Starting /dee2/code/volunteer_pipeline.sh SRR7180087 current disk space = 3057954344960 free memory = 1414177012 SRR7180087 SRAfilesize dec84005e9f104baba809f28282966d6 SRR7180087.sra SRR7180087.sra file validated SRR7180087 is paired end SRR7180087 is conventional basespace SRR7180087 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7180087_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.43275 33.0 32.0 34.0 25.0 34.0 2 32.58075 33.0 33.0 34.0 29.0 34.0 3 33.0455 34.0 33.0 34.0 32.0 34.0 4 33.10825 34.0 33.0 34.0 31.0 34.0 5 33.1495 34.0 33.0 34.0 33.0 34.0 6 36.98375 38.0 37.0 38.0 35.0 38.0 7 37.29575 38.0 38.0 38.0 36.0 38.0 8 37.281 38.0 38.0 38.0 36.0 38.0 9 37.4515 38.0 38.0 38.0 37.0 38.0 10-14 37.559000000000005 38.0 38.0 38.0 37.8 38.0 15-19 37.502399999999994 38.0 38.0 38.0 38.0 38.0 20-24 37.51345 38.0 38.0 38.0 37.8 38.0 25-29 37.516000000000005 38.0 38.0 38.0 38.0 38.0 30-34 37.5149 38.0 38.0 38.0 37.8 38.0 35-39 37.44685 38.0 38.0 38.0 37.4 38.0 40-44 37.43235 38.0 38.0 38.0 37.0 38.0 45-49 37.417449999999995 38.0 38.0 38.0 37.0 38.0 50-54 37.3815 38.0 38.0 38.0 37.0 38.0 55-59 37.30385 38.0 38.0 38.0 37.0 38.0 60-64 37.29395 38.0 38.0 38.0 37.0 38.0 65-69 37.2653 38.0 38.0 38.0 37.0 38.0 70-74 37.19295 38.0 38.0 38.0 36.8 38.0 75-79 37.1393 38.0 38.0 38.0 36.0 38.0 80-84 37.04560000000001 38.0 38.0 38.0 36.0 38.0 85-89 37.009299999999996 38.0 38.0 38.0 36.0 38.0 90-94 36.99925 38.0 38.0 38.0 36.0 38.0 95-99 36.903999999999996 38.0 38.0 38.0 36.0 38.0 100-104 36.6932 38.0 38.0 38.0 34.8 38.0 105-109 36.71625 38.0 38.0 38.0 35.0 38.0 110-114 36.57505 38.0 38.0 38.0 34.2 38.0 115-119 36.45655 38.0 38.0 38.0 34.0 38.0 120-124 36.3442 38.0 38.0 38.0 34.0 38.0 125-129 36.1811 38.0 38.0 38.0 33.8 38.0 130-134 35.9291 38.0 37.2 38.0 33.0 38.0 135-139 35.774300000000004 38.0 37.2 38.0 32.8 38.0 140-144 35.53515 38.0 36.0 38.0 32.0 38.0 145-149 35.0467 38.0 36.0 38.0 31.0 38.0 150-151 32.201 36.5 33.5 38.0 15.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 3 1.0 4 0.0 5 0.0 6 0.0 7 0.0 8 1.0 9 0.0 10 1.0 11 0.0 12 2.0 13 0.0 14 2.0 15 3.0 16 2.0 17 2.0 18 2.0 19 1.0 20 3.0 21 3.0 22 4.0 23 5.0 24 2.0 25 12.0 26 6.0 27 13.0 28 14.0 29 21.0 30 40.0 31 46.0 32 43.0 33 94.0 34 99.0 35 183.0 36 508.0 37 2887.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.08433093907954 14.631550944400107 12.529928172386274 35.754189944134076 2 22.125 16.0 35.8 26.075 3 19.6 21.65 26.375 32.375 4 23.35 28.275 22.375 26.0 5 21.375 31.1 26.974999999999998 20.549999999999997 6 18.65 33.675 25.900000000000002 21.775 7 14.475 23.35 43.4 18.775 8 16.45 25.25 30.95 27.35 9 18.15 24.224999999999998 34.75 22.875 10-14 19.830000000000002 29.075 28.005000000000003 23.09 15-19 19.605 27.63 28.825 23.94 20-24 19.939999999999998 27.6 28.485 23.974999999999998 25-29 19.585 28.24 28.465 23.71 30-34 19.42 28.499999999999996 28.395 23.685000000000002 35-39 20.044999999999998 27.96 27.925 24.07 40-44 20.169999999999998 27.61 27.99 24.23 45-49 20.064999999999998 27.815 28.13 23.990000000000002 50-54 19.75 27.975 28.23 24.044999999999998 55-59 19.915 27.860000000000003 28.325 23.9 60-64 19.985 28.38 27.61 24.025 65-69 19.38 27.975 27.92 24.725 70-74 19.72 28.499999999999996 27.555000000000003 24.224999999999998 75-79 20.335 27.650000000000002 28.51 23.505000000000003 80-84 20.4 27.955000000000002 27.935 23.71 85-89 20.66 27.639999999999997 28.29 23.41 90-94 20.7 27.884999999999998 27.765 23.65 95-99 20.915 27.639999999999997 27.455000000000002 23.990000000000002 100-104 20.605 27.82 27.955000000000002 23.62 105-109 19.705000000000002 28.62 27.92 23.755000000000003 110-114 20.115 28.16 28.22 23.505000000000003 115-119 20.395 27.815 28.165000000000003 23.625 120-124 20.75 27.889999999999997 27.279999999999998 24.08 125-129 20.385 28.139999999999997 27.63 23.845 130-134 20.849999999999998 27.915 27.36 23.875 135-139 21.34 27.68 26.87 24.11 140-144 20.915 28.52 26.76 23.805 145-149 20.71 27.98 27.334999999999997 23.974999999999998 150-151 20.9 28.199999999999996 26.6 24.3 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.5 2 1.0 3 0.5 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 1.0 24 2.0 25 3.0 26 5.0 27 7.0 28 9.5 29 13.0 30 15.0 31 24.5 32 35.5 33 42.0 34 55.0 35 68.0 36 73.0 37 107.5 38 146.5 39 157.5 40 188.0 41 217.5 42 227.5 43 249.0 44 292.5 45 289.0 46 266.0 47 270.0 48 251.5 49 207.0 50 171.5 51 133.0 52 94.5 53 84.5 54 72.5 55 51.5 56 35.0 57 27.0 58 20.5 59 15.5 60 17.5 61 16.5 62 10.0 63 7.5 64 4.5 65 2.0 66 1.5 67 2.5 68 2.0 69 1.0 70 0.5 71 0.5 72 0.0 73 0.5 74 0.5 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 6.0249999999999995 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.75 #Duplication Level Percentage of deduplicated Percentage of total 1 99.74937343358395 99.5 2 0.2506265664160401 0.5 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.037500000000000006 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.0875 0.0 0.0 0.0 0.0 86-87 0.1375 0.0 0.0 0.0 0.0 88-89 0.16249999999999998 0.0 0.0 0.0 0.0 90-91 0.2 0.0 0.0 0.0 0.0 92-93 0.275 0.0 0.0 0.0 0.0 94-95 0.3625 0.0 0.0 0.0 0.0 96-97 0.4375 0.0 0.0 0.0 0.0 98-99 0.575 0.0 0.0 0.0 0.0 100-101 0.6375 0.0 0.0 0.0 0.0 102-103 0.725 0.0 0.0 0.0 0.0 104-105 0.85 0.0 0.0 0.0 0.0 106-107 0.9875 0.0 0.0 0.0 0.0 108-109 1.1124999999999998 0.0 0.0 0.0 0.0 110-111 1.3 0.0 0.0 0.0 0.0 112-113 1.4375 0.0 0.0 0.0 0.0 114-115 1.5875 0.0 0.0 0.0 0.0 116-117 1.85 0.0 0.0 0.0 0.0 118-119 2.2874999999999996 0.0 0.0 0.0 0.0 120-121 2.5125 0.0 0.0 0.0 0.0 122-123 2.825 0.0 0.0 0.0 0.0 124-125 3.15 0.0 0.0 0.0 0.0 126-127 3.575 0.0 0.0 0.0 0.0 128-129 3.8625 0.0 0.0 0.0 0.0 130-131 4.199999999999999 0.0 0.0 0.0 0.0 132-133 4.525 0.0 0.0 0.0 0.0 134-135 4.9 0.0 0.0 0.0 0.0 136-137 5.275 0.0 0.0 0.0 0.0 138-139 5.775 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGATATG 10 0.0068378756 144.95 4 GGAAGGT 10 0.0068378756 144.95 145 >>END_MODULE SRR7180087 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7180087_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.8775 33.0 33.0 34.0 32.0 34.0 2 32.9715 34.0 33.0 34.0 32.0 34.0 3 33.05 34.0 33.0 34.0 32.0 34.0 4 32.92525 34.0 33.0 34.0 32.0 34.0 5 32.90375 34.0 33.0 34.0 32.0 34.0 6 37.15225 38.0 38.0 38.0 37.0 38.0 7 37.07675 38.0 38.0 38.0 37.0 38.0 8 36.96125 38.0 38.0 38.0 36.0 38.0 9 37.068 38.0 38.0 38.0 37.0 38.0 10-14 37.03645 38.0 38.0 38.0 36.8 38.0 15-19 37.04729999999999 38.0 38.0 38.0 37.0 38.0 20-24 37.032 38.0 38.0 38.0 37.0 38.0 25-29 36.94005 38.0 38.0 38.0 36.6 38.0 30-34 36.8271 38.0 38.0 38.0 36.2 38.0 35-39 36.809450000000005 38.0 38.0 38.0 36.0 38.0 40-44 36.82255000000001 38.0 38.0 38.0 36.0 38.0 45-49 36.911899999999996 38.0 38.0 38.0 36.2 38.0 50-54 36.86215 38.0 38.0 38.0 36.0 38.0 55-59 36.76885 38.0 38.0 38.0 36.0 38.0 60-64 36.75085 38.0 38.0 38.0 36.0 38.0 65-69 36.70815 38.0 38.0 38.0 35.6 38.0 70-74 36.65429999999999 38.0 38.0 38.0 35.4 38.0 75-79 36.612700000000004 38.0 38.0 38.0 35.0 38.0 80-84 36.5996 38.0 38.0 38.0 34.8 38.0 85-89 36.4029 38.0 38.0 38.0 34.2 38.0 90-94 36.323750000000004 38.0 38.0 38.0 34.0 38.0 95-99 36.2226 38.0 38.0 38.0 34.0 38.0 100-104 36.102999999999994 38.0 38.0 38.0 34.0 38.0 105-109 35.884100000000004 38.0 37.6 38.0 32.8 38.0 110-114 36.0 38.0 37.8 38.0 33.6 38.0 115-119 35.94065 38.0 37.6 38.0 33.4 38.0 120-124 35.624849999999995 38.0 37.2 38.0 31.8 38.0 125-129 35.35615 38.0 36.4 38.0 31.0 38.0 130-134 35.04565 38.0 36.0 38.0 28.8 38.0 135-139 34.72745 38.0 35.6 38.0 27.4 38.0 140-144 34.55749999999999 38.0 35.8 38.0 27.0 38.0 145-149 34.0461 38.0 35.0 38.0 24.2 38.0 150-151 30.443625000000004 36.5 29.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 7.0 3 7.0 4 6.0 5 1.0 6 3.0 7 2.0 8 1.0 9 0.0 10 3.0 11 0.0 12 2.0 13 2.0 14 3.0 15 7.0 16 3.0 17 3.0 18 3.0 19 1.0 20 12.0 21 8.0 22 3.0 23 10.0 24 12.0 25 15.0 26 21.0 27 17.0 28 34.0 29 38.0 30 38.0 31 51.0 32 54.0 33 85.0 34 152.0 35 246.0 36 512.0 37 2638.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.25 17.5 17.4 27.85 2 24.8 24.025 34.0 17.175 3 20.825 28.1 31.1 19.975 4 26.174999999999997 33.324999999999996 21.85 18.65 5 24.125 36.525 21.95 17.4 6 20.1 36.025 24.875 19.0 7 19.025 19.425 40.525 21.025 8 20.775 24.099999999999998 28.000000000000004 27.125 9 23.3 26.075 28.225 22.400000000000002 10-14 23.215 28.77 26.075 21.94 15-19 23.294999999999998 28.610000000000003 27.37 20.724999999999998 20-24 23.368505275791367 28.729309396409462 27.074061109166376 20.828124218632794 25-29 23.746622635845092 28.670069048333836 27.214049834884417 20.369258480936654 30-34 23.81214639763681 28.73879737645822 27.06653982876884 20.382516397136133 35-39 23.80022041879571 28.484119827672576 27.061416691714257 20.654243061817454 40-44 24.132231404958677 28.109191084397693 27.28274480340596 20.475832707237664 45-49 24.057028514257127 27.463731865932967 28.319159579789893 20.16008004002001 50-54 23.44617230861543 28.516425821291065 27.486374318715935 20.55102755137757 55-59 24.05 28.415000000000003 27.205000000000002 20.330000000000002 60-64 24.305 28.134999999999998 27.779999999999998 19.78 65-69 24.11 28.505000000000003 27.22 20.165 70-74 24.335 27.925 27.229999999999997 20.51 75-79 23.955000000000002 27.810000000000002 27.584999999999997 20.65 80-84 24.060000000000002 28.12 27.345000000000002 20.474999999999998 85-89 24.09 28.265 27.165 20.48 90-94 24.05 28.175 27.395000000000003 20.380000000000003 95-99 23.87 28.165000000000003 27.62 20.345 100-104 24.075 28.449999999999996 27.279999999999998 20.195 105-109 24.005000000000003 28.74 27.305 19.950000000000003 110-114 24.115000000000002 27.785 27.805000000000003 20.294999999999998 115-119 23.865 28.389999999999997 27.52 20.225 120-124 24.224999999999998 27.689999999999998 27.405 20.68 125-129 24.2 28.744999999999997 27.400000000000002 19.655 130-134 24.310000000000002 28.22 27.605 19.865 135-139 24.645 29.03 26.43 19.895 140-144 24.975 28.599999999999998 26.845000000000002 19.580000000000002 145-149 25.09 28.535 26.665 19.71 150-151 25.6064016004001 28.51962990747687 26.65666416604151 19.217304326081518 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 1.0 20 1.0 21 2.0 22 2.0 23 1.5 24 3.0 25 4.0 26 4.0 27 3.5 28 3.0 29 5.5 30 7.0 31 11.0 32 23.0 33 31.0 34 35.5 35 48.0 36 68.5 37 100.0 38 134.5 39 163.0 40 196.0 41 217.5 42 244.5 43 272.0 44 293.5 45 312.0 46 290.5 47 264.5 48 253.5 49 220.0 50 172.0 51 133.0 52 106.0 53 94.0 54 75.5 55 48.5 56 35.5 57 29.0 58 22.0 59 14.5 60 9.5 61 9.5 62 8.0 63 6.0 64 3.5 65 3.0 66 4.5 67 3.0 68 1.0 69 0.5 70 0.0 71 0.0 72 0.0 73 0.5 74 1.0 75 1.0 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.5 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.015 25-29 0.06999999999999999 30-34 0.135 35-39 0.19 40-44 0.17500000000000002 45-49 0.05 50-54 0.005 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.775 #Duplication Level Percentage of deduplicated Percentage of total 1 99.77449260836883 99.55000000000001 2 0.22550739163117012 0.44999999999999996 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.037500000000000006 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.0875 0.0 0.0 0.0 0.0 86-87 0.1375 0.0 0.0 0.0 0.0 88-89 0.16249999999999998 0.0 0.0 0.0 0.0 90-91 0.2 0.0 0.0 0.0 0.0 92-93 0.275 0.0 0.0 0.0 0.0 94-95 0.3625 0.0 0.0 0.0 0.0 96-97 0.4375 0.0 0.0 0.0 0.0 98-99 0.5875 0.0 0.0 0.0 0.0 100-101 0.6625000000000001 0.0 0.0 0.0 0.0 102-103 0.75 0.0 0.0 0.0 0.0 104-105 0.875 0.0 0.0 0.0 0.0 106-107 1.0125 0.0 0.0 0.0 0.0 108-109 1.1375000000000002 0.0 0.0 0.0 0.0 110-111 1.325 0.0 0.0 0.0 0.0 112-113 1.4874999999999998 0.0 0.0 0.0 0.0 114-115 1.6375000000000002 0.0 0.0 0.0 0.0 116-117 1.9 0.0 0.0 0.0 0.0 118-119 2.3375000000000004 0.0 0.0 0.0 0.0 120-121 2.5625 0.0 0.0 0.0 0.0 122-123 2.8625 0.0 0.0 0.0 0.0 124-125 3.2125000000000004 0.0 0.0 0.0 0.0 126-127 3.65 0.0 0.0 0.0 0.0 128-129 3.9875000000000003 0.0 0.0 0.0 0.0 130-131 4.3375 0.0 0.0 0.0 0.0 132-133 4.675000000000001 0.0 0.0 0.0 0.0 134-135 5.05 0.0 0.0 0.0 0.0 136-137 5.449999999999999 0.0 0.0 0.0 0.0 138-139 5.949999999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 907799 spots for SRR7180087.sra Written 907799 spots for SRR7180087.sra Read 907799 spots for SRR7180087.sra Written 907799 spots for SRR7180087.sra Read 907799 spots for SRR7180087.sra Written 907799 spots for SRR7180087.sra Read 907799 spots for SRR7180087.sra Written 907799 spots for SRR7180087.sra Read 907799 spots for SRR7180087.sra Written 907799 spots for SRR7180087.sra Read 907799 spots for SRR7180087.sra Written 907799 spots for SRR7180087.sra Read 907799 spots for SRR7180087.sra Written 907799 spots for SRR7180087.sra Read 907799 spots for SRR7180087.sra Written 907799 spots for SRR7180087.sra Read 907799 spots for SRR7180087.sra Written 907799 spots for SRR7180087.sra Read 907799 spots for SRR7180087.sra Written 907799 spots for SRR7180087.sra Read 907799 spots for SRR7180087.sra Written 907799 spots for SRR7180087.sra Read 907799 spots for SRR7180087.sra Written 907799 spots for SRR7180087.sra Read 907799 spots for SRR7180087.sra Written 907799 spots for SRR7180087.sra Read 907799 spots for SRR7180087.sra Written 907799 spots for SRR7180087.sra Read 907799 spots for SRR7180087.sra Written 907799 spots for SRR7180087.sra Read 907799 spots for SRR7180087.sra Written 907799 spots for SRR7180087.sra Read 907799 spots for SRR7180087.sra Written 907799 spots for SRR7180087.sra Read 907799 spots for SRR7180087.sra Written 907799 spots for SRR7180087.sra Read 907799 spots for SRR7180087.sra Written 907799 spots for SRR7180087.sra Read 907803 spots for SRR7180087.sra Written 907803 spots for SRR7180087.sra SRR ids: ['SRR7180087.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_t3iuwif_ SRR7180087.sra spots: 18155984 blocks: [[1, 907799], [907800, 1815598], [1815599, 2723397], [2723398, 3631196], [3631197, 4538995], [4538996, 5446794], [5446795, 6354593], [6354594, 7262392], [7262393, 8170191], [8170192, 9077990], [9077991, 9985789], [9985790, 10893588], [10893589, 11801387], [11801388, 12709186], [12709187, 13616985], [13616986, 14524784], [14524785, 15432583], [15432584, 16340382], [16340383, 17248181], [17248182, 18155984]] SRR7180087 file size 6130766 SRR7180087 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7180087 SRR7180087_1.fastq SRR7180087_2.fastq Input file: SRR7180087_1.fastq Paired file: SRR7180087_2.fastq trimmed: SRR7180087-trimmed-pair1.fastq, SRR7180087-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 17:56:30 2025 >> started Mon Feb 10 17:57:02 2025 >> done (32.422s) 18155984 read pairs processed; of these: 35413 ( 0.20%) short read pairs filtered out after trimming by size control 25169 ( 0.14%) empty read pairs filtered out after trimming by size control 18095402 (99.67%) read pairs available; of these: 6597434 (36.46%) trimmed read pairs available after processing 11497968 (63.54%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 3 0.00% 20 3 0.00% 21 8 0.00% 22 3 0.00% 23 6 0.00% 24 9 0.00% 25 11 0.00% 26 6 0.00% 27 9 0.00% 28 16 0.00% 29 7 0.00% 30 12 0.00% 31 11 0.00% 32 6 0.00% 33 11 0.00% 34 13 0.00% 35 10 0.00% 36 6 0.00% 37 8 0.00% 38 7 0.00% 39 8 0.00% 40 9 0.00% 41 15 0.00% 42 7 0.00% 43 11 0.00% 44 15 0.00% 45 21 0.00% 46 14 0.00% 47 19 0.00% 48 25 0.00% 49 34 0.00% 50 32 0.00% 51 32 0.00% 52 46 0.00% 53 39 0.00% 54 38 0.00% 55 53 0.00% 56 63 0.00% 57 63 0.00% 58 52 0.00% 59 77 0.00% 60 84 0.00% 61 87 0.00% 62 131 0.00% 63 102 0.00% 64 135 0.00% 65 164 0.00% 66 154 0.00% 67 175 0.00% 68 251 0.00% 69 263 0.00% 70 297 0.00% 71 363 0.00% 72 431 0.00% 73 497 0.00% 74 581 0.00% 75 641 0.00% 76 784 0.00% 77 918 0.01% 78 1024 0.01% 79 1172 0.01% 80 1293 0.01% 81 1418 0.01% 82 1663 0.01% 83 2040 0.01% 84 3622 0.02% 85 4936 0.03% 86 5187 0.03% 87 5987 0.03% 88 6267 0.03% 89 6395 0.04% 90 6698 0.04% 91 6880 0.04% 92 7186 0.04% 93 7528 0.04% 94 7838 0.04% 95 8295 0.05% 96 8823 0.05% 97 9423 0.05% 98 9974 0.06% 99 10511 0.06% 100 11241 0.06% 101 11778 0.07% 102 12507 0.07% 103 13307 0.07% 104 14301 0.08% 105 15282 0.08% 106 15952 0.09% 107 16969 0.09% 108 17894 0.10% 109 19271 0.11% 110 20193 0.11% 111 21293 0.12% 112 22490 0.12% 113 23381 0.13% 114 24959 0.14% 115 26244 0.15% 116 27623 0.15% 117 28822 0.16% 118 30185 0.17% 119 31794 0.18% 120 34369 0.19% 121 35605 0.20% 122 35872 0.20% 123 37584 0.21% 124 39055 0.22% 125 40734 0.23% 126 41531 0.23% 127 43587 0.24% 128 45220 0.25% 129 47224 0.26% 130 49477 0.27% 131 51535 0.28% 132 54165 0.30% 133 57647 0.32% 134 59697 0.33% 135 62452 0.35% 136 65307 0.36% 137 68342 0.38% 138 71929 0.40% 139 76557 0.42% 140 81032 0.45% 141 87310 0.48% 142 94568 0.52% 143 104060 0.58% 144 118208 0.65% 145 133256 0.74% 146 159296 0.88% 147 204366 1.13% 148 297946 1.65% 149 553375 3.06% 150 3209585 17.74% 151 11497968 63.54% 18095402 reads passed initial QC criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=4.35 fanout-score-rank=20 prefix-density=0.28 prefix-fanout=3.6 sequence=CCACATTTGCAGCCA criterion=fanout-score sequence-density=0.12 sequence-density-rank=16 fanout-score=17.17 fanout-score-rank=1 prefix-density=0.32 prefix-fanout=6.3 sequence=CACCATCATTGTAAAGGAACAACTGAG criterion=sequence-density sequence-density=0.31 sequence-density-rank=1 fanout-score=2.29 fanout-score-rank=29 prefix-density=0.32 prefix-fanout=2.2 sequence=GGCAGTGGCTGCAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=63.42 fanout-score-rank=1 prefix-density=0.15 prefix-fanout=3.9 sequence=TCTTTGAGAGTGCATAGATTTGTGTTGATATAGAAAACAATGGCACTACATGGAAAGATTGAGACAACATTAGAACTCAAGTCCTCCGCAGAGAAGTTCTACAAAGTGTGGAGGAGCCAGTCCTTCCATGTTCCCAAACATGCTTCCAAGCATATCCAAGGAGTTGATATACATGCAGGTGACTGGGAGACTGCGGGCTCTATCAGGATTTGGCAGTACACAATCGGAGGGAAAGCCGGGGTCTTTAAAGAGGAGGTTTCC SRR7180087 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 17:58:08 Started mapping on | Feb 10 17:58:08 Finished on | Feb 10 18:01:46 Mapping speed, Million of reads per hour | 298.82 Number of input reads | 18095402 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 16591624 Uniquely mapped reads % | 91.69% Average mapped length | 295.11 Number of splices: Total | 16000081 Number of splices: Annotated (sjdb) | 15680956 Number of splices: GT/AG | 15740072 Number of splices: GC/AG | 202092 Number of splices: AT/AC | 12802 Number of splices: Non-canonical | 45115 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.72 Insertion rate per base | 0.02% Insertion average length | 2.63 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 442490 % of reads mapped to multiple loci | 2.45% Number of reads mapped to too many loci | 108504 % of reads mapped to too many loci | 0.60% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.14% % of reads unmapped: other | 0.13% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1093905 1093905 1093905 N_multimapping 442490 442490 442490 N_noFeature 427046 16435929 499751 N_ambiguous 175636 1299 91765 UnstrandedReadsAssigned:15988942 PositiveStrandReadsAssigned:154396 NegativeStrandReadsAssigned:16000108 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7180087 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7180087-trimmed-pair1.fastq SRR7180087-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,095,402 reads, 15,932,950 reads pseudoaligned [quant] estimated average fragment length: 233.267 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,143 rounds 52401 SRR7180087.ke.tsv 34699 SRR7180087.se.tsv 87100 total ==> SRR7180087.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1785.73 2551 88.8393 Potri.005G024800.1.v4.1 1035 802.733 663 51.3634 Potri.004G059700.1.v4.1 961 728.748 102 8.70431 Potri.007G009000.2.v4.1 1416 1183.73 1 0.0525361 Potri.003G141000.2.v4.1 2943 2710.73 855.236 19.6205 Potri.016G087400.1.v4.1 270 79.1767 1235 970.021 Potri.015G069301.1.v4.1 564 334.315 0 0 Potri.010G195200.1.v4.1 1773 1540.73 514 20.7466 Potri.012G127500.1.v4.1 977 744.74 5798 484.155 ==> SRR7180087.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 58 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 512 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 335 SRR7180087 completed mapping pipeline successfully