Starting /dee2/code/volunteer_pipeline.sh SRR7180085 current disk space = 2818737569792 free memory = 1463540376 SRR7180085 SRAfilesize d443cc5e2163cea4962d56f6dc269a28 SRR7180085.sra SRR7180085.sra file validated SRR7180085 is paired end SRR7180085 is conventional basespace SRR7180085 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7180085_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.8665 33.0 33.0 34.0 32.0 34.0 2 32.6265 33.0 33.0 34.0 31.0 34.0 3 31.866 33.0 31.0 33.0 29.0 34.0 4 32.19975 33.0 33.0 33.0 31.0 34.0 5 32.66875 33.0 33.0 34.0 31.0 34.0 6 36.9805 38.0 37.0 38.0 35.0 38.0 7 37.42 38.0 38.0 38.0 37.0 38.0 8 37.49875 38.0 38.0 38.0 37.0 38.0 9 37.6375 38.0 38.0 38.0 38.0 38.0 10-14 37.68675 38.0 38.0 38.0 38.0 38.0 15-19 37.653200000000005 38.0 38.0 38.0 38.0 38.0 20-24 37.64825 38.0 38.0 38.0 38.0 38.0 25-29 37.66005 38.0 38.0 38.0 38.0 38.0 30-34 37.632 38.0 38.0 38.0 38.0 38.0 35-39 37.6243 38.0 38.0 38.0 38.0 38.0 40-44 37.60225 38.0 38.0 38.0 38.0 38.0 45-49 37.54965 38.0 38.0 38.0 38.0 38.0 50-54 37.53195 38.0 38.0 38.0 38.0 38.0 55-59 37.514849999999996 38.0 38.0 38.0 37.0 38.0 60-64 37.45805 38.0 38.0 38.0 37.4 38.0 65-69 37.41925 38.0 38.0 38.0 37.0 38.0 70-74 37.395799999999994 38.0 38.0 38.0 37.0 38.0 75-79 37.3213 38.0 38.0 38.0 37.0 38.0 80-84 37.350049999999996 38.0 38.0 38.0 37.0 38.0 85-89 37.27645 38.0 38.0 38.0 37.0 38.0 90-94 37.2043 38.0 38.0 38.0 36.8 38.0 95-99 37.1586 38.0 38.0 38.0 36.2 38.0 100-104 37.05550000000001 38.0 38.0 38.0 36.0 38.0 105-109 36.92295 38.0 38.0 38.0 35.6 38.0 110-114 36.87305 38.0 38.0 38.0 35.2 38.0 115-119 36.76625 38.0 38.0 38.0 35.0 38.0 120-124 36.609750000000005 38.0 38.0 38.0 34.4 38.0 125-129 36.5607 38.0 38.0 38.0 34.6 38.0 130-134 36.381099999999996 38.0 38.0 38.0 34.0 38.0 135-139 36.1897 38.0 37.8 38.0 33.4 38.0 140-144 35.98950000000001 38.0 37.6 38.0 33.0 38.0 145-149 35.58155000000001 38.0 36.2 38.0 32.2 38.0 150-151 32.660125 36.5 33.5 38.0 16.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 1.0 16 2.0 17 0.0 18 0.0 19 1.0 20 3.0 21 1.0 22 1.0 23 2.0 24 3.0 25 4.0 26 4.0 27 9.0 28 12.0 29 18.0 30 35.0 31 31.0 32 37.0 33 76.0 34 83.0 35 170.0 36 484.0 37 3022.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.246249353336783 18.882565959648215 10.501810657009829 42.369374030005176 2 17.2 25.75 31.025000000000002 26.025 3 18.375 29.025000000000002 25.05 27.55 4 22.525000000000002 34.599999999999994 21.075 21.8 5 23.05 35.125 23.25 18.575 6 16.775000000000002 35.75 25.775 21.7 7 13.875000000000002 21.15 43.525000000000006 21.45 8 17.849999999999998 22.075 29.775000000000002 30.3 9 16.8 22.35 34.75 26.1 10-14 19.785 29.37 26.515 24.33 15-19 19.855 28.12 27.98 24.044999999999998 20-24 19.435 28.785 28.005000000000003 23.775 25-29 19.305 28.915000000000003 28.005000000000003 23.775 30-34 19.73 29.085 27.985 23.200000000000003 35-39 19.794999999999998 28.12 28.02 24.065 40-44 19.915 28.560000000000002 27.689999999999998 23.835 45-49 20.005 28.050000000000004 28.03 23.915 50-54 20.05 28.71 27.735 23.505000000000003 55-59 19.515 28.144999999999996 28.144999999999996 24.195 60-64 19.62 27.93 28.465 23.985 65-69 19.61 27.865000000000002 28.395 24.13 70-74 19.475 29.17 27.625 23.73 75-79 19.52 27.71 28.405 24.365000000000002 80-84 19.84 28.215 28.139999999999997 23.805 85-89 20.294999999999998 27.92 27.715 24.07 90-94 20.01 27.894999999999996 28.439999999999998 23.655 95-99 19.994999999999997 27.950000000000003 27.955000000000002 24.099999999999998 100-104 19.830000000000002 28.015 28.15 24.005000000000003 105-109 20.03 28.605000000000004 27.785 23.580000000000002 110-114 20.330000000000002 27.725 28.444999999999997 23.5 115-119 20.385 28.065 27.67 23.880000000000003 120-124 19.855 28.17 27.66 24.315 125-129 20.72 28.28 27.195000000000004 23.805 130-134 20.03 28.48 27.305 24.185000000000002 135-139 20.41 27.705000000000002 27.994999999999997 23.89 140-144 20.275000000000002 28.175 27.560000000000002 23.990000000000002 145-149 20.62 28.910000000000004 27.365000000000002 23.105 150-151 21.099999999999998 28.5625 27.0125 23.325000000000003 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.5 17 1.0 18 0.5 19 0.5 20 0.5 21 0.0 22 1.5 23 3.5 24 3.0 25 2.0 26 4.0 27 7.0 28 7.5 29 12.5 30 18.0 31 20.0 32 29.5 33 42.0 34 52.0 35 64.0 36 81.5 37 113.0 38 148.0 39 177.5 40 205.5 41 227.0 42 250.0 43 280.0 44 286.0 45 293.0 46 277.0 47 246.0 48 235.0 49 191.0 50 148.0 51 135.0 52 114.0 53 84.0 54 58.5 55 39.0 56 34.5 57 30.5 58 21.5 59 14.0 60 9.5 61 6.5 62 5.5 63 4.5 64 4.5 65 3.5 66 2.5 67 2.0 68 1.0 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.35 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.825 #Duplication Level Percentage of deduplicated Percentage of total 1 99.82469321312296 99.65 2 0.1753067868770348 0.35000000000000003 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0125 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.037500000000000006 0.0 0.0 0.0 0.0 86-87 0.0625 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.15 0.0 0.0 0.0 0.0 96-97 0.175 0.0 0.0 0.0 0.0 98-99 0.25 0.0 0.0 0.0 0.0 100-101 0.325 0.0 0.0 0.0 0.0 102-103 0.4125 0.0 0.0 0.0 0.0 104-105 0.5375000000000001 0.0 0.0 0.0 0.0 106-107 0.6499999999999999 0.0 0.0 0.0 0.0 108-109 0.8125 0.0 0.0 0.0 0.0 110-111 0.95 0.0 0.0 0.0 0.0 112-113 1.2125 0.0 0.0 0.0 0.0 114-115 1.35 0.0 0.0 0.0 0.0 116-117 1.5125000000000002 0.0 0.0 0.0 0.0 118-119 1.7125 0.0 0.0 0.0 0.0 120-121 1.7875 0.0 0.0 0.0 0.0 122-123 1.9375 0.0 0.0 0.0 0.0 124-125 2.2249999999999996 0.0 0.0 0.0 0.0 126-127 2.375 0.0 0.0 0.0 0.0 128-129 2.825 0.0 0.0 0.0 0.0 130-131 3.075 0.0 0.0 0.0 0.0 132-133 3.325 0.0 0.0 0.0 0.0 134-135 3.7125 0.0 0.0 0.0 0.0 136-137 4.15 0.0 0.0 0.0 0.0 138-139 4.4375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTGAGCC 10 0.0068378756 144.95 7 TATCTCG 10 0.0068378756 144.95 145 >>END_MODULE SRR7180085 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7180085_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.165 33.0 33.0 34.0 33.0 34.0 2 33.26075 34.0 33.0 34.0 33.0 34.0 3 33.28275 34.0 33.0 34.0 33.0 34.0 4 33.2815 34.0 33.0 34.0 33.0 34.0 5 33.27675 34.0 33.0 34.0 33.0 34.0 6 37.47925 38.0 38.0 38.0 38.0 38.0 7 37.469 38.0 38.0 38.0 38.0 38.0 8 37.42775 38.0 38.0 38.0 37.0 38.0 9 37.463 38.0 38.0 38.0 38.0 38.0 10-14 37.4495 38.0 38.0 38.0 38.0 38.0 15-19 37.412600000000005 38.0 38.0 38.0 37.6 38.0 20-24 37.43485 38.0 38.0 38.0 38.0 38.0 25-29 37.40335 38.0 38.0 38.0 37.8 38.0 30-34 37.37820000000001 38.0 38.0 38.0 37.4 38.0 35-39 37.24250000000001 38.0 38.0 38.0 37.0 38.0 40-44 37.204950000000004 38.0 38.0 38.0 37.0 38.0 45-49 37.2322 38.0 38.0 38.0 37.0 38.0 50-54 37.24015 38.0 38.0 38.0 37.0 38.0 55-59 37.174350000000004 38.0 38.0 38.0 37.0 38.0 60-64 37.09605 38.0 38.0 38.0 36.4 38.0 65-69 37.029450000000004 38.0 38.0 38.0 36.0 38.0 70-74 36.9928 38.0 38.0 38.0 36.0 38.0 75-79 36.94355 38.0 38.0 38.0 36.0 38.0 80-84 36.95655 38.0 38.0 38.0 36.0 38.0 85-89 36.8642 38.0 38.0 38.0 35.8 38.0 90-94 36.7367 38.0 38.0 38.0 35.0 38.0 95-99 36.6262 38.0 38.0 38.0 34.8 38.0 100-104 36.3758 38.0 38.0 38.0 34.0 38.0 105-109 36.24295 38.0 38.0 38.0 34.0 38.0 110-114 36.2308 38.0 38.0 38.0 34.0 38.0 115-119 36.1212 38.0 37.6 38.0 33.6 38.0 120-124 35.8853 38.0 37.0 38.0 32.2 38.0 125-129 35.768449999999994 38.0 36.8 38.0 32.2 38.0 130-134 35.5065 38.0 36.0 38.0 30.6 38.0 135-139 35.25705000000001 38.0 36.0 38.0 30.4 38.0 140-144 34.76485 38.0 35.0 38.0 28.0 38.0 145-149 34.1935 38.0 35.0 38.0 25.6 38.0 150-151 30.3885 36.5 29.0 38.0 8.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 0.0 4 1.0 5 0.0 6 1.0 7 0.0 8 0.0 9 2.0 10 1.0 11 1.0 12 1.0 13 1.0 14 1.0 15 0.0 16 4.0 17 0.0 18 1.0 19 5.0 20 4.0 21 5.0 22 6.0 23 7.0 24 6.0 25 15.0 26 13.0 27 20.0 28 26.0 29 31.0 30 34.0 31 50.0 32 55.0 33 90.0 34 123.0 35 216.0 36 627.0 37 2651.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.225 16.8 15.925 28.050000000000004 2 24.725 21.975 35.35 17.95 3 21.625 26.224999999999998 31.2 20.95 4 24.625 35.675000000000004 21.925 17.775 5 23.7 37.375 22.15 16.775000000000002 6 19.654913728432106 37.15928982245561 23.680920230057513 19.504876219054765 7 19.0 17.175 42.95 20.875 8 20.9 22.775000000000002 29.075 27.250000000000004 9 22.15 24.775 28.375 24.7 10-14 23.582358235823584 28.252825282528253 25.972597259725973 22.19221922192219 15-19 23.1973197319732 27.887788778877887 27.402740274027405 21.512151215121513 20-24 22.828697218330998 28.50210126075645 27.37142285371223 21.29777866720032 25-29 23.240212275958747 28.276759787724043 27.866226093922098 20.616801842395112 30-34 23.096955128205128 28.70592948717949 27.59415064102564 20.602964743589745 35-39 23.38677354709419 28.111222444889776 27.760521042084168 20.741482965931866 40-44 22.943592826370104 29.140366696723774 27.30187355976355 20.61416691714257 45-49 23.09424896140948 28.915361129185648 27.634015716502326 20.35637419290255 50-54 22.962629446195407 28.56571114112762 27.55515533543449 20.916504077242486 55-59 23.581790895447725 27.903951975987994 28.244122061030513 20.27013506753377 60-64 23.56178089044522 28.16408204102051 27.55877938969485 20.715357678839418 65-69 23.915762092941826 28.507828522835275 27.507378320244108 20.06903106397879 70-74 23.486743371685844 28.179089544772385 27.933966983491747 20.400200100050025 75-79 23.5105797608924 28.127657445850634 27.982592166474912 20.379170626782052 80-84 23.971985992996498 27.983991995997997 27.6288144072036 20.415207603801903 85-89 23.770696813566104 28.68290730828873 27.447351308088642 20.099044570056527 90-94 24.40488097619524 28.240648129625924 27.510502100420087 19.84396879375875 95-99 24.276213810690532 28.221411070553525 27.841392069603483 19.66098304915246 100-104 23.91358703805571 28.804320648097214 27.509126368955343 19.772965944891734 105-109 23.986199309965496 28.021401070053503 27.901395069753487 20.091004550227513 110-114 24.099999999999998 28.560000000000002 27.315 20.025000000000002 115-119 24.381219060953047 27.971398569928496 27.986399319965997 19.66098304915246 120-124 24.479895979195838 28.505701140228044 27.770554110822165 19.243848769753953 125-129 24.130858886498924 28.537842028913012 27.167225251363114 20.16407383322495 130-134 24.345955680056026 28.352758741433643 27.592416587464356 19.70886899104597 135-139 24.95748724617385 28.653596078823647 27.308192457737324 19.08072421726518 140-144 24.80996199239848 28.855771154230847 26.880376075215047 19.453890778155632 145-149 24.413544740659233 27.839743910368632 27.604661631571048 20.14204971740109 150-151 24.796595318563025 27.93841532106647 27.93841532106647 19.32657403930404 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.5 19 0.5 20 0.0 21 0.5 22 0.5 23 0.5 24 2.0 25 1.5 26 1.0 27 2.5 28 4.0 29 7.5 30 10.0 31 17.5 32 25.5 33 26.5 34 32.5 35 49.5 36 68.0 37 102.0 38 140.5 39 174.5 40 208.5 41 248.5 42 286.0 43 300.0 44 304.0 45 287.5 46 267.0 47 267.0 48 242.0 49 189.5 50 151.0 51 126.5 52 109.0 53 87.0 54 68.5 55 53.5 56 38.5 57 22.0 58 16.0 59 16.5 60 11.0 61 6.5 62 4.5 63 4.5 64 4.0 65 3.5 66 2.0 67 2.0 68 2.0 69 1.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.025 7 0.0 8 0.0 9 0.0 10-14 0.01 15-19 0.01 20-24 0.06 25-29 0.13 30-34 0.16 35-39 0.2 40-44 0.19 45-49 0.105 50-54 0.055 55-59 0.05 60-64 0.05 65-69 0.045 70-74 0.05 75-79 0.045 80-84 0.05 85-89 0.045 90-94 0.02 95-99 0.005 100-104 0.015 105-109 0.005 110-114 0.0 115-119 0.005 120-124 0.02 125-129 0.045 130-134 0.045 135-139 0.03 140-144 0.02 145-149 0.034999999999999996 150-151 0.13749999999999998 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.5 #Duplication Level Percentage of deduplicated Percentage of total 1 99.52261306532664 99.02499999999999 2 0.4522613065326633 0.8999999999999999 3 0.02512562814070352 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0125 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.037500000000000006 0.0 0.0 0.0 0.0 86-87 0.0625 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.15 0.0 0.0 0.0 0.0 96-97 0.175 0.0 0.0 0.0 0.0 98-99 0.2375 0.0 0.0 0.0 0.0 100-101 0.3 0.0 0.0 0.0 0.0 102-103 0.3875 0.0 0.0 0.0 0.0 104-105 0.5125 0.0 0.0 0.0 0.0 106-107 0.625 0.0 0.0 0.0 0.0 108-109 0.8 0.0 0.0 0.0 0.0 110-111 0.95 0.0 0.0 0.0 0.0 112-113 1.2125 0.0 0.0 0.0 0.0 114-115 1.35 0.0 0.0 0.0 0.0 116-117 1.5 0.0 0.0 0.0 0.0 118-119 1.6875 0.0 0.0 0.0 0.0 120-121 1.75 0.0 0.0 0.0 0.0 122-123 1.8875000000000002 0.0 0.0 0.0 0.0 124-125 2.1500000000000004 0.0 0.0 0.0 0.0 126-127 2.3 0.0 0.0 0.0 0.0 128-129 2.725 0.0 0.0 0.0 0.0 130-131 2.975 0.0 0.0 0.0 0.0 132-133 3.2375 0.0 0.0 0.0 0.0 134-135 3.6375 0.0 0.0 0.0 0.0 136-137 4.075 0.0 0.0 0.0 0.0 138-139 4.3375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACTAACA 10 0.0068608476 144.78749 6 TGACCTT 10 0.0068608476 144.78749 8 AACTAAC 10 0.0068608476 144.78749 5 TTGACCT 10 0.0068608476 144.78749 7 >>END_MODULE Read 805060 spots for SRR7180085.sra Written 805060 spots for SRR7180085.sra Read 805060 spots for SRR7180085.sra Written 805060 spots for SRR7180085.sra Read 805060 spots for SRR7180085.sra Written 805060 spots for SRR7180085.sra Read 805060 spots for SRR7180085.sra Written 805060 spots for SRR7180085.sra Read 805060 spots for SRR7180085.sra Written 805060 spots for SRR7180085.sra Read 805060 spots for SRR7180085.sra Written 805060 spots for SRR7180085.sra Read 805060 spots for SRR7180085.sra Written 805060 spots for SRR7180085.sra Read 805060 spots for SRR7180085.sra Written 805060 spots for SRR7180085.sra Read 805060 spots for SRR7180085.sra Written 805060 spots for SRR7180085.sra Read 805060 spots for SRR7180085.sra Written 805060 spots for SRR7180085.sra Read 805060 spots for SRR7180085.sra Written 805060 spots for SRR7180085.sra Read 805060 spots for SRR7180085.sra Written 805060 spots for SRR7180085.sra Read 805060 spots for SRR7180085.sra Written 805060 spots for SRR7180085.sra Read 805060 spots for SRR7180085.sra Written 805060 spots for SRR7180085.sra Read 805060 spots for SRR7180085.sra Written 805060 spots for SRR7180085.sra Read 805060 spots for SRR7180085.sra Written 805060 spots for SRR7180085.sra Read 805060 spots for SRR7180085.sra Written 805060 spots for SRR7180085.sra Read 805060 spots for SRR7180085.sra Written 805060 spots for SRR7180085.sra Read 805060 spots for SRR7180085.sra Written 805060 spots for SRR7180085.sra Read 805065 spots for SRR7180085.sra Written 805065 spots for SRR7180085.sra SRR ids: ['SRR7180085.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_qtgrkxju SRR7180085.sra spots: 16101205 blocks: [[1, 805060], [805061, 1610120], [1610121, 2415180], [2415181, 3220240], [3220241, 4025300], [4025301, 4830360], [4830361, 5635420], [5635421, 6440480], [6440481, 7245540], [7245541, 8050600], [8050601, 8855660], [8855661, 9660720], [9660721, 10465780], [10465781, 11270840], [11270841, 12075900], [12075901, 12880960], [12880961, 13686020], [13686021, 14491080], [14491081, 15296140], [15296141, 16101205]] SRR7180085 file size 5434469 SRR7180085 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7180085 SRR7180085_1.fastq SRR7180085_2.fastq Input file: SRR7180085_1.fastq Paired file: SRR7180085_2.fastq trimmed: SRR7180085-trimmed-pair1.fastq, SRR7180085-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Apr 10 16:00:34 2025 >> started Thu Apr 10 16:00:55 2025 >> done (20.453s) 16101205 read pairs processed; of these: 14694 ( 0.09%) short read pairs filtered out after trimming by size control 6694 ( 0.04%) empty read pairs filtered out after trimming by size control 16079817 (99.87%) read pairs available; of these: 5683279 (35.34%) trimmed read pairs available after processing 10396538 (64.66%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 20 3 0.00% 21 2 0.00% 22 8 0.00% 23 4 0.00% 24 2 0.00% 25 4 0.00% 26 2 0.00% 27 5 0.00% 28 3 0.00% 29 4 0.00% 30 4 0.00% 31 4 0.00% 32 2 0.00% 33 3 0.00% 34 2 0.00% 35 4 0.00% 36 20 0.00% 37 15 0.00% 38 4 0.00% 39 9 0.00% 40 22 0.00% 41 19 0.00% 42 11 0.00% 43 5 0.00% 44 14 0.00% 45 50 0.00% 46 40 0.00% 47 80 0.00% 48 42 0.00% 49 53 0.00% 50 35 0.00% 51 105 0.00% 52 18 0.00% 53 30 0.00% 54 45 0.00% 55 100 0.00% 56 33 0.00% 57 44 0.00% 58 51 0.00% 59 72 0.00% 60 80 0.00% 61 76 0.00% 62 97 0.00% 63 92 0.00% 64 114 0.00% 65 140 0.00% 66 129 0.00% 67 163 0.00% 68 181 0.00% 69 217 0.00% 70 265 0.00% 71 259 0.00% 72 343 0.00% 73 400 0.00% 74 430 0.00% 75 533 0.00% 76 631 0.00% 77 715 0.00% 78 809 0.01% 79 848 0.01% 80 967 0.01% 81 1147 0.01% 82 1349 0.01% 83 1556 0.01% 84 2642 0.02% 85 3043 0.02% 86 3150 0.02% 87 3492 0.02% 88 3842 0.02% 89 4081 0.03% 90 4262 0.03% 91 4429 0.03% 92 4730 0.03% 93 5265 0.03% 94 5630 0.04% 95 6058 0.04% 96 6672 0.04% 97 6808 0.04% 98 7385 0.05% 99 7826 0.05% 100 8522 0.05% 101 8978 0.06% 102 9527 0.06% 103 10248 0.06% 104 10853 0.07% 105 11549 0.07% 106 12520 0.08% 107 13393 0.08% 108 14206 0.09% 109 14737 0.09% 110 15569 0.10% 111 16338 0.10% 112 17579 0.11% 113 18241 0.11% 114 19206 0.12% 115 20125 0.13% 116 21039 0.13% 117 22078 0.14% 118 23565 0.15% 119 24430 0.15% 120 25356 0.16% 121 27456 0.17% 122 27859 0.17% 123 29066 0.18% 124 29850 0.19% 125 30790 0.19% 126 32461 0.20% 127 34141 0.21% 128 35078 0.22% 129 36691 0.23% 130 38014 0.24% 131 40021 0.25% 132 42139 0.26% 133 43424 0.27% 134 45797 0.28% 135 48278 0.30% 136 50045 0.31% 137 53367 0.33% 138 55733 0.35% 139 59129 0.37% 140 62826 0.39% 141 67709 0.42% 142 73509 0.46% 143 80881 0.50% 144 90405 0.56% 145 104024 0.65% 146 124104 0.77% 147 160203 1.00% 148 235427 1.46% 149 467770 2.91% 150 3027194 18.83% 151 10396538 64.66% 16079817 reads passed initial QC criterion=sequence-density sequence-density=0.29 sequence-density-rank=1 fanout-score=3.97 fanout-score-rank=21 prefix-density=0.34 prefix-fanout=3.4 sequence=CCACATTTGCAGCCA criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=52.61 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=7.7 sequence=ACAAGAGGAGCGGGCCTAACCAGGCTAAAAACAGGGCAGTTAAACCAACATTAATACCACAACTATCTTAATTGCCACTGACTAGCAATAACAACACCCATTTCTAAAGAAAATATCTTATTCTGCAAATCTCAGACTCTTCTCCCTCGTTGTAAACAAGGAAGAGAAGTACTTGAGTTTGACATGTAGCAAATCAAAGTTTCTAGTGGTGCTTGTTTGCAACAGTGCACTGCTTTCTGATCTCACCCTTGGTACCGGTGAGTGGGTTGTTCTCAGAAAGAATGGTGATAGCCCTAGAAAACTCCTTAAAGAAGTAATCCTGACTCTTGGCCATTTTCTTCACGTAAGGCTTAGTTCTCTTGTCAGTGGCTAGTTGGTGATCCACTATCAACAAGCCCTTGTTGTCCAATATGTTTCTGTAGTAGTTGTTGTCTAGAACCATGGGTGTGCCTCTGTCATTCCTCACATATTGGACAGCTTTAGGGTCTGGGATTGAATCAGGGCACTTGTA criterion=sequence-density sequence-density=0.50 sequence-density-rank=1 fanout-score=3.98 fanout-score-rank=18 prefix-density=0.58 prefix-fanout=3.4 sequence=TGCAAGTGCGGCAGTGGCTGCAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=43.71 fanout-score-rank=1 prefix-density=0.15 prefix-fanout=3.6 sequence=TCTTTGAGAGTGCATAGATTTGTGTTGATATAGAAAACAATGGCACTACATGGAAAGATTGAGACAACATTAGAACTCAAGTCCTCCGCAGAGAAGTTCTACAAAGTGTGGAGGAGCCAGTCCTTCCATGTTCCCAAACATGCTTCCAAGCATATCCAAGGAGTTGATATACATGCAGGTGACTGGGAGACTGCGGGCTCTATCAGGATTTGGCAGTACACAATCGGAGGGAAAGCCGGGGTCTTTAAAGAGGAGGTTTCC SRR7180085 testing PE reads STAR mapping to Ensembl genome Started job on | Apr 10 16:01:39 Started mapping on | Apr 10 16:01:39 Finished on | Apr 10 16:03:37 Mapping speed, Million of reads per hour | 490.57 Number of input reads | 16079817 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 15036650 Uniquely mapped reads % | 93.51% Average mapped length | 295.87 Number of splices: Total | 14944217 Number of splices: Annotated (sjdb) | 14622653 Number of splices: GT/AG | 14702206 Number of splices: GC/AG | 189971 Number of splices: AT/AC | 12240 Number of splices: Non-canonical | 39800 Mismatch rate per base, % | 0.32% Deletion rate per base | 0.03% Deletion average length | 2.55 Insertion rate per base | 0.02% Insertion average length | 2.55 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 340924 % of reads mapped to multiple loci | 2.12% Number of reads mapped to too many loci | 36782 % of reads mapped to too many loci | 0.23% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.09% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 715109 715109 715109 N_multimapping 340924 340924 340924 N_noFeature 432266 14896833 491897 N_ambiguous 156317 1063 75502 UnstrandedReadsAssigned:14448067 PositiveStrandReadsAssigned:138754 NegativeStrandReadsAssigned:14469251 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7180085 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7180085-trimmed-pair1.fastq SRR7180085-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,079,817 reads, 14,370,924 reads pseudoaligned [quant] estimated average fragment length: 239.649 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,083 rounds 52401 SRR7180085.ke.tsv 34699 SRR7180085.se.tsv 87100 total ==> SRR7180085.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1779.35 1739 64.3905 Potri.005G024800.1.v4.1 1035 796.351 461 38.14 Potri.004G059700.1.v4.1 961 722.361 46 4.19554 Potri.007G009000.2.v4.1 1416 1177.35 0 0 Potri.003G141000.2.v4.1 2943 2704.35 893 21.7557 Potri.016G087400.1.v4.1 270 77.7368 1024 867.876 Potri.015G069301.1.v4.1 564 328.594 0 0 Potri.010G195200.1.v4.1 1773 1534.35 250 10.7349 Potri.012G127500.1.v4.1 977 738.356 10182 908.555 ==> SRR7180085.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 220 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 441 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 3 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 144 SRR7180085 completed mapping pipeline successfully