Starting /dee2/code/volunteer_pipeline.sh SRR7180090 current disk space = 3057401528320 free memory = 1137324064 SRR7180090 SRAfilesize 11e3842fa9bde359d393f5a126f1fa5d SRR7180090.sra SRR7180090.sra file validated SRR7180090 is paired end SRR7180090 is conventional basespace SRR7180090 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7180090_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.93725 33.0 33.0 34.0 30.0 34.0 2 32.915 34.0 33.0 34.0 32.0 34.0 3 32.31975 33.0 33.0 34.0 30.0 34.0 4 32.48075 33.0 33.0 33.0 31.0 34.0 5 33.035 33.0 33.0 34.0 33.0 34.0 6 36.9845 38.0 37.0 38.0 35.0 38.0 7 37.35925 38.0 38.0 38.0 36.0 38.0 8 37.40925 38.0 38.0 38.0 37.0 38.0 9 37.6645 38.0 38.0 38.0 38.0 38.0 10-14 37.682 38.0 38.0 38.0 38.0 38.0 15-19 37.683749999999996 38.0 38.0 38.0 38.0 38.0 20-24 37.668099999999995 38.0 38.0 38.0 38.0 38.0 25-29 37.669200000000004 38.0 38.0 38.0 38.0 38.0 30-34 37.63445 38.0 38.0 38.0 38.0 38.0 35-39 37.637100000000004 38.0 38.0 38.0 38.0 38.0 40-44 37.6029 38.0 38.0 38.0 38.0 38.0 45-49 37.575849999999996 38.0 38.0 38.0 38.0 38.0 50-54 37.55929999999999 38.0 38.0 38.0 38.0 38.0 55-59 37.5318 38.0 38.0 38.0 38.0 38.0 60-64 37.4879 38.0 38.0 38.0 37.6 38.0 65-69 37.44165 38.0 38.0 38.0 37.0 38.0 70-74 37.4057 38.0 38.0 38.0 37.0 38.0 75-79 37.3646 38.0 38.0 38.0 37.0 38.0 80-84 37.302949999999996 38.0 38.0 38.0 37.0 38.0 85-89 37.3153 38.0 38.0 38.0 36.8 38.0 90-94 37.19145 38.0 38.0 38.0 36.6 38.0 95-99 37.10245 38.0 38.0 38.0 36.2 38.0 100-104 37.01215 38.0 38.0 38.0 36.0 38.0 105-109 36.8882 38.0 38.0 38.0 35.6 38.0 110-114 36.824749999999995 38.0 38.0 38.0 35.2 38.0 115-119 36.636649999999996 38.0 38.0 38.0 34.6 38.0 120-124 36.571600000000004 38.0 38.0 38.0 34.2 38.0 125-129 36.412800000000004 38.0 38.0 38.0 34.0 38.0 130-134 36.2346 38.0 37.8 38.0 34.0 38.0 135-139 36.097899999999996 38.0 37.8 38.0 33.4 38.0 140-144 35.887 38.0 37.0 38.0 33.0 38.0 145-149 35.4507 38.0 36.4 38.0 31.8 38.0 150-151 32.70675 37.0 33.5 38.0 16.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 0.0 10 0.0 11 1.0 12 0.0 13 0.0 14 0.0 15 2.0 16 1.0 17 0.0 18 0.0 19 2.0 20 1.0 21 1.0 22 3.0 23 3.0 24 8.0 25 6.0 26 6.0 27 16.0 28 7.0 29 17.0 30 23.0 31 29.0 32 55.0 33 55.0 34 94.0 35 154.0 36 472.0 37 3043.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 31.210021321961623 14.55223880597015 15.458422174840086 38.779317697228144 2 20.125 20.45 39.975 19.45 3 18.3 26.575 27.224999999999998 27.900000000000002 4 20.825 34.4 22.55 22.225 5 20.724999999999998 37.025000000000006 23.674999999999997 18.575 6 15.825 37.375 26.6 20.200000000000003 7 12.775 21.7 45.9 19.625 8 18.2 22.7 29.425 29.675 9 17.224999999999998 23.75 33.324999999999996 25.7 10-14 19.72 28.915000000000003 26.919999999999998 24.445 15-19 19.814999999999998 28.549999999999997 28.050000000000004 23.585 20-24 19.165 29.01 27.67 24.154999999999998 25-29 19.585 29.09 27.71 23.615 30-34 19.105 29.285 28.265 23.345 35-39 19.689999999999998 27.99 28.37 23.95 40-44 19.67 28.465 28.23 23.635 45-49 19.295 28.360000000000003 28.560000000000002 23.785 50-54 19.675 28.4 28.28 23.645 55-59 19.79 29.044999999999998 27.779999999999998 23.385 60-64 19.835 28.599999999999998 27.925 23.64 65-69 19.509999999999998 28.625 28.255000000000003 23.61 70-74 20.36 28.615000000000002 28.18 22.845 75-79 19.615 28.634999999999998 28.125 23.625 80-84 20.04 28.265 27.800000000000004 23.895 85-89 19.665 28.955 27.805000000000003 23.575 90-94 20.14 28.28 27.93 23.65 95-99 19.195 28.365000000000002 28.325 24.115000000000002 100-104 20.335 28.525 27.66 23.48 105-109 20.595 27.985 27.800000000000004 23.62 110-114 20.615 27.61 28.32 23.455000000000002 115-119 20.46 28.08 27.235 24.224999999999998 120-124 19.86 28.26 28.08 23.799999999999997 125-129 20.419999999999998 27.855 27.725 24.0 130-134 20.485 28.52 26.955000000000002 24.04 135-139 19.744999999999997 28.34 27.55 24.365000000000002 140-144 20.455000000000002 28.82 27.015 23.71 145-149 20.349999999999998 28.12 27.43 24.099999999999998 150-151 20.3 27.8375 26.9125 24.95 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 1.0 16 0.5 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 1.0 23 1.0 24 1.0 25 1.5 26 3.0 27 5.5 28 10.0 29 16.5 30 18.0 31 25.5 32 45.0 33 47.5 34 55.0 35 75.5 36 98.5 37 133.5 38 160.0 39 184.5 40 213.0 41 241.5 42 267.0 43 279.0 44 290.0 45 298.5 46 277.0 47 234.0 48 201.5 49 164.0 50 134.5 51 120.5 52 97.5 53 74.5 54 53.5 55 41.0 56 36.5 57 26.5 58 14.0 59 12.0 60 12.0 61 8.0 62 5.0 63 4.5 64 3.5 65 2.0 66 1.0 67 1.0 68 0.5 69 0.0 70 0.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 6.2 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.275 #Duplication Level Percentage of deduplicated Percentage of total 1 99.26970536388819 98.55000000000001 2 0.7302946361118107 1.4500000000000002 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.0625 0.0 0.0 0.0 0.0 84-85 0.1125 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.1375 0.0 0.0 0.0 0.0 90-91 0.21250000000000002 0.0 0.0 0.0 0.0 92-93 0.225 0.0 0.0 0.0 0.0 94-95 0.275 0.0 0.0 0.0 0.0 96-97 0.3375 0.0 0.0 0.0 0.0 98-99 0.4375 0.0 0.0 0.0 0.0 100-101 0.575 0.0 0.0 0.0 0.0 102-103 0.7 0.0 0.0 0.0 0.0 104-105 0.85 0.0 0.0 0.0 0.0 106-107 1.0375 0.0 0.0 0.0 0.0 108-109 1.2 0.0 0.0 0.0 0.0 110-111 1.4375 0.0 0.0 0.0 0.0 112-113 1.5750000000000002 0.0 0.0 0.0 0.0 114-115 1.8 0.0 0.0 0.0 0.0 116-117 2.0125 0.0 0.0 0.0 0.0 118-119 2.1875 0.0 0.0 0.0 0.0 120-121 2.3499999999999996 0.0 0.0 0.0 0.0 122-123 2.625 0.0 0.0 0.0 0.0 124-125 2.9000000000000004 0.0 0.0 0.0 0.0 126-127 3.1125 0.0 0.0 0.0 0.0 128-129 3.6375 0.0 0.0 0.0 0.0 130-131 3.875 0.0 0.0 0.0 0.0 132-133 4.237500000000001 0.0 0.0 0.0 0.0 134-135 4.6375 0.0 0.0 0.0 0.0 136-137 5.0125 0.0 0.0 0.0 0.0 138-139 5.3875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAACGAA 10 0.005853838 152.57895 1 CTTTTTT 10 0.005853838 152.57895 1 TTTTTCA 10 0.0068378756 144.95 2 GACAACA 10 0.0068378756 144.95 2 >>END_MODULE SRR7180090 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7180090_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.16225 33.0 33.0 34.0 33.0 34.0 2 33.176 34.0 33.0 34.0 33.0 34.0 3 33.32275 34.0 33.0 34.0 33.0 34.0 4 33.31675 34.0 33.0 34.0 33.0 34.0 5 33.30875 34.0 33.0 34.0 33.0 34.0 6 37.46875 38.0 38.0 38.0 38.0 38.0 7 37.5225 38.0 38.0 38.0 38.0 38.0 8 37.46525 38.0 38.0 38.0 38.0 38.0 9 37.461 38.0 38.0 38.0 38.0 38.0 10-14 37.44525 38.0 38.0 38.0 38.0 38.0 15-19 37.44515 38.0 38.0 38.0 37.8 38.0 20-24 37.47455 38.0 38.0 38.0 37.8 38.0 25-29 37.4912 38.0 38.0 38.0 38.0 38.0 30-34 37.4396 38.0 38.0 38.0 37.4 38.0 35-39 37.41324999999999 38.0 38.0 38.0 37.6 38.0 40-44 37.37094999999999 38.0 38.0 38.0 37.0 38.0 45-49 37.37325 38.0 38.0 38.0 37.0 38.0 50-54 37.351200000000006 38.0 38.0 38.0 37.0 38.0 55-59 37.29175 38.0 38.0 38.0 37.0 38.0 60-64 37.1985 38.0 38.0 38.0 37.0 38.0 65-69 37.1444 38.0 38.0 38.0 36.2 38.0 70-74 37.10719999999999 38.0 38.0 38.0 36.2 38.0 75-79 37.06060000000001 38.0 38.0 38.0 36.0 38.0 80-84 37.033550000000005 38.0 38.0 38.0 36.0 38.0 85-89 36.88035 38.0 38.0 38.0 36.0 38.0 90-94 36.79795 38.0 38.0 38.0 35.6 38.0 95-99 36.73515 38.0 38.0 38.0 35.0 38.0 100-104 36.63275 38.0 38.0 38.0 34.4 38.0 105-109 36.3722 38.0 38.0 38.0 34.0 38.0 110-114 36.30794999999999 38.0 38.0 38.0 33.8 38.0 115-119 36.20615 38.0 37.6 38.0 33.8 38.0 120-124 35.970549999999996 38.0 37.0 38.0 33.0 38.0 125-129 35.7082 38.0 36.6 38.0 32.0 38.0 130-134 35.4782 38.0 36.0 38.0 31.0 38.0 135-139 35.2245 38.0 36.0 38.0 30.6 38.0 140-144 34.89925 38.0 35.8 38.0 29.2 38.0 145-149 34.26115 38.0 35.0 38.0 26.2 38.0 150-151 30.0535 35.5 28.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 0.0 4 0.0 5 1.0 6 1.0 7 0.0 8 0.0 9 0.0 10 0.0 11 1.0 12 2.0 13 1.0 14 0.0 15 1.0 16 3.0 17 1.0 18 0.0 19 6.0 20 4.0 21 6.0 22 3.0 23 5.0 24 12.0 25 12.0 26 12.0 27 16.0 28 23.0 29 24.0 30 33.0 31 42.0 32 49.0 33 90.0 34 116.0 35 237.0 36 589.0 37 2708.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.875 14.575 19.8 31.75 2 24.55 20.549999999999997 37.625 17.275 3 20.625 24.45 32.425 22.5 4 24.349999999999998 33.4 22.45 19.8 5 23.974999999999998 37.075 22.725 16.225 6 19.15 36.7 24.55 19.6 7 19.35 17.7 43.375 19.575 8 20.175 22.8 28.849999999999998 28.175 9 22.1 24.3 28.95 24.65 10-14 23.535 28.915000000000003 26.05 21.5 15-19 23.044999999999998 27.655 28.24 21.060000000000002 20-24 23.405 28.050000000000004 27.705000000000002 20.84 25-29 23.580000000000002 28.549999999999997 27.345000000000002 20.525 30-34 22.8 28.365000000000002 28.16 20.674999999999997 35-39 23.015 28.050000000000004 28.384999999999998 20.549999999999997 40-44 23.305 28.23 27.88 20.585 45-49 23.195 28.965000000000003 27.455000000000002 20.385 50-54 23.369999999999997 28.705000000000002 27.405 20.52 55-59 23.799999999999997 28.655 27.71 19.835 60-64 23.825 28.21 27.755000000000003 20.21 65-69 23.095 28.904999999999998 27.765 20.235 70-74 23.965 28.305000000000003 27.54 20.19 75-79 23.685000000000002 28.249999999999996 27.195000000000004 20.87 80-84 23.39 28.000000000000004 27.675 20.935000000000002 85-89 23.56 27.939999999999998 28.23 20.27 90-94 23.84 28.32 27.47 20.369999999999997 95-99 23.145 28.645 27.884999999999998 20.325 100-104 23.84 27.625 28.555000000000003 19.98 105-109 24.240000000000002 28.449999999999996 27.715 19.595000000000002 110-114 24.2 28.08 27.639999999999997 20.080000000000002 115-119 23.549999999999997 28.139999999999997 28.29 20.02 120-124 24.22 28.050000000000004 27.92 19.81 125-129 23.97 28.625 27.48 19.925 130-134 25.009999999999998 28.044999999999998 27.855 19.09 135-139 24.44 29.025000000000002 27.095000000000002 19.439999999999998 140-144 25.180000000000003 27.925 27.384999999999998 19.509999999999998 145-149 24.935 28.610000000000003 27.21 19.245 150-151 25.934725522070778 27.98549456046017 27.047642866074778 19.032137051394272 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 1.0 23 1.5 24 0.5 25 1.0 26 1.0 27 2.5 28 7.0 29 7.0 30 8.0 31 15.5 32 21.5 33 28.5 34 44.0 35 63.5 36 87.0 37 115.0 38 145.5 39 187.0 40 211.5 41 227.5 42 258.0 43 285.5 44 292.5 45 291.0 46 285.5 47 259.0 48 225.5 49 195.0 50 159.5 51 124.5 52 104.5 53 85.0 54 66.5 55 51.0 56 36.0 57 27.5 58 18.5 59 14.5 60 15.0 61 9.5 62 6.5 63 4.0 64 1.5 65 2.0 66 3.0 67 2.5 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0375 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.175 #Duplication Level Percentage of deduplicated Percentage of total 1 99.1681371313335 98.35000000000001 2 0.8318628686664987 1.6500000000000001 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.0625 0.0 0.0 0.0 0.0 84-85 0.1125 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.1375 0.0 0.0 0.0 0.0 90-91 0.21250000000000002 0.0 0.0 0.0 0.0 92-93 0.225 0.0 0.0 0.0 0.0 94-95 0.275 0.0 0.0 0.0 0.0 96-97 0.3375 0.0 0.0 0.0 0.0 98-99 0.4375 0.0 0.0 0.0 0.0 100-101 0.575 0.0 0.0 0.0 0.0 102-103 0.7 0.0 0.0 0.0 0.0 104-105 0.85 0.0 0.0 0.0 0.0 106-107 1.0375 0.0 0.0 0.0 0.0 108-109 1.2 0.0 0.0 0.0 0.0 110-111 1.4375 0.0 0.0 0.0 0.0 112-113 1.5750000000000002 0.0 0.0 0.0 0.0 114-115 1.8 0.0 0.0 0.0 0.0 116-117 2.0125 0.0 0.0 0.0 0.0 118-119 2.1875 0.0 0.0 0.0 0.0 120-121 2.3499999999999996 0.0 0.0 0.0 0.0 122-123 2.625 0.0 0.0 0.0 0.0 124-125 2.9000000000000004 0.0 0.0 0.0 0.0 126-127 3.1125 0.0 0.0 0.0 0.0 128-129 3.6375 0.0 0.0 0.0 0.0 130-131 3.875 0.0 0.0 0.0 0.0 132-133 4.237500000000001 0.0 0.0 0.0 0.0 134-135 4.65 0.0 0.0 0.0 0.0 136-137 5.025 0.0 0.0 0.0 0.0 138-139 5.3875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTGTTAT 10 0.006830828 145.0 6 ATCTTTC 10 0.006830828 145.0 5 CACAAGT 10 0.006830828 145.0 1 GTGGAGA 10 0.006830828 145.0 1 >>END_MODULE Read 860252 spots for SRR7180090.sra Written 860252 spots for SRR7180090.sra Read 860252 spots for SRR7180090.sra Written 860252 spots for SRR7180090.sra Read 860252 spots for SRR7180090.sra Written 860252 spots for SRR7180090.sra Read 860252 spots for SRR7180090.sra Written 860252 spots for SRR7180090.sra Read 860252 spots for SRR7180090.sra Written 860252 spots for SRR7180090.sra Read 860252 spots for SRR7180090.sra Written 860252 spots for SRR7180090.sra Read 860252 spots for SRR7180090.sra Written 860252 spots for SRR7180090.sra Read 860252 spots for SRR7180090.sra Written 860252 spots for SRR7180090.sra Read 860252 spots for SRR7180090.sra Written 860252 spots for SRR7180090.sra Read 860252 spots for SRR7180090.sra Written 860252 spots for SRR7180090.sra Read 860252 spots for SRR7180090.sra Written 860252 spots for SRR7180090.sra Read 860252 spots for SRR7180090.sra Written 860252 spots for SRR7180090.sra Read 860252 spots for SRR7180090.sra Written 860252 spots for SRR7180090.sra Read 860252 spots for SRR7180090.sra Written 860252 spots for SRR7180090.sra Read 860252 spots for SRR7180090.sra Written 860252 spots for SRR7180090.sra Read 860252 spots for SRR7180090.sra Written 860252 spots for SRR7180090.sra Read 860262 spots for SRR7180090.sra Written 860262 spots for SRR7180090.sra Read 860252 spots for SRR7180090.sra Written 860252 spots for SRR7180090.sra Read 860252 spots for SRR7180090.sra Written 860252 spots for SRR7180090.sra Read 860252 spots for SRR7180090.sra Written 860252 spots for SRR7180090.sra SRR ids: ['SRR7180090.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_rig5r21t SRR7180090.sra spots: 17205050 blocks: [[1, 860252], [860253, 1720504], [1720505, 2580756], [2580757, 3441008], [3441009, 4301260], [4301261, 5161512], [5161513, 6021764], [6021765, 6882016], [6882017, 7742268], [7742269, 8602520], [8602521, 9462772], [9462773, 10323024], [10323025, 11183276], [11183277, 12043528], [12043529, 12903780], [12903781, 13764032], [13764033, 14624284], [14624285, 15484536], [15484537, 16344788], [16344789, 17205050]] SRR7180090 file size 5808526 SRR7180090 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7180090 SRR7180090_1.fastq SRR7180090_2.fastq Input file: SRR7180090_1.fastq Paired file: SRR7180090_2.fastq trimmed: SRR7180090-trimmed-pair1.fastq, SRR7180090-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 18:40:24 2025 >> started Mon Feb 10 18:40:42 2025 >> done (17.916s) 17205050 read pairs processed; of these: 8751 ( 0.05%) short read pairs filtered out after trimming by size control 7165 ( 0.04%) empty read pairs filtered out after trimming by size control 17189134 (99.91%) read pairs available; of these: 6160382 (35.84%) trimmed read pairs available after processing 11028752 (64.16%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 20 5 0.00% 21 0 0.00% 22 3 0.00% 23 2 0.00% 24 1 0.00% 25 1 0.00% 26 4 0.00% 27 1 0.00% 28 4 0.00% 29 3 0.00% 30 3 0.00% 31 2 0.00% 32 2 0.00% 33 6 0.00% 34 2 0.00% 35 4 0.00% 36 4 0.00% 37 4 0.00% 38 6 0.00% 39 5 0.00% 40 8 0.00% 41 8 0.00% 42 6 0.00% 43 7 0.00% 44 5 0.00% 45 8 0.00% 46 17 0.00% 47 29 0.00% 48 20 0.00% 49 24 0.00% 50 26 0.00% 51 23 0.00% 52 57 0.00% 53 67 0.00% 54 67 0.00% 55 43 0.00% 56 45 0.00% 57 67 0.00% 58 65 0.00% 59 92 0.00% 60 79 0.00% 61 121 0.00% 62 128 0.00% 63 172 0.00% 64 148 0.00% 65 179 0.00% 66 202 0.00% 67 224 0.00% 68 269 0.00% 69 281 0.00% 70 372 0.00% 71 405 0.00% 72 485 0.00% 73 573 0.00% 74 605 0.00% 75 763 0.00% 76 885 0.01% 77 967 0.01% 78 1154 0.01% 79 1216 0.01% 80 1446 0.01% 81 1565 0.01% 82 1803 0.01% 83 2093 0.01% 84 2740 0.02% 85 3342 0.02% 86 3624 0.02% 87 4060 0.02% 88 4434 0.03% 89 4718 0.03% 90 5175 0.03% 91 5473 0.03% 92 5994 0.03% 93 6360 0.04% 94 6852 0.04% 95 7355 0.04% 96 8051 0.05% 97 8729 0.05% 98 9288 0.05% 99 9641 0.06% 100 10216 0.06% 101 10962 0.06% 102 11569 0.07% 103 12517 0.07% 104 13293 0.08% 105 14117 0.08% 106 14919 0.09% 107 16253 0.09% 108 16976 0.10% 109 17780 0.10% 110 18875 0.11% 111 19784 0.12% 112 20758 0.12% 113 21570 0.13% 114 22630 0.13% 115 23832 0.14% 116 25157 0.15% 117 26339 0.15% 118 27791 0.16% 119 29414 0.17% 120 30599 0.18% 121 32065 0.19% 122 32436 0.19% 123 33427 0.19% 124 34603 0.20% 125 36200 0.21% 126 37476 0.22% 127 39636 0.23% 128 40829 0.24% 129 42536 0.25% 130 44471 0.26% 131 45848 0.27% 132 47864 0.28% 133 50247 0.29% 134 51809 0.30% 135 54545 0.32% 136 56956 0.33% 137 60082 0.35% 138 63216 0.37% 139 67166 0.39% 140 70851 0.41% 141 76442 0.44% 142 82188 0.48% 143 89546 0.52% 144 99727 0.58% 145 114083 0.66% 146 135358 0.79% 147 173772 1.01% 148 255995 1.49% 149 504624 2.94% 150 3168316 18.43% 151 11028752 64.16% 17189134 reads passed initial QC criterion=sequence-density sequence-density=0.46 sequence-density-rank=1 fanout-score=2.93 fanout-score-rank=33 prefix-density=0.61 prefix-fanout=2.2 sequence=CATCTCAGACCTCTCATAGAACATCTTAACTGGTGCAACACCTGCAATGATTGTCTCAGTTGTGGTGTTCTCTGAGAAACCTAAGTCAGGGTACATGCCACATTTGCA criterion=fanout-score sequence-density=0.06 sequence-density-rank=30 fanout-score=38.27 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=10.4 sequence=ATCAACCTCTGCTGGTCTGG criterion=sequence-density sequence-density=0.78 sequence-density-rank=1 fanout-score=2.42 fanout-score-rank=30 prefix-density=0.79 prefix-fanout=2.4 sequence=ATGTACCCTGACTTAGGTTTCTCAGAGA criterion=fanout-score sequence-density=0.03 sequence-density-rank=31 fanout-score=68.14 fanout-score-rank=1 prefix-density=0.18 prefix-fanout=12.4 sequence=TCTTCCTCTCTATAATTTTCTAGGGTTTAGCAATGTCTGCCGAGGTTGAGTACAGGTGCTTTGTTGG SRR7180090 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 18:41:26 Started mapping on | Feb 10 18:41:26 Finished on | Feb 10 18:43:38 Mapping speed, Million of reads per hour | 468.79 Number of input reads | 17189134 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 16173301 Uniquely mapped reads % | 94.09% Average mapped length | 295.55 Number of splices: Total | 15843230 Number of splices: Annotated (sjdb) | 15470161 Number of splices: GT/AG | 15581522 Number of splices: GC/AG | 201501 Number of splices: AT/AC | 12820 Number of splices: Non-canonical | 47387 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.04% Deletion average length | 2.58 Insertion rate per base | 0.02% Insertion average length | 2.63 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 380628 % of reads mapped to multiple loci | 2.21% Number of reads mapped to too many loci | 52472 % of reads mapped to too many loci | 0.31% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.33% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 644254 644254 644254 N_multimapping 380628 380628 380628 N_noFeature 534901 16020698 595603 N_ambiguous 179796 792 87601 UnstrandedReadsAssigned:15458604 PositiveStrandReadsAssigned:151811 NegativeStrandReadsAssigned:15490097 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7180090 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7180090-trimmed-pair1.fastq SRR7180090-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,189,134 reads, 15,322,821 reads pseudoaligned [quant] estimated average fragment length: 235.791 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,113 rounds 52401 SRR7180090.ke.tsv 34699 SRR7180090.se.tsv 87100 total ==> SRR7180090.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1783.21 1979 66.5979 Potri.005G024800.1.v4.1 1035 800.209 1139 85.4156 Potri.004G059700.1.v4.1 961 726.241 20 1.65259 Potri.007G009000.2.v4.1 1416 1181.21 0 0 Potri.003G141000.2.v4.1 2943 2708.21 1142 25.3047 Potri.016G087400.1.v4.1 270 79.8524 1540 1157.31 Potri.015G069301.1.v4.1 564 332.239 0 0 Potri.010G195200.1.v4.1 1773 1538.21 389 15.1758 Potri.012G127500.1.v4.1 977 742.225 2028 163.964 ==> SRR7180090.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 28 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 521 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 323 SRR7180090 completed mapping pipeline successfully