Starting /dee2/code/volunteer_pipeline.sh SRR7180088 current disk space = 3057818038272 free memory = 1442545892 SRR7180088 SRAfilesize 8648ad6f039ec17321e1b7df5ff6492d SRR7180088.sra SRR7180088.sra file validated SRR7180088 is paired end SRR7180088 is conventional basespace SRR7180088 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7180088_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.86425 33.0 33.0 34.0 32.0 34.0 2 32.745 33.0 33.0 34.0 31.0 34.0 3 31.8885 33.0 31.0 33.0 29.0 34.0 4 32.20025 33.0 33.0 33.0 31.0 34.0 5 32.8415 33.0 33.0 34.0 31.0 34.0 6 36.8755 38.0 37.0 38.0 35.0 38.0 7 37.29325 38.0 38.0 38.0 36.0 38.0 8 37.46425 38.0 38.0 38.0 37.0 38.0 9 37.5845 38.0 38.0 38.0 38.0 38.0 10-14 37.648649999999996 38.0 38.0 38.0 38.0 38.0 15-19 37.674899999999994 38.0 38.0 38.0 38.0 38.0 20-24 37.6543 38.0 38.0 38.0 38.0 38.0 25-29 37.65335 38.0 38.0 38.0 38.0 38.0 30-34 37.621050000000004 38.0 38.0 38.0 38.0 38.0 35-39 37.6164 38.0 38.0 38.0 38.0 38.0 40-44 37.59135 38.0 38.0 38.0 38.0 38.0 45-49 37.564499999999995 38.0 38.0 38.0 38.0 38.0 50-54 37.520050000000005 38.0 38.0 38.0 38.0 38.0 55-59 37.501599999999996 38.0 38.0 38.0 37.8 38.0 60-64 37.4678 38.0 38.0 38.0 37.2 38.0 65-69 37.4246 38.0 38.0 38.0 37.0 38.0 70-74 37.380700000000004 38.0 38.0 38.0 37.0 38.0 75-79 37.3794 38.0 38.0 38.0 37.0 38.0 80-84 37.313300000000005 38.0 38.0 38.0 37.0 38.0 85-89 37.280950000000004 38.0 38.0 38.0 37.0 38.0 90-94 37.18815 38.0 38.0 38.0 36.8 38.0 95-99 37.1603 38.0 38.0 38.0 36.0 38.0 100-104 37.0768 38.0 38.0 38.0 36.0 38.0 105-109 36.97305 38.0 38.0 38.0 35.8 38.0 110-114 36.902750000000005 38.0 38.0 38.0 35.6 38.0 115-119 36.800200000000004 38.0 38.0 38.0 35.0 38.0 120-124 36.7479 38.0 38.0 38.0 35.0 38.0 125-129 36.63505 38.0 38.0 38.0 34.6 38.0 130-134 36.3457 38.0 38.0 38.0 34.0 38.0 135-139 36.13265 38.0 37.6 38.0 33.4 38.0 140-144 36.032599999999995 38.0 38.0 38.0 33.4 38.0 145-149 35.61255 38.0 36.0 38.0 32.4 38.0 150-151 32.876000000000005 37.0 33.5 38.0 17.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 0.0 10 0.0 11 1.0 12 0.0 13 0.0 14 1.0 15 1.0 16 1.0 17 0.0 18 1.0 19 2.0 20 1.0 21 2.0 22 3.0 23 6.0 24 4.0 25 5.0 26 9.0 27 5.0 28 14.0 29 12.0 30 26.0 31 24.0 32 42.0 33 59.0 34 90.0 35 166.0 36 420.0 37 3104.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 31.087408949011447 15.608740894901144 12.669094693028097 40.634755463059314 2 19.525000000000002 20.65 31.35 28.475 3 19.075 25.45 27.200000000000003 28.275 4 22.05 30.099999999999998 24.099999999999998 23.75 5 22.6 33.825 24.45 19.125 6 17.724999999999998 35.825 25.2 21.25 7 14.399999999999999 21.775 44.025 19.8 8 18.975 24.125 28.825 28.075 9 18.35 23.599999999999998 34.2 23.849999999999998 10-14 20.19 28.92 27.095000000000002 23.794999999999998 15-19 19.685 28.395 28.299999999999997 23.62 20-24 19.275000000000002 28.005000000000003 28.299999999999997 24.42 25-29 19.52 28.835 27.775 23.87 30-34 20.244999999999997 28.405 27.810000000000002 23.54 35-39 19.919999999999998 28.384999999999998 27.529999999999998 24.165 40-44 19.830000000000002 28.355000000000004 28.16 23.655 45-49 20.04 28.285 27.82 23.855 50-54 20.44 27.87 27.67 24.02 55-59 19.865 28.065 28.155 23.915 60-64 19.689999999999998 28.1 28.17 24.04 65-69 19.085 28.985 27.675 24.255 70-74 20.169999999999998 28.294999999999998 27.675 23.86 75-79 20.01 28.349999999999998 27.944999999999997 23.695 80-84 20.09 28.544999999999998 27.11 24.255 85-89 20.07 28.384999999999998 27.889999999999997 23.655 90-94 20.255000000000003 27.725 27.634999999999998 24.385 95-99 20.555 28.48 27.685 23.28 100-104 20.625 28.34 27.6 23.435 105-109 20.8 27.58 27.595 24.025 110-114 20.424999999999997 28.205000000000002 27.884999999999998 23.485 115-119 20.525 28.144999999999996 27.565 23.765 120-124 21.07 27.735 27.55 23.645 125-129 20.674999999999997 28.21 27.439999999999998 23.674999999999997 130-134 20.84 28.315 27.38 23.465 135-139 20.965 28.535 26.415 24.085 140-144 21.18 28.21 26.83 23.78 145-149 21.55 28.555000000000003 26.174999999999997 23.72 150-151 21.099999999999998 28.575 25.5125 24.8125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 1.0 20 1.0 21 0.5 22 2.0 23 2.0 24 2.5 25 3.0 26 3.0 27 5.0 28 6.5 29 11.5 30 22.5 31 31.0 32 32.5 33 35.5 34 52.0 35 67.0 36 80.5 37 108.5 38 144.5 39 161.0 40 173.0 41 208.5 42 228.0 43 266.5 44 296.0 45 286.0 46 281.0 47 260.5 48 228.0 49 207.0 50 185.0 51 152.5 52 115.5 53 90.0 54 78.5 55 50.5 56 29.0 57 23.0 58 16.0 59 12.0 60 8.0 61 5.0 62 6.5 63 5.0 64 2.5 65 2.5 66 2.0 67 1.5 68 0.5 69 1.0 70 1.5 71 1.0 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.9 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.775 #Duplication Level Percentage of deduplicated Percentage of total 1 99.77449260836883 99.55000000000001 2 0.22550739163117012 0.44999999999999996 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.0625 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.175 0.0 0.0 0.0 0.0 94-95 0.225 0.0 0.0 0.0 0.0 96-97 0.2875 0.0 0.0 0.0 0.0 98-99 0.3875 0.0 0.0 0.0 0.0 100-101 0.5125 0.0 0.0 0.0 0.0 102-103 0.6625 0.0 0.0 0.0 0.0 104-105 0.7875000000000001 0.0 0.0 0.0 0.0 106-107 0.8374999999999999 0.0 0.0 0.0 0.0 108-109 1.025 0.0 0.0 0.0 0.0 110-111 1.25 0.0 0.0 0.0 0.0 112-113 1.4249999999999998 0.0 0.0 0.0 0.0 114-115 1.65 0.0 0.0 0.0 0.0 116-117 1.8875 0.0 0.0 0.0 0.0 118-119 2.375 0.0 0.0 0.0 0.0 120-121 2.675 0.0 0.0 0.0 0.0 122-123 2.9625 0.0 0.0 0.0 0.0 124-125 3.2125 0.0 0.0 0.0 0.0 126-127 3.5374999999999996 0.0 0.0 0.0 0.0 128-129 3.9125 0.0 0.0 0.0 0.0 130-131 4.225 0.0 0.0 0.0 0.0 132-133 4.5625 0.0 0.0 0.0 0.0 134-135 5.0625 0.0 0.0 0.0 0.0 136-137 5.7 0.0 0.0 0.0 0.0 138-139 6.5 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGCGAAT 10 0.006836113 144.9625 6 >>END_MODULE SRR7180088 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7180088_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.13825 33.0 33.0 34.0 33.0 34.0 2 33.234 34.0 33.0 34.0 33.0 34.0 3 33.22725 34.0 33.0 34.0 33.0 34.0 4 33.235 34.0 33.0 34.0 33.0 34.0 5 33.26775 34.0 33.0 34.0 33.0 34.0 6 37.41 38.0 38.0 38.0 38.0 38.0 7 37.4035 38.0 38.0 38.0 38.0 38.0 8 37.327 38.0 38.0 38.0 37.0 38.0 9 37.35425 38.0 38.0 38.0 38.0 38.0 10-14 37.36280000000001 38.0 38.0 38.0 37.6 38.0 15-19 37.346799999999995 38.0 38.0 38.0 37.2 38.0 20-24 37.3553 38.0 38.0 38.0 37.6 38.0 25-29 37.32549999999999 38.0 38.0 38.0 37.0 38.0 30-34 37.253150000000005 38.0 38.0 38.0 37.2 38.0 35-39 37.19075 38.0 38.0 38.0 37.0 38.0 40-44 37.12519999999999 38.0 38.0 38.0 37.0 38.0 45-49 37.15525 38.0 38.0 38.0 37.0 38.0 50-54 37.16609999999999 38.0 38.0 38.0 37.0 38.0 55-59 37.07605 38.0 38.0 38.0 36.8 38.0 60-64 37.0875 38.0 38.0 38.0 36.6 38.0 65-69 36.987049999999996 38.0 38.0 38.0 36.0 38.0 70-74 36.97465 38.0 38.0 38.0 36.0 38.0 75-79 36.9362 38.0 38.0 38.0 36.0 38.0 80-84 36.901650000000004 38.0 38.0 38.0 36.0 38.0 85-89 36.83605 38.0 38.0 38.0 35.8 38.0 90-94 36.76004999999999 38.0 38.0 38.0 35.2 38.0 95-99 36.60445 38.0 38.0 38.0 34.6 38.0 100-104 36.4261 38.0 38.0 38.0 34.0 38.0 105-109 36.2663 38.0 38.0 38.0 34.0 38.0 110-114 36.23615 38.0 38.0 38.0 33.8 38.0 115-119 36.040800000000004 38.0 37.2 38.0 33.2 38.0 120-124 35.8332 38.0 37.0 38.0 32.8 38.0 125-129 35.6792 38.0 36.6 38.0 32.0 38.0 130-134 35.438950000000006 38.0 36.0 38.0 31.0 38.0 135-139 35.1723 38.0 35.8 38.0 29.4 38.0 140-144 34.57665 38.0 35.0 38.0 27.0 38.0 145-149 34.19575 38.0 35.0 38.0 25.4 38.0 150-151 30.372374999999998 36.5 29.0 38.0 8.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 7.0 3 0.0 4 2.0 5 3.0 6 1.0 7 2.0 8 3.0 9 0.0 10 3.0 11 0.0 12 0.0 13 1.0 14 0.0 15 1.0 16 1.0 17 2.0 18 1.0 19 2.0 20 3.0 21 4.0 22 5.0 23 6.0 24 11.0 25 8.0 26 10.0 27 16.0 28 25.0 29 24.0 30 36.0 31 39.0 32 62.0 33 93.0 34 137.0 35 241.0 36 620.0 37 2631.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.3 17.05 18.9 25.75 2 26.375 23.5 32.225 17.9 3 20.8 26.224999999999998 31.324999999999996 21.65 4 24.5 34.35 21.675 19.475 5 24.125 37.275000000000006 20.849999999999998 17.75 6 19.579894973743436 37.23430857714429 23.88097024256064 19.30482620655164 7 18.75 19.175 40.949999999999996 21.125 8 21.325 24.75 27.400000000000002 26.525 9 21.7 24.55 29.349999999999998 24.4 10-14 24.412441244124413 28.77287728772877 25.402540254025403 21.412141214121412 15-19 23.164632926585316 28.135627125425085 27.485497099419888 21.214242848569715 20-24 23.046523261630817 28.214107053526767 27.39369684842421 21.34567283641821 25-29 23.213928357014208 27.68661196718031 27.55153091855113 21.547928757254354 30-34 22.882882882882882 28.033033033033032 27.91791791791792 21.166166166166168 35-39 23.7217687415494 28.389002954579603 27.086984826481046 20.802243477389954 40-44 23.48788303625075 28.54996995794112 27.072902062888044 20.889244942920087 45-49 23.43406043626176 27.7416449869922 28.286972183309988 20.53732239343606 50-54 23.401700850425215 28.62431215607804 27.823911955977987 20.150075037518757 55-59 23.36168084042021 27.77888944472236 27.86893446723362 20.990495247623812 60-64 23.65182591295648 27.75887943971986 27.603801900950476 20.985492746373186 65-69 23.70566755039768 28.027612425591514 27.127207243259466 21.13951278075134 70-74 24.19709854927464 27.933966983491747 27.348674337168582 20.520260130065033 75-79 23.340503226451904 27.817517883047373 27.85253364013806 20.989445250362664 80-84 23.611805902951478 27.843921960980488 27.453726863431715 21.09054527263632 85-89 24.145865639537792 28.32274523535591 26.7720474213396 20.759341703766694 90-94 23.999799959992 28.030606121224245 27.30546109221844 20.66413282656531 95-99 23.927392739273927 27.792779277927792 27.602760276027606 20.67706770677068 100-104 24.093614042106314 27.89918487773166 27.299094864229634 20.70810621593239 105-109 24.106205310265512 27.841392069603483 27.561378068903448 20.49102455122756 110-114 24.19 27.79 28.15 19.869999999999997 115-119 24.526226311315565 28.151407570378517 27.45137256862843 19.870993549677486 120-124 25.001250312578144 27.921980495123783 27.366841710427607 19.70992748187047 125-129 24.308507977792225 28.049817436102636 27.664682638923622 19.976991947181514 130-134 24.9499799919968 27.370948379351738 27.66606642657063 20.013005202080834 135-139 25.301325331332837 28.272068017004255 27.00675168792198 19.419854963740935 140-144 25.35633908477119 28.327081770442607 26.751687921980494 19.564891222805702 145-149 25.802740822246673 27.773331999599883 26.79803941182355 19.6258877663299 150-151 24.640220247778753 28.45701414090852 27.08046552371418 19.82230008759855 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.5 22 0.5 23 0.5 24 1.0 25 2.0 26 5.0 27 4.5 28 1.5 29 4.5 30 7.0 31 10.5 32 16.0 33 22.5 34 38.0 35 55.0 36 69.0 37 80.0 38 105.0 39 151.0 40 200.0 41 238.5 42 253.5 43 272.5 44 286.5 45 290.0 46 312.5 47 290.0 48 240.0 49 216.0 50 179.0 51 153.0 52 133.5 53 105.0 54 78.5 55 49.5 56 29.5 57 24.5 58 23.5 59 14.5 60 7.5 61 5.0 62 3.5 63 2.0 64 3.0 65 4.0 66 3.0 67 2.0 68 1.5 69 0.5 70 0.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.025 7 0.0 8 0.0 9 0.0 10-14 0.01 15-19 0.02 20-24 0.05 25-29 0.06 30-34 0.1 35-39 0.155 40-44 0.13999999999999999 45-49 0.06 50-54 0.05 55-59 0.05 60-64 0.05 65-69 0.045 70-74 0.05 75-79 0.045 80-84 0.05 85-89 0.045 90-94 0.02 95-99 0.01 100-104 0.015 105-109 0.005 110-114 0.0 115-119 0.005 120-124 0.025 125-129 0.034999999999999996 130-134 0.04 135-139 0.025 140-144 0.025 145-149 0.03 150-151 0.11249999999999999 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.175 #Duplication Level Percentage of deduplicated Percentage of total 1 99.49584068565667 98.675 2 0.3781194857574994 0.75 3 0.07562389715149988 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.025207965717166627 0.15 7 0.0 0.0 8 0.025207965717166627 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ACCAGCTTGAGCAAATTCAGTTTCTAAGCAAAAGCTTTCCAGGCCCCTTT 8 0.2 No Hit GTTAGGCTTGAGCAGATTCATTCGCCAACTAACCCTTTAATTTATCCTAT 6 0.15 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.0625 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.175 0.0 0.0 0.0 0.0 92-93 0.2 0.0 0.0 0.0 0.0 94-95 0.2625 0.0 0.0 0.0 0.0 96-97 0.3375 0.0 0.0 0.0 0.0 98-99 0.4375 0.0 0.0 0.0 0.0 100-101 0.5625 0.0 0.0 0.0 0.0 102-103 0.7375 0.0 0.0 0.0 0.0 104-105 0.875 0.0 0.0 0.0 0.0 106-107 0.9375 0.0 0.0 0.0 0.0 108-109 1.125 0.0 0.0 0.0 0.0 110-111 1.35 0.0 0.0 0.0 0.0 112-113 1.525 0.0 0.0 0.0 0.0 114-115 1.75 0.0 0.0 0.0 0.0 116-117 1.9625 0.0 0.0 0.0 0.0 118-119 2.45 0.0 0.0 0.0 0.0 120-121 2.775 0.0 0.0 0.0 0.0 122-123 3.0625 0.0 0.0 0.0 0.0 124-125 3.35 0.0 0.0 0.0 0.0 126-127 3.7 0.0 0.0 0.0 0.0 128-129 4.112500000000001 0.0 0.0 0.0 0.0 130-131 4.4375 0.0 0.0 0.0 0.0 132-133 4.75 0.0 0.0 0.0 0.0 134-135 5.2375 0.0 0.0 0.0 0.0 136-137 5.875 0.0 0.0 0.0 0.0 138-139 6.6875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAAGCAA 10 0.006830828 145.0 145 >>END_MODULE Read 729180 spots for SRR7180088.sra Written 729180 spots for SRR7180088.sra Read 729180 spots for SRR7180088.sra Written 729180 spots for SRR7180088.sra Read 729180 spots for SRR7180088.sra Written 729180 spots for SRR7180088.sra Read 729180 spots for SRR7180088.sra Written 729180 spots for SRR7180088.sra Read 729180 spots for SRR7180088.sra Written 729180 spots for SRR7180088.sra Read 729180 spots for SRR7180088.sra Written 729180 spots for SRR7180088.sra Read 729180 spots for SRR7180088.sra Written 729180 spots for SRR7180088.sra Read 729180 spots for SRR7180088.sra Written 729180 spots for SRR7180088.sra Read 729180 spots for SRR7180088.sra Written 729180 spots for SRR7180088.sra Read 729180 spots for SRR7180088.sra Written 729180 spots for SRR7180088.sra Read 729180 spots for SRR7180088.sra Written 729180 spots for SRR7180088.sra Read 729180 spots for SRR7180088.sra Written 729180 spots for SRR7180088.sra Read 729180 spots for SRR7180088.sra Written 729180 spots for SRR7180088.sra Read 729180 spots for SRR7180088.sra Written 729180 spots for SRR7180088.sra Read 729180 spots for SRR7180088.sra Written 729180 spots for SRR7180088.sra Read 729187 spots for SRR7180088.sra Written 729187 spots for SRR7180088.sra Read 729180 spots for SRR7180088.sra Written 729180 spots for SRR7180088.sra Read 729180 spots for SRR7180088.sra Written 729180 spots for SRR7180088.sra Read 729180 spots for SRR7180088.sra Written 729180 spots for SRR7180088.sra Read 729180 spots for SRR7180088.sra Written 729180 spots for SRR7180088.sra SRR ids: ['SRR7180088.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_duabkuds SRR7180088.sra spots: 14583607 blocks: [[1, 729180], [729181, 1458360], [1458361, 2187540], [2187541, 2916720], [2916721, 3645900], [3645901, 4375080], [4375081, 5104260], [5104261, 5833440], [5833441, 6562620], [6562621, 7291800], [7291801, 8020980], [8020981, 8750160], [8750161, 9479340], [9479341, 10208520], [10208521, 10937700], [10937701, 11666880], [11666881, 12396060], [12396061, 13125240], [13125241, 13854420], [13854421, 14583607]] SRR7180088 file size 4920205 SRR7180088 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7180088 SRR7180088_1.fastq SRR7180088_2.fastq Input file: SRR7180088_1.fastq Paired file: SRR7180088_2.fastq trimmed: SRR7180088-trimmed-pair1.fastq, SRR7180088-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 18:02:01 2025 >> started Mon Feb 10 18:02:25 2025 >> done (23.592s) 14583607 read pairs processed; of these: 19723 ( 0.14%) short read pairs filtered out after trimming by size control 9869 ( 0.07%) empty read pairs filtered out after trimming by size control 14554015 (99.80%) read pairs available; of these: 5404432 (37.13%) trimmed read pairs available after processing 9149583 (62.87%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 4 0.00% 20 3 0.00% 21 4 0.00% 22 5 0.00% 23 6 0.00% 24 3 0.00% 25 2 0.00% 26 1 0.00% 27 7 0.00% 28 4 0.00% 29 2 0.00% 30 4 0.00% 31 5 0.00% 32 3 0.00% 33 5 0.00% 34 5 0.00% 35 2 0.00% 36 18 0.00% 37 9 0.00% 38 4 0.00% 39 5 0.00% 40 17 0.00% 41 24 0.00% 42 7 0.00% 43 13 0.00% 44 23 0.00% 45 54 0.00% 46 45 0.00% 47 49 0.00% 48 30 0.00% 49 44 0.00% 50 37 0.00% 51 87 0.00% 52 20 0.00% 53 29 0.00% 54 41 0.00% 55 95 0.00% 56 49 0.00% 57 47 0.00% 58 44 0.00% 59 84 0.00% 60 83 0.00% 61 80 0.00% 62 81 0.00% 63 93 0.00% 64 124 0.00% 65 149 0.00% 66 123 0.00% 67 196 0.00% 68 201 0.00% 69 239 0.00% 70 273 0.00% 71 308 0.00% 72 400 0.00% 73 395 0.00% 74 549 0.00% 75 641 0.00% 76 722 0.00% 77 841 0.01% 78 899 0.01% 79 1003 0.01% 80 1220 0.01% 81 1342 0.01% 82 1609 0.01% 83 1884 0.01% 84 3111 0.02% 85 3834 0.03% 86 3989 0.03% 87 4330 0.03% 88 4550 0.03% 89 4888 0.03% 90 5269 0.04% 91 5518 0.04% 92 5750 0.04% 93 6371 0.04% 94 6740 0.05% 95 7336 0.05% 96 7902 0.05% 97 8724 0.06% 98 9078 0.06% 99 9686 0.07% 100 10399 0.07% 101 10995 0.08% 102 11940 0.08% 103 12600 0.09% 104 13388 0.09% 105 14085 0.10% 106 15007 0.10% 107 16105 0.11% 108 17150 0.12% 109 17796 0.12% 110 18806 0.13% 111 19953 0.14% 112 21129 0.15% 113 21654 0.15% 114 22777 0.16% 115 24190 0.17% 116 24910 0.17% 117 26118 0.18% 118 27518 0.19% 119 28643 0.20% 120 29726 0.20% 121 31910 0.22% 122 32785 0.23% 123 33577 0.23% 124 34689 0.24% 125 35444 0.24% 126 37282 0.26% 127 38251 0.26% 128 39602 0.27% 129 41238 0.28% 130 42848 0.29% 131 44079 0.30% 132 46145 0.32% 133 48152 0.33% 134 50076 0.34% 135 51990 0.36% 136 53918 0.37% 137 56594 0.39% 138 58376 0.40% 139 61273 0.42% 140 64677 0.44% 141 68757 0.47% 142 74339 0.51% 143 80892 0.56% 144 88997 0.61% 145 101191 0.70% 146 118640 0.82% 147 149850 1.03% 148 215068 1.48% 149 417122 2.87% 150 2670309 18.35% 151 9149583 62.87% 14554015 reads passed initial QC criterion=sequence-density sequence-density=0.71 sequence-density-rank=1 fanout-score=2.10 fanout-score-rank=32 prefix-density=0.74 prefix-fanout=2.0 sequence=CAGGTGCAGTTTGATCCACACTTGCA criterion=fanout-score sequence-density=0.09 sequence-density-rank=28 fanout-score=79.39 fanout-score-rank=1 prefix-density=0.42 prefix-fanout=17.3 sequence=CCATCTTCAAGCTGCTTCCCAGCAAA criterion=sequence-density sequence-density=0.74 sequence-density-rank=1 fanout-score=2.88 fanout-score-rank=27 prefix-density=0.94 prefix-fanout=2.3 sequence=GGTTTCTCAGAGA criterion=fanout-score sequence-density=0.01 sequence-density-rank=34 fanout-score=273.77 fanout-score-rank=1 prefix-density=0.17 prefix-fanout=13.9 sequence=TTTCTTTGAGAGTGCATAGATTTGTGTTGATATAGAAAACAATGGCACTACATGGAAAGATTGAGACAACATTAGAACTCAAGTCCTCCGCAGAGAAGTTCTACAAAGTGTGGAGGAGCCAGTCCTTCCATGTTCCCAAACATGCTTCCAAGCATATCCAAGGAGTTGATATACATGCAGGTGACTGGGAGACTGCGGGCTCTATCAGGATTTGGCAGTACACAATCGGAGGGAAAGCCGGGGTCTTTAAAGAGGAGGTTTCCTTCGATGATGAGAACAAGATCATAACTCTTAATGGTTTGGAAGGAGATGTCATGAAAATTTACAAGGTCTATAGGCCCGTCTGGCAGCTTACACCAAAAGGCTCGGGCTGCTTGGCAAAACTGACCATTGAATACGAAAAACTCCATCCTGAAGTCCCGGTTCCAGAGATTTATGTTGATCTTATGGTTCATATGACTAAAGACATCGACGAAGCCCTTAGCACGGAGTAATAGAAGGGGTCATCGAT SRR7180088 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 18:03:13 Started mapping on | Feb 10 18:03:14 Finished on | Feb 10 18:04:50 Mapping speed, Million of reads per hour | 545.78 Number of input reads | 14554015 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 13651017 Uniquely mapped reads % | 93.80% Average mapped length | 294.58 Number of splices: Total | 13609811 Number of splices: Annotated (sjdb) | 13365144 Number of splices: GT/AG | 13393992 Number of splices: GC/AG | 170567 Number of splices: AT/AC | 10660 Number of splices: Non-canonical | 34592 Mismatch rate per base, % | 0.32% Deletion rate per base | 0.03% Deletion average length | 2.60 Insertion rate per base | 0.02% Insertion average length | 2.56 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 333665 % of reads mapped to multiple loci | 2.29% Number of reads mapped to too many loci | 36502 % of reads mapped to too many loci | 0.25% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.61% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 586998 586998 586998 N_multimapping 333665 333665 333665 N_noFeature 315320 13507217 385411 N_ambiguous 134781 923 60555 UnstrandedReadsAssigned:13200916 PositiveStrandReadsAssigned:142877 NegativeStrandReadsAssigned:13205051 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7180088 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7180088-trimmed-pair1.fastq SRR7180088-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,554,015 reads, 13,061,297 reads pseudoaligned [quant] estimated average fragment length: 231.397 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,138 rounds 52401 SRR7180088.ke.tsv 34699 SRR7180088.se.tsv 87100 total ==> SRR7180088.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1787.6 1335 52.186 Potri.005G024800.1.v4.1 1035 804.603 262 22.7543 Potri.004G059700.1.v4.1 961 730.618 19 1.81722 Potri.007G009000.2.v4.1 1416 1185.6 0 0 Potri.003G141000.2.v4.1 2943 2712.6 706 18.187 Potri.016G087400.1.v4.1 270 82.3068 874 742.026 Potri.015G069301.1.v4.1 564 336.365 0 0 Potri.010G195200.1.v4.1 1773 1542.6 321.912 14.5823 Potri.012G127500.1.v4.1 977 746.608 2997 280.503 ==> SRR7180088.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 45 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 559 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 368 SRR7180088 completed mapping pipeline successfully