.0 38.0 8 37.469 38.0 38.0 38.0 38.0 38.0 9 37.44425 38.0 38.0 38.0 38.0 38.0 10-14 37.448499999999996 38.0 38.0 38.0 38.0 38.0 15-19 37.497350000000004 38.0 38.0 38.0 38.0 38.0 20-24 37.43315 38.0 38.0 38.0 38.0 38.0 25-29 37.43835 38.0 38.0 38.0 38.0 38.0 30-34 37.41185 38.0 38.0 38.0 38.0 38.0 35-39 37.34955 38.0 38.0 38.0 37.8 38.0 40-44 37.331649999999996 38.0 38.0 38.0 37.6 38.0 45-49 37.37425 38.0 38.0 38.0 38.0 38.0 50-54 37.32145 38.0 38.0 38.0 37.6 38.0 55-59 37.268449999999994 38.0 38.0 38.0 37.0 38.0 60-64 37.248400000000004 38.0 38.0 38.0 37.0 38.0 65-69 37.19949999999999 38.0 38.0 38.0 37.0 38.0 70-74 37.13290000000001 38.0 38.0 38.0 36.8 38.0 75-79 37.103899999999996 38.0 38.0 38.0 37.0 38.0 80-84 37.088499999999996 38.0 38.0 38.0 36.8 38.0 85-89 36.926249999999996 38.0 38.0 38.0 36.2 38.0 90-94 36.797850000000004 38.0 38.0 38.0 36.0 38.0 95-99 36.807249999999996 38.0 38.0 38.0 36.0 38.0 100-104 36.66495 38.0 38.0 38.0 35.2 38.0 105-109 36.4114 38.0 38.0 38.0 34.2 38.0 110-114 36.3757 38.0 38.0 38.0 34.0 38.0 115-119 36.39035 38.0 38.0 38.0 34.0 38.0 120-124 36.1599 38.0 38.0 38.0 34.0 38.0 125-129 35.99524999999999 38.0 37.6 38.0 33.2 38.0 130-134 35.770799999999994 38.0 37.0 38.0 32.8 38.0 135-139 35.611599999999996 38.0 36.2 38.0 32.4 38.0 140-144 35.21445 38.0 36.0 38.0 31.0 38.0 145-149 34.802949999999996 38.0 35.8 38.0 29.0 38.0 150-151 30.908875 35.5 30.0 38.0 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 3.0 4 1.0 5 3.0 6 1.0 7 1.0 8 1.0 9 0.0 10 1.0 11 1.0 12 1.0 13 2.0 14 0.0 15 0.0 16 2.0 17 2.0 18 4.0 19 3.0 20 2.0 21 1.0 22 10.0 23 5.0 24 11.0 25 15.0 26 5.0 27 17.0 28 14.0 29 20.0 30 30.0 31 34.0 32 52.0 33 61.0 34 95.0 35 179.0 36 484.0 37 2936.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.883720930232556 14.753688422105526 18.454613653413354 31.90797699424856 2 23.75 21.625 37.375 17.25 3 21.925 25.5 30.825000000000003 21.75 4 23.65 33.35 23.75 19.25 5 23.974999999999998 34.325 22.95 18.75 6 18.099999999999998 38.4 24.65 18.85 7 18.625 18.25 42.449999999999996 20.674999999999997 8 20.875 24.5 28.050000000000004 26.575 9 23.25 25.0 28.975 22.775000000000002 10-14 23.925 28.255000000000003 25.945 21.875 15-19 22.830000000000002 28.325 27.66 21.185000000000002 20-24 23.405 28.37 26.93 21.295 25-29 23.515 28.7 27.005000000000003 20.78 30-34 23.995 28.92 26.685 20.4 35-39 23.494999999999997 28.335 27.6 20.57 40-44 23.53 28.425 27.37 20.674999999999997 45-49 23.265 28.73 27.295 20.71 50-54 23.57 28.544999999999998 27.22 20.665 55-59 23.72 28.63 27.089999999999996 20.560000000000002 60-64 23.630000000000003 28.26 27.589999999999996 20.52 65-69 23.855 27.700000000000003 27.82 20.625 70-74 24.065 28.37 27.034999999999997 20.53 75-79 23.799999999999997 28.139999999999997 27.82 20.24 80-84 24.09 27.66 27.605 20.645 85-89 23.735 27.66 27.884999999999998 20.72 90-94 23.64 28.405 27.465 20.49 95-99 24.14 27.615000000000002 27.66 20.585 100-104 23.955000000000002 28.605000000000004 27.375 20.064999999999998 105-109 23.52 28.175 28.095 20.21 110-114 23.86 28.384999999999998 27.605 20.150000000000002 115-119 24.3 28.294999999999998 27.485 19.919999999999998 120-124 24.044999999999998 27.96 27.855 20.14 125-129 24.18 28.275 27.515 20.03 130-134 24.38 28.000000000000004 27.55 20.07 135-139 24.54 28.744999999999997 27.185 19.53 140-144 24.959999999999997 28.48 26.965 19.595000000000002 145-149 25.455 28.465 26.695 19.384999999999998 150-151 25.422033262473427 28.435663373765163 27.747905464549206 18.394397899212205 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.5 3 1.0 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.5 23 1.0 24 1.0 25 2.5 26 4.0 27 5.5 28 6.0 29 9.0 30 12.5 31 13.0 32 20.0 33 27.0 34 34.0 35 53.5 36 77.5 37 89.5 38 114.5 39 158.0 40 182.5 41 216.5 42 255.5 43 278.0 44 297.5 45 311.5 46 297.5 47 268.0 48 243.5 49 202.5 50 176.5 51 160.0 52 115.5 53 86.5 54 77.0 55 56.5 56 33.0 57 23.5 58 23.5 59 16.5 60 10.5 61 7.5 62 10.0 63 8.5 64 3.5 65 2.5 66 2.0 67 1.0 68 0.0 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0375 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.175 #Duplication Level Percentage of deduplicated Percentage of total 1 99.19334509705067 98.375 2 0.7814469372321654 1.55 3 0.025207965717166627 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0125 0.0 0.0 0.0 0.0 78-79 0.037500000000000006 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.0625 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.0875 0.0 0.0 0.0 0.0 88-89 0.1125 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.15 0.0 0.0 0.0 0.0 96-97 0.2 0.0 0.0 0.0 0.0 98-99 0.225 0.0 0.0 0.0 0.0 100-101 0.30000000000000004 0.0 0.0 0.0 0.0 102-103 0.425 0.0 0.0 0.0 0.0 104-105 0.575 0.0 0.0 0.0 0.0 106-107 0.775 0.0 0.0 0.0 0.0 108-109 0.8875 0.0 0.0 0.0 0.0 110-111 1.05 0.0 0.0 0.0 0.0 112-113 1.125 0.0 0.0 0.0 0.0 114-115 1.25 0.0 0.0 0.0 0.0 116-117 1.3625 0.0 0.0 0.0 0.0 118-119 1.575 0.0 0.0 0.0 0.0 120-121 1.8625 0.0 0.0 0.0 0.0 122-123 2.175 0.0 0.0 0.0 0.0 124-125 2.325 0.0 0.0 0.0 0.0 126-127 2.7375 0.0 0.0 0.0 0.0 128-129 3.0625 0.0 0.0 0.0 0.0 130-131 3.4375 0.0 0.0 0.0 0.0 132-133 4.0375 0.0 0.0 0.0 0.0 134-135 4.5 0.0 0.0 0.0 0.0 136-137 5.1125 0.0 0.0 0.0 0.0 138-139 5.800000000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAAGCTC 10 0.006830828 145.0 3 >>END_MODULE Read 611715 spots for SRR7180084.sra Written 611715 spots for SRR7180084.sra Read 611715 spots for SRR7180084.sra Written 611715 spots for SRR7180084.sra Read 611715 spots for SRR7180084.sra Written 611715 spots for SRR7180084.sra Read 611715 spots for SRR7180084.sra Written 611715 spots for SRR7180084.sra Read 611715 spots for SRR7180084.sra Written 611715 spots for SRR7180084.sra Read 611715 spots for SRR7180084.sra Written 611715 spots for SRR7180084.sra Read 611715 spots for SRR7180084.sra Written 611715 spots for SRR7180084.sra Read 611715 spots for SRR7180084.sra Written 611715 spots for SRR7180084.sra Read 611715 spots for SRR7180084.sra Written 611715 spots for SRR7180084.sra Read 611715 spots for SRR7180084.sra Written 611715 spots for SRR7180084.sra Read 611715 spots for SRR7180084.sra Written 611715 spots for SRR7180084.sra Read 611715 spots for SRR7180084.sra Written 611715 spots for SRR7180084.sra Read 611715 spots for SRR7180084.sra Written 611715 spots for SRR7180084.sra Read 611715 spots for SRR7180084.sra Written 611715 spots for SRR7180084.sra Read 611715 spots for SRR7180084.sra Written 611715 spots for SRR7180084.sra Read 611715 spots for SRR7180084.sra Written 611715 spots for SRR7180084.sra Read 611715 spots for SRR7180084.sra Written 611715 spots for SRR7180084.sra Read 611715 spots for SRR7180084.sra Written 611715 spots for SRR7180084.sra Read 611715 spots for SRR7180084.sra Written 611715 spots for SRR7180084.sra Read 611731 spots for SRR7180084.sra Written 611731 spots for SRR7180084.sra SRR ids: ['SRR7180084.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_bkeqxddz SRR7180084.sra spots: 12234316 blocks: [[1, 611715], [611716, 1223430], [1223431, 1835145], [1835146, 2446860], [2446861, 3058575], [3058576, 3670290], [3670291, 4282005], [4282006, 4893720], [4893721, 5505435], [5505436, 6117150], [6117151, 6728865], [6728866, 7340580], [7340581, 7952295], [7952296, 8564010], [8564011, 9175725], [9175726, 9787440], [9787441, 10399155], [10399156, 11010870], [11010871, 11622585], [11622586, 12234316]] SRR7180084 file size 4124107 SRR7180084 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7180084 SRR7180084_1.fastq SRR7180084_2.fastq Input file: SRR7180084_1.fastq Paired file: SRR7180084_2.fastq trimmed: SRR7180084-trimmed-pair1.fastq, SRR7180084-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 18:25:13 2025 >> started Mon Feb 10 18:25:27 2025 >> done (13.409s) 12234316 read pairs processed; of these: 12090 ( 0.10%) short read pairs filtered out after trimming by size control 10415 ( 0.09%) empty read pairs filtered out after trimming by size control 12211811 (99.82%) read pairs available; of these: 4210701 (34.48%) trimmed read pairs available after processing 8001110 (65.52%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 0 0.00% 20 0 0.00% 21 0 0.00% 22 2 0.00% 23 1 0.00% 24 0 0.00% 25 2 0.00% 26 5 0.00% 27 1 0.00% 28 0 0.00% 29 5 0.00% 30 3 0.00% 31 3 0.00% 32 6 0.00% 33 3 0.00% 34 0 0.00% 35 6 0.00% 36 4 0.00% 37 1 0.00% 38 4 0.00% 39 3 0.00% 40 3 0.00% 41 5 0.00% 42 7 0.00% 43 5 0.00% 44 4 0.00% 45 8 0.00% 46 3 0.00% 47 18 0.00% 48 8 0.00% 49 13 0.00% 50 16 0.00% 51 13 0.00% 52 28 0.00% 53 23 0.00% 54 22 0.00% 55 17 0.00% 56 26 0.00% 57 14 0.00% 58 21 0.00% 59 41 0.00% 60 37 0.00% 61 50 0.00% 62 39 0.00% 63 55 0.00% 64 57 0.00% 65 62 0.00% 66 54 0.00% 67 83 0.00% 68 85 0.00% 69 100 0.00% 70 129 0.00% 71 142 0.00% 72 155 0.00% 73 185 0.00% 74 209 0.00% 75 279 0.00% 76 291 0.00% 77 334 0.00% 78 381 0.00% 79 414 0.00% 80 506 0.00% 81 582 0.00% 82 658 0.01% 83 855 0.01% 84 1332 0.01% 85 1830 0.01% 86 1949 0.02% 87 2252 0.02% 88 2392 0.02% 89 2581 0.02% 90 2814 0.02% 91 2868 0.02% 92 3160 0.03% 93 3258 0.03% 94 3431 0.03% 95 3875 0.03% 96 4045 0.03% 97 4319 0.04% 98 4644 0.04% 99 4992 0.04% 100 5449 0.04% 101 5865 0.05% 102 6440 0.05% 103 6863 0.06% 104 7507 0.06% 105 7858 0.06% 106 8687 0.07% 107 9569 0.08% 108 10011 0.08% 109 10831 0.09% 110 11514 0.09% 111 12146 0.10% 112 12925 0.11% 113 13545 0.11% 114 14569 0.12% 115 15508 0.13% 116 16423 0.13% 117 17868 0.15% 118 19143 0.16% 119 19831 0.16% 120 21222 0.17% 121 22226 0.18% 122 23206 0.19% 123 23773 0.19% 124 25296 0.21% 125 26272 0.22% 126 27710 0.23% 127 28848 0.24% 128 30299 0.25% 129 31743 0.26% 130 33985 0.28% 131 35125 0.29% 132 36993 0.30% 133 38903 0.32% 134 40142 0.33% 135 42266 0.35% 136 44385 0.36% 137 46886 0.38% 138 49861 0.41% 139 52708 0.43% 140 55617 0.46% 141 59237 0.49% 142 63246 0.52% 143 67777 0.56% 144 74632 0.61% 145 83946 0.69% 146 97062 0.79% 147 119638 0.98% 148 167965 1.38% 149 317056 2.60% 150 2134295 17.48% 151 8001110 65.52% 12211811 reads passed initial QC criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=5.03 fanout-score-rank=16 prefix-density=0.47 prefix-fanout=2.7 sequence=CACTTGCAGCCATTCTCAGCACC criterion=fanout-score sequence-density=0.01 sequence-density-rank=29 fanout-score=41.88 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=5.2 sequence=AATGCCTCAAGAACTCAGAATCATAACCCCATGACATTTATTCAAGGAAAAAATAAAAGGAAAAAACAAATAGCTGAAAAGAACTACTTCTCTTCAGCTTCCTCGTCCTTCTCATCCTCACTCCAACAACATTTCAGGATAGACCTGGGAGATGCACTGCCTCCAGTCCTTGCAAAGCTGTGGTAGATGATCGATCCACCTTTCCCAAGCATTTCATAGTTCCCTCCTCCGCCAGAGTAACCTTCCACGTCCAGGGGAAACTTTGCTCTAAGTTCGGCACCCTTGATATTAGAATGCAAGGCAACGGAGAACATGGTCGGTTCAAAGCAAGCCAAGACCCTTTCAAGCAGCCGACTCAAATTCAAATCT criterion=sequence-density sequence-density=0.32 sequence-density-rank=1 fanout-score=2.50 fanout-score-rank=28 prefix-density=0.33 prefix-fanout=2.5 sequence=ATGTACCCTGACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=27 fanout-score=276.17 fanout-score-rank=1 prefix-density=0.19 prefix-fanout=12.6 sequence=TTTCTTTGAGAGTGCATAGATTTGTGTTGATATAGAAAACAATGGCACTACATGGAAAGATTGAGACAACATTAGAACTCAAGTCCTCCGCAGAGAAGTTCTACAAAGTGTGGAGGAGCCAGTCCTTCCATGTTCCCAAACATGCTTCCAAGCATATCCAAGGAGTTGATATACATGCAGGTGACTGGGAGACTGCGGGCTCTATCAGGATTTGGCAGTACACAATCGGAGGGAAAGCCGGGGTCTTTAAAGAGGAGGTTTCCTTCGATGATGAGAACAAGATCATAACTCTTAATGGTTTGGAAGGAGATGTCATGAAAATTTACAAGGTCTATAGGCCCGTCTGGCAGCTTACACCAAAAGGCTCGGGCTGCTTGGCAAAACTGACCATTGAATACGAAAAACTCCATCCTGAAGTCCCGGTTCCAGAGATTTATGTTGATCTTATGGTTCATATGACTAAAGACATCGACGAAGCCCTTAGCACGGAGTAATAGAAGGGGTCATCGAT SRR7180084 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 18:26:15 Started mapping on | Feb 10 18:26:15 Finished on | Feb 10 18:28:13 Mapping speed, Million of reads per hour | 372.56 Number of input reads | 12211811 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 11177833 Uniquely mapped reads % | 91.53% Average mapped length | 295.96 Number of splices: Total | 10234457 Number of splices: Annotated (sjdb) | 9999449 Number of splices: GT/AG | 10062589 Number of splices: GC/AG | 128569 Number of splices: AT/AC | 8181 Number of splices: Non-canonical | 35118 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.03% Deletion average length | 2.72 Insertion rate per base | 0.02% Insertion average length | 2.46 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 314608 % of reads mapped to multiple loci | 2.58% Number of reads mapped to too many loci | 39033 % of reads mapped to too many loci | 0.32% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.49% % of reads unmapped: other | 0.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 730668 730668 730668 N_multimapping 314608 314608 314608 N_noFeature 305638 11067542 350121 N_ambiguous 129757 568 63611 UnstrandedReadsAssigned:10742438 PositiveStrandReadsAssigned:109723 NegativeStrandReadsAssigned:10764101 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7180084 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7180084-trimmed-pair1.fastq SRR7180084-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,211,811 reads, 10,726,299 reads pseudoaligned [quant] estimated average fragment length: 211.856 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,133 rounds 52401 SRR7180084.ke.tsv 34699 SRR7180084.se.tsv 87100 total ==> SRR7180084.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1807.14 1509 73.291 Potri.005G024800.1.v4.1 1035 824.144 1759 187.334 Potri.004G059700.1.v4.1 961 750.144 2 0.234013 Potri.007G009000.2.v4.1 1416 1205.14 0 0 Potri.003G141000.2.v4.1 2943 2732.14 371.208 11.9253 Potri.016G087400.1.v4.1 270 79.3778 967 1069.26 Potri.015G069301.1.v4.1 564 353.481 0 0 Potri.010G195200.1.v4.1 1773 1562.14 835 46.9158 Potri.012G127500.1.v4.1 977 766.144 4336 496.744 ==> SRR7180084.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 0 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 518 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 375 SRR7180084 completed mapping pipeline successfully