Starting /dee2/code/volunteer_pipeline.sh SRR7180089 current disk space = 3057665343488 free memory = 1024160396 SRR7180089 SRAfilesize 8e29700d058b686052013a3f205f2a57 SRR7180089.sra SRR7180089.sra file validated SRR7180089 is paired end SRR7180089 is conventional basespace SRR7180089 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7180089_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 29.16275 33.0 30.0 33.0 18.0 34.0 2 31.75275 33.0 31.0 33.0 28.0 34.0 3 31.58875 33.0 31.0 33.0 28.0 34.0 4 32.7375 33.0 33.0 34.0 32.0 34.0 5 33.08875 33.0 33.0 34.0 33.0 34.0 6 36.54825 38.0 37.0 38.0 34.0 38.0 7 37.27375 38.0 38.0 38.0 36.0 38.0 8 37.403 38.0 38.0 38.0 36.0 38.0 9 37.66325 38.0 38.0 38.0 38.0 38.0 10-14 37.687349999999995 38.0 38.0 38.0 38.0 38.0 15-19 37.6789 38.0 38.0 38.0 38.0 38.0 20-24 37.6553 38.0 38.0 38.0 38.0 38.0 25-29 37.617549999999994 38.0 38.0 38.0 38.0 38.0 30-34 37.554050000000004 38.0 38.0 38.0 38.0 38.0 35-39 37.510299999999994 38.0 38.0 38.0 38.0 38.0 40-44 37.458999999999996 38.0 38.0 38.0 38.0 38.0 45-49 37.41295 38.0 38.0 38.0 38.0 38.0 50-54 37.41655 38.0 38.0 38.0 38.0 38.0 55-59 37.3768 38.0 38.0 38.0 37.2 38.0 60-64 37.353500000000004 38.0 38.0 38.0 37.2 38.0 65-69 37.3044 38.0 38.0 38.0 37.0 38.0 70-74 37.28789999999999 38.0 38.0 38.0 37.0 38.0 75-79 37.19025 38.0 38.0 38.0 37.0 38.0 80-84 37.177200000000006 38.0 38.0 38.0 37.0 38.0 85-89 37.08219999999999 38.0 38.0 38.0 36.4 38.0 90-94 37.01535 38.0 38.0 38.0 36.0 38.0 95-99 36.909949999999995 38.0 38.0 38.0 36.0 38.0 100-104 36.88995 38.0 38.0 38.0 35.8 38.0 105-109 36.7668 38.0 38.0 38.0 35.6 38.0 110-114 36.6553 38.0 38.0 38.0 35.0 38.0 115-119 36.6011 38.0 38.0 38.0 35.0 38.0 120-124 36.47895 38.0 38.0 38.0 34.4 38.0 125-129 36.4037 38.0 38.0 38.0 34.2 38.0 130-134 36.11285 38.0 38.0 38.0 33.6 38.0 135-139 35.8587 38.0 38.0 38.0 33.0 38.0 140-144 35.601 38.0 37.0 38.0 32.8 38.0 145-149 35.3524 38.0 36.0 38.0 32.0 38.0 150-151 32.707625 36.5 33.5 38.0 16.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 4.0 8 3.0 9 2.0 10 1.0 11 0.0 12 2.0 13 2.0 14 2.0 15 1.0 16 0.0 17 5.0 18 4.0 19 2.0 20 0.0 21 2.0 22 4.0 23 0.0 24 5.0 25 8.0 26 9.0 27 11.0 28 12.0 29 15.0 30 26.0 31 37.0 32 42.0 33 66.0 34 83.0 35 180.0 36 470.0 37 3002.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.94940010432968 12.54564423578508 12.310902451747523 34.19405320813772 2 21.099999999999998 17.849999999999998 35.425000000000004 25.624999999999996 3 19.950000000000003 20.575 27.775 31.7 4 21.425 28.575 24.75 25.25 5 22.5 32.875 25.775 18.85 6 18.675 33.650000000000006 27.450000000000003 20.225 7 14.124999999999998 26.174999999999997 41.675000000000004 18.025 8 17.375 25.7 32.875 24.05 9 17.724999999999998 25.124999999999996 33.7 23.45 10-14 19.64 30.235 28.110000000000003 22.015 15-19 19.49 28.999999999999996 28.46 23.05 20-24 20.01 29.160000000000004 28.115000000000002 22.715 25-29 19.625 28.845 28.405 23.125 30-34 19.67 29.325000000000003 28.18 22.825 35-39 20.369999999999997 29.255 27.810000000000002 22.564999999999998 40-44 19.99 29.03 27.88 23.1 45-49 19.84 29.365000000000002 27.63 23.165 50-54 19.259999999999998 29.360000000000003 27.800000000000004 23.580000000000002 55-59 19.509999999999998 28.84 28.13 23.52 60-64 19.77 28.585 27.705000000000002 23.94 65-69 19.830000000000002 28.660000000000004 28.09 23.419999999999998 70-74 20.565 28.705000000000002 27.845 22.884999999999998 75-79 20.150000000000002 28.265 27.83 23.755000000000003 80-84 20.580000000000002 28.13 27.605 23.685000000000002 85-89 20.18 28.28 28.199999999999996 23.34 90-94 20.05 28.849999999999998 27.715 23.385 95-99 20.495 28.405 27.800000000000004 23.3 100-104 20.635 28.335 27.650000000000002 23.380000000000003 105-109 20.935000000000002 28.804999999999996 27.189999999999998 23.07 110-114 21.240000000000002 28.13 27.48 23.150000000000002 115-119 20.905 28.000000000000004 28.09 23.005 120-124 20.919999999999998 28.565 27.389999999999997 23.125 125-129 21.38 28.355000000000004 26.605 23.66 130-134 20.830000000000002 29.075 27.11 22.985 135-139 21.19 28.595 27.3 22.915 140-144 21.38 28.33 26.840000000000003 23.45 145-149 20.965 28.285 26.919999999999998 23.830000000000002 150-151 21.938711694809257 27.942464040025015 26.116322701688553 24.002501563477175 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 4.0 1 2.5 2 2.5 3 2.0 4 0.0 5 0.5 6 1.5 7 1.5 8 0.5 9 0.0 10 0.5 11 1.0 12 1.0 13 0.5 14 0.0 15 0.5 16 1.5 17 1.0 18 0.0 19 0.0 20 0.0 21 0.0 22 2.0 23 5.5 24 6.0 25 5.5 26 9.5 27 12.0 28 12.5 29 22.5 30 30.5 31 34.0 32 38.5 33 51.5 34 64.0 35 78.0 36 98.0 37 117.0 38 147.5 39 170.0 40 195.0 41 226.0 42 229.5 43 250.0 44 264.0 45 249.5 46 250.5 47 258.5 48 228.5 49 187.0 50 153.0 51 123.0 52 109.0 53 86.5 54 67.5 55 50.0 56 37.5 57 29.5 58 19.5 59 13.5 60 11.0 61 9.0 62 8.0 63 6.5 64 5.0 65 1.5 66 3.0 67 3.0 68 0.0 69 1.0 70 1.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.15 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0625 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.3 #Duplication Level Percentage of deduplicated Percentage of total 1 99.39577039274926 98.7 2 0.5035246727089627 1.0 3 0.10070493454179255 0.3 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.175 0.0 0.0 0.0 0.0 94-95 0.1875 0.0 0.0 0.0 0.0 96-97 0.2375 0.0 0.0 0.0 0.0 98-99 0.275 0.0 0.0 0.0 0.0 100-101 0.36250000000000004 0.0 0.0 0.0 0.0 102-103 0.44999999999999996 0.0 0.0 0.0 0.0 104-105 0.55 0.0 0.0 0.0 0.0 106-107 0.7625 0.0 0.0 0.0 0.0 108-109 0.9 0.0 0.0 0.0 0.0 110-111 1.025 0.0 0.0 0.0 0.0 112-113 1.2625 0.0 0.0 0.0 0.0 114-115 1.4875 0.0 0.0 0.0 0.0 116-117 1.725 0.0 0.0 0.0 0.0 118-119 2.125 0.0 0.0 0.0 0.0 120-121 2.3499999999999996 0.0 0.0 0.0 0.0 122-123 2.725 0.0 0.0 0.0 0.0 124-125 3.1875 0.0 0.0 0.0 0.0 126-127 3.475 0.0 0.0 0.0 0.0 128-129 3.825 0.0 0.0 0.0 0.0 130-131 4.3375 0.0 0.0 0.0 0.0 132-133 4.8875 0.0 0.0 0.0 0.0 134-135 5.4 0.0 0.0 0.0 0.0 136-137 5.7125 0.0 0.0 0.0 0.0 138-139 6.35 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATCGGAA 40 0.007674091 18.117188 140-144 >>END_MODULE SRR7180089 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7180089_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.85575 33.0 33.0 34.0 32.0 34.0 2 32.94775 34.0 33.0 34.0 32.0 34.0 3 32.91875 34.0 33.0 34.0 32.0 34.0 4 32.86 34.0 33.0 34.0 33.0 34.0 5 32.868 34.0 33.0 34.0 32.0 34.0 6 36.86575 38.0 38.0 38.0 37.0 38.0 7 36.9155 38.0 38.0 38.0 37.0 38.0 8 36.8795 38.0 38.0 38.0 37.0 38.0 9 36.84725 38.0 38.0 38.0 37.0 38.0 10-14 36.839549999999996 38.0 38.0 38.0 37.0 38.0 15-19 36.7758 38.0 38.0 38.0 37.0 38.0 20-24 36.733050000000006 38.0 38.0 38.0 37.0 38.0 25-29 36.81075 38.0 38.0 38.0 37.0 38.0 30-34 36.71485 38.0 38.0 38.0 36.8 38.0 35-39 36.654700000000005 38.0 38.0 38.0 36.4 38.0 40-44 36.625099999999996 38.0 38.0 38.0 36.4 38.0 45-49 36.61015 38.0 38.0 38.0 36.0 38.0 50-54 36.59245 38.0 38.0 38.0 36.0 38.0 55-59 36.501599999999996 38.0 38.0 38.0 36.0 38.0 60-64 36.433600000000006 38.0 38.0 38.0 35.4 38.0 65-69 36.39225 38.0 38.0 38.0 35.6 38.0 70-74 36.34440000000001 38.0 38.0 38.0 35.0 38.0 75-79 36.303700000000006 38.0 38.0 38.0 35.2 38.0 80-84 36.22325 38.0 38.0 38.0 35.0 38.0 85-89 36.183550000000004 38.0 38.0 38.0 34.2 38.0 90-94 36.01625 38.0 38.0 38.0 34.0 38.0 95-99 35.942550000000004 38.0 38.0 38.0 34.0 38.0 100-104 35.79455 38.0 38.0 38.0 33.2 38.0 105-109 35.70065 38.0 38.0 38.0 33.0 38.0 110-114 35.58594999999999 38.0 38.0 38.0 33.0 38.0 115-119 35.4724 38.0 37.6 38.0 31.8 38.0 120-124 35.319399999999995 38.0 37.2 38.0 31.4 38.0 125-129 34.9536 38.0 36.4 38.0 29.0 38.0 130-134 34.745200000000004 38.0 36.0 38.0 28.2 38.0 135-139 34.48925 38.0 36.0 38.0 26.8 38.0 140-144 34.112700000000004 38.0 35.2 38.0 24.2 38.0 145-149 33.460699999999996 38.0 34.8 38.0 17.4 38.0 150-151 29.933750000000003 36.5 28.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 24.0 3 12.0 4 6.0 5 2.0 6 6.0 7 6.0 8 4.0 9 2.0 10 6.0 11 6.0 12 3.0 13 8.0 14 5.0 15 2.0 16 7.0 17 7.0 18 7.0 19 6.0 20 3.0 21 6.0 22 10.0 23 13.0 24 13.0 25 13.0 26 13.0 27 15.0 28 24.0 29 32.0 30 40.0 31 27.0 32 58.0 33 64.0 34 112.0 35 194.0 36 516.0 37 2728.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.71915747241725 18.806419257773317 16.599799398194584 24.874623871614844 2 25.424999999999997 25.05 31.45 18.075 3 21.575 28.15 29.25 21.025 4 24.65 32.95 22.975 19.425 5 23.549999999999997 35.05 23.45 17.95 6 20.225 33.875 27.6 18.3 7 20.8 19.625 37.824999999999996 21.75 8 22.625 23.400000000000002 28.225 25.75 9 20.925 26.424999999999997 28.549999999999997 24.099999999999998 10-14 23.535 28.199999999999996 26.575 21.69 15-19 23.1 28.62 27.150000000000002 21.13 20-24 23.655 28.92 27.060000000000002 20.365 25-29 23.465 28.59 27.015 20.93 30-34 23.630000000000003 28.439999999999998 27.27 20.66 35-39 23.876193809690484 27.83639181959098 27.65638281914096 20.63103155157758 40-44 23.94359153873081 28.484272640896137 27.01905285792869 20.553082962444368 45-49 23.25 28.09 27.315 21.345 50-54 23.375 28.4 27.22 21.005 55-59 23.305 27.845 27.965 20.885 60-64 23.91 27.365000000000002 27.99 20.735 65-69 23.32 28.37 27.944999999999997 20.365 70-74 23.535 28.110000000000003 27.77 20.585 75-79 23.7 28.139999999999997 27.515 20.645 80-84 23.71 28.075 27.47 20.745 85-89 23.785 27.529999999999998 28.244999999999997 20.44 90-94 22.835 28.53 27.815 20.82 95-99 23.235 27.860000000000003 28.355000000000004 20.549999999999997 100-104 23.955000000000002 27.675 28.09 20.28 105-109 23.71 28.050000000000004 28.08 20.16 110-114 23.61 27.715 27.755000000000003 20.919999999999998 115-119 23.74 28.43 27.08 20.75 120-124 24.075 27.794999999999998 27.38 20.75 125-129 23.830000000000002 28.685 27.38 20.105 130-134 23.91 28.54 27.775 19.775000000000002 135-139 24.665 28.08 27.325 19.93 140-144 24.705 28.23 27.55 19.515 145-149 24.65 28.465 27.57 19.314999999999998 150-151 25.47642928786359 28.385155466399198 26.71765295887663 19.420762286860583 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 1.0 14 1.5 15 0.5 16 0.0 17 0.5 18 2.0 19 1.5 20 0.0 21 0.5 22 1.5 23 2.5 24 3.5 25 3.5 26 4.0 27 4.0 28 4.0 29 6.5 30 7.5 31 11.5 32 20.0 33 30.0 34 45.5 35 55.5 36 71.0 37 105.5 38 130.5 39 150.0 40 181.5 41 217.0 42 248.5 43 278.0 44 293.0 45 292.5 46 290.5 47 274.5 48 238.0 49 202.5 50 180.0 51 154.5 52 121.5 53 85.0 54 61.5 55 57.0 56 43.5 57 30.0 58 22.5 59 14.0 60 14.5 61 11.5 62 7.5 63 5.0 64 2.0 65 2.0 66 1.5 67 0.5 68 0.5 69 1.0 70 0.5 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.5 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.3 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.005 40-44 0.015 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.3 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.45 #Duplication Level Percentage of deduplicated Percentage of total 1 99.44695827048768 98.9 2 0.5530417295123178 1.0999999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.037500000000000006 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.2 0.0 0.0 0.0 0.0 94-95 0.21250000000000002 0.0 0.0 0.0 0.0 96-97 0.2625 0.0 0.0 0.0 0.0 98-99 0.3 0.0 0.0 0.0 0.0 100-101 0.4 0.0 0.0 0.0 0.0 102-103 0.5 0.0 0.0 0.0 0.0 104-105 0.6 0.0 0.0 0.0 0.0 106-107 0.7875 0.0 0.0 0.0 0.0 108-109 0.925 0.0 0.0 0.0 0.0 110-111 1.0625 0.0 0.0 0.0 0.0 112-113 1.3 0.0 0.0 0.0 0.0 114-115 1.625 0.0 0.0 0.0 0.0 116-117 1.925 0.0 0.0 0.0 0.0 118-119 2.325 0.0 0.0 0.0 0.0 120-121 2.55 0.0 0.0 0.0 0.0 122-123 2.9000000000000004 0.0 0.0 0.0 0.0 124-125 3.3625 0.0 0.0 0.0 0.0 126-127 3.675 0.0 0.0 0.0 0.0 128-129 4.0375 0.0 0.0 0.0 0.0 130-131 4.5375 0.0 0.0 0.0 0.0 132-133 5.0875 0.0 0.0 0.0 0.0 134-135 5.575 0.0 0.0 0.0 0.0 136-137 5.9 0.0 0.0 0.0 0.0 138-139 6.55 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAATCCT 10 0.0068343505 144.975 7 >>END_MODULE Read 589732 spots for SRR7180089.sra Written 589732 spots for SRR7180089.sra Read 589732 spots for SRR7180089.sra Written 589732 spots for SRR7180089.sra Read 589732 spots for SRR7180089.sra Written 589732 spots for SRR7180089.sra Read 589732 spots for SRR7180089.sra Written 589732 spots for SRR7180089.sra Read 589732 spots for SRR7180089.sra Written 589732 spots for SRR7180089.sra Read 589732 spots for SRR7180089.sra Written 589732 spots for SRR7180089.sra Read 589732 spots for SRR7180089.sra Written 589732 spots for SRR7180089.sra Read 589732 spots for SRR7180089.sra Written 589732 spots for SRR7180089.sra Read 589732 spots for SRR7180089.sra Written 589732 spots for SRR7180089.sra Read 589732 spots for SRR7180089.sra Written 589732 spots for SRR7180089.sra Read 589732 spots for SRR7180089.sra Written 589732 spots for SRR7180089.sra Read 589732 spots for SRR7180089.sra Written 589732 spots for SRR7180089.sra Read 589732 spots for SRR7180089.sra Written 589732 spots for SRR7180089.sra Read 589732 spots for SRR7180089.sra Written 589732 spots for SRR7180089.sra Read 589732 spots for SRR7180089.sra Written 589732 spots for SRR7180089.sra Read 589732 spots for SRR7180089.sra Written 589732 spots for SRR7180089.sra Read 589732 spots for SRR7180089.sra Written 589732 spots for SRR7180089.sra Read 589732 spots for SRR7180089.sra Written 589732 spots for SRR7180089.sra Read 589732 spots for SRR7180089.sra Written 589732 spots for SRR7180089.sra Read 589740 spots for SRR7180089.sra Written 589740 spots for SRR7180089.sra SRR ids: ['SRR7180089.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_sg02217n SRR7180089.sra spots: 11794648 blocks: [[1, 589732], [589733, 1179464], [1179465, 1769196], [1769197, 2358928], [2358929, 2948660], [2948661, 3538392], [3538393, 4128124], [4128125, 4717856], [4717857, 5307588], [5307589, 5897320], [5897321, 6487052], [6487053, 7076784], [7076785, 7666516], [7666517, 8256248], [8256249, 8845980], [8845981, 9435712], [9435713, 10025444], [10025445, 10615176], [10615177, 11204908], [11204909, 11794648]] SRR7180089 file size 3975118 SRR7180089 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7180089 SRR7180089_1.fastq SRR7180089_2.fastq Input file: SRR7180089_1.fastq Paired file: SRR7180089_2.fastq trimmed: SRR7180089-trimmed-pair1.fastq, SRR7180089-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 18:15:30 2025 >> started Mon Feb 10 18:15:42 2025 >> done (12.374s) 11794648 read pairs processed; of these: 53283 ( 0.45%) short read pairs filtered out after trimming by size control 37296 ( 0.32%) empty read pairs filtered out after trimming by size control 11704069 (99.23%) read pairs available; of these: 4557633 (38.94%) trimmed read pairs available after processing 7146436 (61.06%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 3 0.00% 20 6 0.00% 21 5 0.00% 22 16 0.00% 23 11 0.00% 24 14 0.00% 25 16 0.00% 26 19 0.00% 27 15 0.00% 28 17 0.00% 29 23 0.00% 30 18 0.00% 31 15 0.00% 32 18 0.00% 33 17 0.00% 34 15 0.00% 35 13 0.00% 36 17 0.00% 37 11 0.00% 38 22 0.00% 39 46 0.00% 40 16 0.00% 41 11 0.00% 42 22 0.00% 43 25 0.00% 44 21 0.00% 45 34 0.00% 46 30 0.00% 47 28 0.00% 48 37 0.00% 49 34 0.00% 50 31 0.00% 51 49 0.00% 52 57 0.00% 53 57 0.00% 54 68 0.00% 55 113 0.00% 56 131 0.00% 57 95 0.00% 58 87 0.00% 59 86 0.00% 60 108 0.00% 61 124 0.00% 62 144 0.00% 63 154 0.00% 64 150 0.00% 65 154 0.00% 66 184 0.00% 67 210 0.00% 68 220 0.00% 69 250 0.00% 70 331 0.00% 71 321 0.00% 72 391 0.00% 73 422 0.00% 74 483 0.00% 75 524 0.00% 76 645 0.01% 77 797 0.01% 78 859 0.01% 79 936 0.01% 80 1055 0.01% 81 1221 0.01% 82 1381 0.01% 83 1618 0.01% 84 3891 0.03% 85 5419 0.05% 86 5809 0.05% 87 6641 0.06% 88 6829 0.06% 89 6887 0.06% 90 6996 0.06% 91 7090 0.06% 92 7538 0.06% 93 7543 0.06% 94 7615 0.07% 95 7897 0.07% 96 8154 0.07% 97 8583 0.07% 98 9089 0.08% 99 9663 0.08% 100 10219 0.09% 101 10637 0.09% 102 11610 0.10% 103 12202 0.10% 104 12986 0.11% 105 13891 0.12% 106 14680 0.13% 107 15210 0.13% 108 16001 0.14% 109 16975 0.15% 110 18079 0.15% 111 19206 0.16% 112 20332 0.17% 113 21388 0.18% 114 22490 0.19% 115 23649 0.20% 116 24809 0.21% 117 25650 0.22% 118 26401 0.23% 119 27244 0.23% 120 29095 0.25% 121 30744 0.26% 122 30606 0.26% 123 32062 0.27% 124 33879 0.29% 125 34518 0.29% 126 36474 0.31% 127 36862 0.31% 128 37655 0.32% 129 38877 0.33% 130 40279 0.34% 131 41873 0.36% 132 43863 0.37% 133 46051 0.39% 134 48236 0.41% 135 49760 0.43% 136 52124 0.45% 137 53018 0.45% 138 54967 0.47% 139 57435 0.49% 140 59871 0.51% 141 62341 0.53% 142 67117 0.57% 143 73016 0.62% 144 81201 0.69% 145 89798 0.77% 146 102222 0.87% 147 126617 1.08% 148 177885 1.52% 149 333227 2.85% 150 2062602 17.62% 151 7146436 61.06% 11704069 reads passed initial QC criterion=sequence-density sequence-density=0.42 sequence-density-rank=1 fanout-score=3.69 fanout-score-rank=11 prefix-density=0.47 prefix-fanout=3.3 sequence=CCACATTTGCAGCCA criterion=fanout-score sequence-density=0.15 sequence-density-rank=18 fanout-score=26.08 fanout-score-rank=1 prefix-density=0.42 prefix-fanout=9.4 sequence=ACACCAGCAATGATTGT criterion=sequence-density sequence-density=0.50 sequence-density-rank=1 fanout-score=4.74 fanout-score-rank=12 prefix-density=0.69 prefix-fanout=3.4 sequence=TGCAAGTGCGGCAGTG criterion=fanout-score sequence-density=0.01 sequence-density-rank=26 fanout-score=77.10 fanout-score-rank=1 prefix-density=0.28 prefix-fanout=3.0 sequence=TCTTTGAGAGTGCATAGATTTGTGTTGATATAGAAAACAATGGCACTACATGGAAAGATTGAGACAACATTAGAACTCAAGTCCTCCGCAGAGAAGTTCTACAAAGTGTGGAGGAGCCAGTCCTTCCATGTTCCCAAACATGCTTCCAAGCATATCCAAGGAGTTGATATACATGCAGGTGACTGGGAGACTGCGGGCTCTATCAGGATTTGGCAGTACACAATCGGAGGGAAAGCCGGGGTCTTTAAAGAGGAGGTTTCC SRR7180089 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 18:16:29 Started mapping on | Feb 10 18:16:29 Finished on | Feb 10 18:18:31 Mapping speed, Million of reads per hour | 345.37 Number of input reads | 11704069 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 10740631 Uniquely mapped reads % | 91.77% Average mapped length | 293.37 Number of splices: Total | 9731352 Number of splices: Annotated (sjdb) | 9537932 Number of splices: GT/AG | 9576406 Number of splices: GC/AG | 118134 Number of splices: AT/AC | 8272 Number of splices: Non-canonical | 28540 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.71 Insertion rate per base | 0.02% Insertion average length | 2.52 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 284712 % of reads mapped to multiple loci | 2.43% Number of reads mapped to too many loci | 28041 % of reads mapped to too many loci | 0.24% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.51% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 725506 725506 725506 N_multimapping 284712 284712 284712 N_noFeature 284027 10612481 343497 N_ambiguous 121039 837 51943 UnstrandedReadsAssigned:10335565 PositiveStrandReadsAssigned:127313 NegativeStrandReadsAssigned:10345191 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7180089 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7180089-trimmed-pair1.fastq SRR7180089-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,704,069 reads, 10,306,135 reads pseudoaligned [quant] estimated average fragment length: 222.123 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,051 rounds 52401 SRR7180089.ke.tsv 34699 SRR7180089.se.tsv 87100 total ==> SRR7180089.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1796.88 743 32.4787 Potri.005G024800.1.v4.1 1035 813.877 134 12.9322 Potri.004G059700.1.v4.1 961 739.882 64 6.79431 Potri.007G009000.2.v4.1 1416 1194.88 0 0 Potri.003G141000.2.v4.1 2943 2721.88 351 10.129 Potri.016G087400.1.v4.1 270 83.9536 1136.57 1063.37 Potri.015G069301.1.v4.1 564 344.764 0 0 Potri.010G195200.1.v4.1 1773 1551.88 223 11.2869 Potri.012G127500.1.v4.1 977 755.877 6161 640.218 ==> SRR7180089.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 40 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 485 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 337 SRR7180089 completed mapping pipeline successfully