Starting /dee2/code/volunteer_pipeline.sh SRR7180086 current disk space = 3057359196160 free memory = 1529402968 SRR7180086 SRAfilesize 131dd0902165047f07f6e29801c5ade4 SRR7180086.sra SRR7180086.sra file validated SRR7180086 is paired end SRR7180086 is conventional basespace SRR7180086 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7180086_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.80875 33.0 33.0 33.0 32.0 34.0 2 32.20525 33.0 33.0 34.0 30.0 34.0 3 31.53475 33.0 31.0 33.0 28.0 34.0 4 31.38575 33.0 31.0 33.0 29.0 33.0 5 32.38875 33.0 33.0 33.0 31.0 34.0 6 36.5275 38.0 37.0 38.0 34.0 38.0 7 37.41975 38.0 38.0 38.0 37.0 38.0 8 37.457 38.0 38.0 38.0 37.0 38.0 9 37.61125 38.0 38.0 38.0 38.0 38.0 10-14 37.625099999999996 38.0 38.0 38.0 38.0 38.0 15-19 37.6187 38.0 38.0 38.0 38.0 38.0 20-24 37.63715 38.0 38.0 38.0 38.0 38.0 25-29 37.611450000000005 38.0 38.0 38.0 38.0 38.0 30-34 37.62199999999999 38.0 38.0 38.0 38.0 38.0 35-39 37.606 38.0 38.0 38.0 38.0 38.0 40-44 37.6071 38.0 38.0 38.0 38.0 38.0 45-49 37.5981 38.0 38.0 38.0 38.0 38.0 50-54 37.549400000000006 38.0 38.0 38.0 38.0 38.0 55-59 37.525099999999995 38.0 38.0 38.0 37.6 38.0 60-64 37.50195 38.0 38.0 38.0 37.2 38.0 65-69 37.492599999999996 38.0 38.0 38.0 37.2 38.0 70-74 37.4456 38.0 38.0 38.0 37.0 38.0 75-79 37.40905 38.0 38.0 38.0 37.0 38.0 80-84 37.349450000000004 38.0 38.0 38.0 37.0 38.0 85-89 37.2873 38.0 38.0 38.0 37.0 38.0 90-94 37.28435 38.0 38.0 38.0 36.8 38.0 95-99 37.2173 38.0 38.0 38.0 36.6 38.0 100-104 37.1238 38.0 38.0 38.0 36.0 38.0 105-109 37.003249999999994 38.0 38.0 38.0 36.0 38.0 110-114 36.9108 38.0 38.0 38.0 35.2 38.0 115-119 36.833999999999996 38.0 38.0 38.0 35.0 38.0 120-124 36.722950000000004 38.0 38.0 38.0 35.0 38.0 125-129 36.7028 38.0 38.0 38.0 35.0 38.0 130-134 36.4849 38.0 38.0 38.0 34.0 38.0 135-139 36.2667 38.0 38.0 38.0 33.8 38.0 140-144 36.148999999999994 38.0 37.8 38.0 33.4 38.0 145-149 35.79215000000001 38.0 36.4 38.0 33.0 38.0 150-151 33.076125000000005 37.0 33.5 38.0 17.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 1.0 15 0.0 16 0.0 17 1.0 18 1.0 19 1.0 20 1.0 21 3.0 22 1.0 23 1.0 24 1.0 25 6.0 26 9.0 27 8.0 28 12.0 29 18.0 30 19.0 31 29.0 32 44.0 33 55.0 34 98.0 35 163.0 36 473.0 37 3055.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 21.808374004623683 18.443359876701773 10.583097867968148 49.1651682507064 2 15.375 26.75 32.300000000000004 25.575 3 19.15 28.225 25.55 27.075 4 21.25 35.625 20.474999999999998 22.650000000000002 5 21.05 37.4 23.225 18.325 6 16.375 37.675 25.174999999999997 20.775 7 13.125 20.65 45.9 20.325 8 19.225 21.55 29.175 30.049999999999997 9 17.075000000000003 23.625 32.225 27.075 10-14 19.695 29.299999999999997 26.450000000000003 24.555 15-19 19.475 28.515 28.065 23.945 20-24 19.91 29.275000000000002 27.405 23.41 25-29 19.435 28.605000000000004 28.335 23.625 30-34 19.39 28.599999999999998 27.665 24.345 35-39 20.11 28.625 27.46 23.805 40-44 19.465 28.95 27.465 24.12 45-49 19.39 28.455000000000002 27.935 24.22 50-54 20.424999999999997 28.065 27.505000000000003 24.005000000000003 55-59 20.095 28.93 27.22 23.755000000000003 60-64 19.495 28.375 27.889999999999997 24.240000000000002 65-69 19.939999999999998 28.935 27.224999999999998 23.9 70-74 19.78 28.115000000000002 27.779999999999998 24.325 75-79 19.75 28.465 27.195000000000004 24.59 80-84 20.19 28.27 28.125 23.415 85-89 20.02 28.21 27.825 23.945 90-94 20.25 28.555000000000003 27.49 23.705000000000002 95-99 20.150000000000002 28.26 27.689999999999998 23.9 100-104 20.555 28.7 27.22 23.525 105-109 20.74 28.000000000000004 27.35 23.91 110-114 20.455000000000002 28.37 27.279999999999998 23.895 115-119 20.755000000000003 28.005000000000003 27.860000000000003 23.380000000000003 120-124 20.244999999999997 28.525 27.205000000000002 24.025 125-129 20.835 28.205000000000002 27.58 23.380000000000003 130-134 20.41 28.544999999999998 27.43 23.615 135-139 21.044999999999998 27.985 27.150000000000002 23.82 140-144 20.825 28.29 26.705000000000002 24.18 145-149 21.205 28.235 27.189999999999998 23.369999999999997 150-151 20.849999999999998 27.650000000000002 27.450000000000003 24.05 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.0 22 1.5 23 2.5 24 4.0 25 4.5 26 4.5 27 4.5 28 4.0 29 6.5 30 13.0 31 21.5 32 27.0 33 34.0 34 49.5 35 71.0 36 92.5 37 118.0 38 144.0 39 172.5 40 196.5 41 223.0 42 258.0 43 256.5 44 273.5 45 302.5 46 282.5 47 255.5 48 243.5 49 215.0 50 165.5 51 135.5 52 114.0 53 83.0 54 54.5 55 43.0 56 32.0 57 18.5 58 14.0 59 13.5 60 14.0 61 11.5 62 6.5 63 3.5 64 2.0 65 1.0 66 1.5 67 1.5 68 0.5 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.675 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69902182091799 99.375 2 0.27589666415851516 0.5499999999999999 3 0.025081514923501375 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.0625 0.0 0.0 0.0 0.0 92-93 0.1375 0.0 0.0 0.0 0.0 94-95 0.1875 0.0 0.0 0.0 0.0 96-97 0.2375 0.0 0.0 0.0 0.0 98-99 0.2875 0.0 0.0 0.0 0.0 100-101 0.375 0.0 0.0 0.0 0.0 102-103 0.4 0.0 0.0 0.0 0.0 104-105 0.48750000000000004 0.0 0.0 0.0 0.0 106-107 0.6625 0.0 0.0 0.0 0.0 108-109 0.75 0.0 0.0 0.0 0.0 110-111 0.85 0.0 0.0 0.0 0.0 112-113 1.0 0.0 0.0 0.0 0.0 114-115 1.2374999999999998 0.0 0.0 0.0 0.0 116-117 1.375 0.0 0.0 0.0 0.0 118-119 1.5375 0.0 0.0 0.0 0.0 120-121 1.75 0.0 0.0 0.0 0.0 122-123 1.9625 0.0 0.0 0.0 0.0 124-125 2.2125 0.0 0.0 0.0 0.0 126-127 2.55 0.0 0.0 0.0 0.0 128-129 2.7249999999999996 0.0 0.0 0.0 0.0 130-131 3.0374999999999996 0.0 0.0 0.0 0.0 132-133 3.3375 0.0 0.0 0.0 0.0 134-135 3.55 0.0 0.0 0.0 0.0 136-137 3.9 0.0 0.0 0.0 0.0 138-139 4.2875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GATAGCA 10 0.006836113 144.9625 5 >>END_MODULE SRR7180086 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7180086_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.0485 33.0 33.0 34.0 32.0 34.0 2 33.156 34.0 33.0 34.0 32.0 34.0 3 33.208 34.0 33.0 34.0 33.0 34.0 4 33.192 34.0 33.0 34.0 33.0 34.0 5 33.18 34.0 33.0 34.0 33.0 34.0 6 37.36475 38.0 38.0 38.0 37.0 38.0 7 37.43425 38.0 38.0 38.0 37.0 38.0 8 37.285 38.0 38.0 38.0 37.0 38.0 9 37.29125 38.0 38.0 38.0 37.0 38.0 10-14 37.31455 38.0 38.0 38.0 37.0 38.0 15-19 37.3088 38.0 38.0 38.0 37.0 38.0 20-24 37.2877 38.0 38.0 38.0 37.0 38.0 25-29 37.24055 38.0 38.0 38.0 37.0 38.0 30-34 37.19765 38.0 38.0 38.0 37.0 38.0 35-39 37.10955 38.0 38.0 38.0 36.8 38.0 40-44 37.03869999999999 38.0 38.0 38.0 36.0 38.0 45-49 37.13975 38.0 38.0 38.0 36.2 38.0 50-54 37.0591 38.0 38.0 38.0 36.0 38.0 55-59 37.031549999999996 38.0 38.0 38.0 36.0 38.0 60-64 37.0113 38.0 38.0 38.0 36.0 38.0 65-69 36.933749999999996 38.0 38.0 38.0 35.8 38.0 70-74 36.89685000000001 38.0 38.0 38.0 35.6 38.0 75-79 36.80985 38.0 38.0 38.0 35.0 38.0 80-84 36.76765 38.0 38.0 38.0 35.0 38.0 85-89 36.6918 38.0 38.0 38.0 34.8 38.0 90-94 36.5897 38.0 38.0 38.0 34.0 38.0 95-99 36.43775 38.0 38.0 38.0 34.0 38.0 100-104 36.22665 38.0 37.0 38.0 33.4 38.0 105-109 36.09310000000001 38.0 37.0 38.0 33.0 38.0 110-114 36.0166 38.0 37.0 38.0 33.0 38.0 115-119 35.865750000000006 38.0 37.0 38.0 32.2 38.0 120-124 35.63695 38.0 36.0 38.0 31.0 38.0 125-129 35.41785 38.0 36.0 38.0 30.6 38.0 130-134 35.091300000000004 38.0 35.6 38.0 28.2 38.0 135-139 34.758849999999995 38.0 35.0 38.0 27.6 38.0 140-144 34.3456 38.0 35.0 38.0 25.8 38.0 145-149 33.7005 38.0 34.8 38.0 21.4 38.0 150-151 29.68 36.0 27.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 1.0 4 1.0 5 1.0 6 2.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 1.0 13 0.0 14 0.0 15 1.0 16 2.0 17 4.0 18 2.0 19 2.0 20 0.0 21 2.0 22 6.0 23 9.0 24 16.0 25 10.0 26 17.0 27 21.0 28 14.0 29 35.0 30 46.0 31 61.0 32 89.0 33 94.0 34 169.0 35 325.0 36 709.0 37 2359.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.875 15.174999999999999 17.175 32.775 2 23.625 20.875 37.075 18.425 3 21.7 24.425 32.625 21.25 4 23.799999999999997 33.6 22.475 20.125 5 24.875 35.725 21.9 17.5 6 17.62940735183796 37.98449612403101 24.031007751937985 20.355088772193046 7 18.15 16.45 43.05 22.35 8 20.424999999999997 22.125 27.750000000000004 29.7 9 21.475 24.9 30.075000000000003 23.549999999999997 10-14 24.115000000000002 27.425 26.119999999999997 22.34 15-19 22.688403260489075 27.844176626493972 27.53413011951793 21.933289993499024 20-24 22.884451784016413 28.19396487013962 27.763599059200324 21.157984286643646 25-29 23.476083145504635 28.019033308289508 27.46306035562234 21.04182319058352 30-34 22.527940660552296 28.50197965218263 27.775271888939006 21.194807798326064 35-39 23.75626880641926 27.81344032096289 27.793380140421263 20.63691073219659 40-44 23.119358074222667 28.385155466399198 27.4222668004012 21.07321965897693 45-49 22.978318561914776 28.80676981623354 27.660107155375297 20.55480446647639 50-54 23.49762321741306 28.066049537152864 27.47060295221416 20.965724293219914 55-59 23.377533149862398 28.10607955966975 27.755816862646988 20.760570427820866 60-64 22.91718789091819 28.006004503377536 27.78083562672004 21.295971978984237 65-69 23.36018411967779 28.393455746235052 27.71801671086206 20.528343423225095 70-74 23.832874655991994 28.29121841381036 27.425569176882664 20.450337753314987 75-79 23.898143979188553 27.37005352944119 27.92535894742108 20.80644354394917 80-84 23.622717037778333 27.585689266950215 27.5806855141356 21.210908181135853 85-89 23.4714300010007 28.109676773741622 27.729410587411184 20.689482637846492 90-94 23.59707912373712 28.088426527958386 27.59327798339502 20.721216364909473 95-99 23.765 27.92 27.675 20.64 100-104 23.697369736973698 28.15781578157816 27.502750275027505 20.642064206420642 105-109 24.097409740974097 27.69276927692769 27.852785278527854 20.357035703570357 110-114 23.669999999999998 28.050000000000004 27.894999999999996 20.385 115-119 24.39121956097805 28.036401820091005 27.346367318365917 20.226011300565027 120-124 24.02980596119224 28.545709141828368 27.230446089217843 20.19403880776155 125-129 23.91935161096658 28.041825095057032 27.46647988793276 20.572343406043625 130-134 24.437218609304654 28.119059529764883 27.503751875937972 19.939969984992494 135-139 24.398539488821086 28.004801680588205 27.709698394438053 19.886960436152652 140-144 23.687106131839553 28.008402520756228 28.023407022106632 20.281084325297588 145-149 24.917458729364682 27.693846923461727 27.508754377188595 19.879939969984992 150-151 25.35070140280561 27.667835671342683 27.26703406813627 19.71442885771543 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 1.0 11 0.5 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 0.5 25 1.0 26 2.0 27 2.0 28 4.0 29 7.0 30 8.0 31 12.0 32 17.0 33 24.5 34 35.0 35 48.5 36 66.5 37 87.5 38 131.5 39 169.5 40 186.0 41 222.0 42 255.5 43 273.5 44 290.5 45 300.0 46 291.0 47 275.5 48 263.0 49 227.0 50 196.0 51 167.0 52 119.5 53 85.5 54 69.5 55 52.0 56 33.0 57 20.0 58 12.5 59 11.0 60 8.5 61 5.0 62 3.5 63 3.0 64 3.0 65 2.5 66 1.0 67 1.0 68 0.5 69 0.0 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.025 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.015 20-24 0.08499999999999999 25-29 0.17500000000000002 30-34 0.23500000000000001 35-39 0.3 40-44 0.3 45-49 0.145 50-54 0.075 55-59 0.075 60-64 0.075 65-69 0.065 70-74 0.075 75-79 0.055 80-84 0.075 85-89 0.06999999999999999 90-94 0.03 95-99 0.0 100-104 0.01 105-109 0.01 110-114 0.0 115-119 0.005 120-124 0.02 125-129 0.06 130-134 0.05 135-139 0.034999999999999996 140-144 0.03 145-149 0.05 150-151 0.2 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.74905897114178 99.375 2 0.17565872020075282 0.35000000000000003 3 0.02509410288582183 0.075 4 0.05018820577164366 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.1125 0.0 0.0 0.0 0.0 94-95 0.16249999999999998 0.0 0.0 0.0 0.0 96-97 0.21250000000000002 0.0 0.0 0.0 0.0 98-99 0.2625 0.0 0.0 0.0 0.0 100-101 0.35 0.0 0.0 0.0 0.0 102-103 0.375 0.0 0.0 0.0 0.0 104-105 0.4625 0.0 0.0 0.0 0.0 106-107 0.6499999999999999 0.0 0.0 0.0 0.0 108-109 0.725 0.0 0.0 0.0 0.0 110-111 0.825 0.0 0.0 0.0 0.0 112-113 0.9750000000000001 0.0 0.0 0.0 0.0 114-115 1.1875 0.0 0.0 0.0 0.0 116-117 1.3250000000000002 0.0 0.0 0.0 0.0 118-119 1.4375 0.0 0.0 0.0 0.0 120-121 1.65 0.0 0.0 0.0 0.0 122-123 1.875 0.0 0.0 0.0 0.0 124-125 2.1375 0.0 0.0 0.0 0.0 126-127 2.5 0.0 0.0 0.0 0.0 128-129 2.675 0.0 0.0 0.0 0.0 130-131 3.0 0.0 0.0 0.0 0.0 132-133 3.3125 0.0 0.0 0.0 0.0 134-135 3.5125 0.0 0.0 0.0 0.0 136-137 3.85 0.0 0.0 0.0 0.0 138-139 4.237500000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 711036 spots for SRR7180086.sra Written 711036 spots for SRR7180086.sra Read 711036 spots for SRR7180086.sra Written 711036 spots for SRR7180086.sra Read 711036 spots for SRR7180086.sra Written 711036 spots for SRR7180086.sra Read 711036 spots for SRR7180086.sra Written 711036 spots for SRR7180086.sra Read 711036 spots for SRR7180086.sra Written 711036 spots for SRR7180086.sra Read 711036 spots for SRR7180086.sra Written 711036 spots for SRR7180086.sra Read 711036 spots for SRR7180086.sra Written 711036 spots for SRR7180086.sra Read 711036 spots for SRR7180086.sra Written 711036 spots for SRR7180086.sra Read 711036 spots for SRR7180086.sra Written 711036 spots for SRR7180086.sra Read 711036 spots for SRR7180086.sra Written 711036 spots for SRR7180086.sra Read 711036 spots for SRR7180086.sra Written 711036 spots for SRR7180086.sra Read 711036 spots for SRR7180086.sra Written 711036 spots for SRR7180086.sra Read 711036 spots for SRR7180086.sra Written 711036 spots for SRR7180086.sra Read 711036 spots for SRR7180086.sra Written 711036 spots for SRR7180086.sra Read 711052 spots for SRR7180086.sra Written 711052 spots for SRR7180086.sra Read 711036 spots for SRR7180086.sra Written 711036 spots for SRR7180086.sra Read 711036 spots for SRR7180086.sra Written 711036 spots for SRR7180086.sra Read 711036 spots for SRR7180086.sra Written 711036 spots for SRR7180086.sra Read 711036 spots for SRR7180086.sra Written 711036 spots for SRR7180086.sra Read 711036 spots for SRR7180086.sra Written 711036 spots for SRR7180086.sra SRR ids: ['SRR7180086.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_8x0yegel SRR7180086.sra spots: 14220736 blocks: [[1, 711036], [711037, 1422072], [1422073, 2133108], [2133109, 2844144], [2844145, 3555180], [3555181, 4266216], [4266217, 4977252], [4977253, 5688288], [5688289, 6399324], [6399325, 7110360], [7110361, 7821396], [7821397, 8532432], [8532433, 9243468], [9243469, 9954504], [9954505, 10665540], [10665541, 11376576], [11376577, 12087612], [12087613, 12798648], [12798649, 13509684], [13509685, 14220736]] SRR7180086 file size 4797240 SRR7180086 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7180086 SRR7180086_1.fastq SRR7180086_2.fastq Input file: SRR7180086_1.fastq Paired file: SRR7180086_2.fastq trimmed: SRR7180086-trimmed-pair1.fastq, SRR7180086-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 18:46:14 2025 >> started Mon Feb 10 18:46:31 2025 >> done (17.006s) 14220736 read pairs processed; of these: 7263 ( 0.05%) short read pairs filtered out after trimming by size control 3165 ( 0.02%) empty read pairs filtered out after trimming by size control 14210308 (99.93%) read pairs available; of these: 4955101 (34.87%) trimmed read pairs available after processing 9255207 (65.13%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 1 0.00% 20 1 0.00% 21 1 0.00% 22 0 0.00% 23 1 0.00% 24 3 0.00% 25 0 0.00% 26 1 0.00% 27 0 0.00% 28 0 0.00% 29 2 0.00% 30 3 0.00% 31 1 0.00% 32 2 0.00% 33 0 0.00% 34 1 0.00% 35 3 0.00% 36 13 0.00% 37 18 0.00% 38 6 0.00% 39 8 0.00% 40 25 0.00% 41 16 0.00% 42 8 0.00% 43 1 0.00% 44 9 0.00% 45 50 0.00% 46 41 0.00% 47 59 0.00% 48 33 0.00% 49 36 0.00% 50 43 0.00% 51 78 0.00% 52 8 0.00% 53 24 0.00% 54 43 0.00% 55 82 0.00% 56 28 0.00% 57 28 0.00% 58 22 0.00% 59 34 0.00% 60 57 0.00% 61 55 0.00% 62 34 0.00% 63 68 0.00% 64 68 0.00% 65 78 0.00% 66 87 0.00% 67 113 0.00% 68 124 0.00% 69 152 0.00% 70 175 0.00% 71 201 0.00% 72 235 0.00% 73 263 0.00% 74 306 0.00% 75 387 0.00% 76 399 0.00% 77 461 0.00% 78 499 0.00% 79 554 0.00% 80 725 0.01% 81 795 0.01% 82 867 0.01% 83 1090 0.01% 84 1652 0.01% 85 2028 0.01% 86 2031 0.01% 87 2210 0.02% 88 2412 0.02% 89 2610 0.02% 90 2720 0.02% 91 3068 0.02% 92 3287 0.02% 93 3525 0.02% 94 3934 0.03% 95 4266 0.03% 96 4484 0.03% 97 4987 0.04% 98 5307 0.04% 99 5676 0.04% 100 6104 0.04% 101 6483 0.05% 102 7062 0.05% 103 7456 0.05% 104 7913 0.06% 105 8607 0.06% 106 9165 0.06% 107 10011 0.07% 108 10448 0.07% 109 11058 0.08% 110 11801 0.08% 111 12345 0.09% 112 13400 0.09% 113 13900 0.10% 114 14295 0.10% 115 15202 0.11% 116 16011 0.11% 117 16624 0.12% 118 17983 0.13% 119 18736 0.13% 120 19559 0.14% 121 21318 0.15% 122 21845 0.15% 123 22404 0.16% 124 23163 0.16% 125 23700 0.17% 126 25813 0.18% 127 26686 0.19% 128 27901 0.20% 129 29586 0.21% 130 30657 0.22% 131 31966 0.22% 132 33444 0.24% 133 35399 0.25% 134 37116 0.26% 135 38722 0.27% 136 41003 0.29% 137 43392 0.31% 138 46439 0.33% 139 49444 0.35% 140 52796 0.37% 141 56930 0.40% 142 63105 0.44% 143 69035 0.49% 144 77352 0.54% 145 89776 0.63% 146 108017 0.76% 147 141580 1.00% 148 211099 1.49% 149 426948 3.00% 150 2731579 19.22% 151 9255207 65.13% 14210308 reads passed initial QC criterion=sequence-density sequence-density=0.50 sequence-density-rank=1 fanout-score=2.10 fanout-score-rank=30 prefix-density=0.53 prefix-fanout=2.0 sequence=CAGGTGCAGTTTGATCCACACTTGCA criterion=fanout-score sequence-density=0.10 sequence-density-rank=26 fanout-score=10.89 fanout-score-rank=1 prefix-density=0.39 prefix-fanout=2.8 sequence=TCCTTCTGGATATTGTAGTCTGCCAGGGTGCGCCCAT criterion=sequence-density sequence-density=0.53 sequence-density-rank=1 fanout-score=3.08 fanout-score-rank=27 prefix-density=0.69 prefix-fanout=2.4 sequence=GGTTTCTCAGAGA criterion=fanout-score sequence-density=0.11 sequence-density-rank=31 fanout-score=37.36 fanout-score-rank=1 prefix-density=0.37 prefix-fanout=10.6 sequence=GAGGTTGAGTACAGGTGCTTTGTTGG SRR7180086 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 18:47:15 Started mapping on | Feb 10 18:47:16 Finished on | Feb 10 18:48:42 Mapping speed, Million of reads per hour | 594.85 Number of input reads | 14210308 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 13572992 Uniquely mapped reads % | 95.52% Average mapped length | 296.68 Number of splices: Total | 14115881 Number of splices: Annotated (sjdb) | 13893494 Number of splices: GT/AG | 13898310 Number of splices: GC/AG | 175859 Number of splices: AT/AC | 10355 Number of splices: Non-canonical | 31357 Mismatch rate per base, % | 0.32% Deletion rate per base | 0.03% Deletion average length | 2.49 Insertion rate per base | 0.02% Insertion average length | 2.62 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 359054 % of reads mapped to multiple loci | 2.53% Number of reads mapped to too many loci | 29526 % of reads mapped to too many loci | 0.21% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.70% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 284147 284147 284147 N_multimapping 359054 359054 359054 N_noFeature 276623 13466507 317514 N_ambiguous 128251 874 62021 UnstrandedReadsAssigned:13168118 PositiveStrandReadsAssigned:105611 NegativeStrandReadsAssigned:13193457 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7180086 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7180086-trimmed-pair1.fastq SRR7180086-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,210,308 reads, 13,031,915 reads pseudoaligned [quant] estimated average fragment length: 242.403 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,275 rounds 52401 SRR7180086.ke.tsv 34699 SRR7180086.se.tsv 87100 total ==> SRR7180086.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1776.6 903 34.6339 Potri.005G024800.1.v4.1 1035 793.597 204 17.5159 Potri.004G059700.1.v4.1 961 719.617 47 4.4504 Potri.007G009000.2.v4.1 1416 1174.6 0 0 Potri.003G141000.2.v4.1 2943 2701.6 463 11.6779 Potri.016G087400.1.v4.1 270 75.3654 1135.56 1026.7 Potri.015G069301.1.v4.1 564 325.498 0 0 Potri.010G195200.1.v4.1 1773 1531.6 121 5.38324 Potri.012G127500.1.v4.1 977 735.604 2575 238.526 ==> SRR7180086.se.tsv <== Potri.001G166300.v4.1 5 Potri.001G448400.v4.1 31 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 403 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 227 SRR7180086 completed mapping pipeline successfully