Starting /dee2/code/volunteer_pipeline.sh SRR7180091 current disk space = 3057670328320 free memory = 976231948 SRR7180091 SRAfilesize 0c2c88bf8f73936a663478aa9a829bf0 SRR7180091.sra SRR7180091.sra file validated SRR7180091 is paired end SRR7180091 is conventional basespace SRR7180091 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7180091_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 19.64225 18.0 18.0 18.0 18.0 32.0 2 21.5165 18.0 18.0 25.0 18.0 32.0 3 28.03825 27.0 27.0 32.0 25.0 32.0 4 29.90975 32.0 27.0 32.0 25.0 33.0 5 32.03425 33.0 32.0 33.0 32.0 33.0 6 35.8835 37.0 35.0 38.0 33.0 38.0 7 36.627 38.0 37.0 38.0 34.0 38.0 8 36.888 38.0 37.0 38.0 34.0 38.0 9 37.27775 38.0 38.0 38.0 36.0 38.0 10-14 37.577549999999995 38.0 38.0 38.0 37.4 38.0 15-19 37.6303 38.0 38.0 38.0 38.0 38.0 20-24 37.675250000000005 38.0 38.0 38.0 38.0 38.0 25-29 37.63935 38.0 38.0 38.0 38.0 38.0 30-34 37.63505 38.0 38.0 38.0 38.0 38.0 35-39 37.6073 38.0 38.0 38.0 38.0 38.0 40-44 37.59740000000001 38.0 38.0 38.0 38.0 38.0 45-49 37.557 38.0 38.0 38.0 38.0 38.0 50-54 37.5546 38.0 38.0 38.0 38.0 38.0 55-59 37.4973 38.0 38.0 38.0 37.6 38.0 60-64 37.460449999999994 38.0 38.0 38.0 37.0 38.0 65-69 37.4177 38.0 38.0 38.0 37.0 38.0 70-74 37.369200000000006 38.0 38.0 38.0 37.0 38.0 75-79 37.3303 38.0 38.0 38.0 37.0 38.0 80-84 37.254949999999994 38.0 38.0 38.0 36.8 38.0 85-89 37.26275 38.0 38.0 38.0 37.0 38.0 90-94 37.1971 38.0 38.0 38.0 36.2 38.0 95-99 37.15075 38.0 38.0 38.0 36.0 38.0 100-104 37.0166 38.0 38.0 38.0 36.0 38.0 105-109 36.88165 38.0 38.0 38.0 35.4 38.0 110-114 36.8275 38.0 38.0 38.0 35.2 38.0 115-119 36.59725 38.0 38.0 38.0 34.6 38.0 120-124 36.5724 38.0 38.0 38.0 34.2 38.0 125-129 36.4314 38.0 38.0 38.0 34.0 38.0 130-134 36.195949999999996 38.0 37.8 38.0 33.8 38.0 135-139 36.0199 38.0 37.2 38.0 33.2 38.0 140-144 35.754850000000005 38.0 36.6 38.0 33.0 38.0 145-149 35.3312 38.0 36.2 38.0 31.6 38.0 150-151 32.456 36.5 33.5 38.0 16.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 1.0 9 0.0 10 0.0 11 0.0 12 1.0 13 0.0 14 0.0 15 2.0 16 2.0 17 1.0 18 1.0 19 0.0 20 4.0 21 3.0 22 0.0 23 4.0 24 4.0 25 2.0 26 7.0 27 15.0 28 11.0 29 22.0 30 23.0 31 34.0 32 36.0 33 66.0 34 113.0 35 230.0 36 711.0 37 2706.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 13.39725317439751 36.3565690593418 11.920186576833377 38.32599118942731 2 20.599999999999998 22.55 28.775000000000002 28.075 3 19.775000000000002 27.3 24.474999999999998 28.449999999999996 4 21.8 30.75 23.35 24.099999999999998 5 21.275 34.525 24.05 20.150000000000002 6 18.35 35.099999999999994 25.324999999999996 21.224999999999998 7 14.799999999999999 23.45 41.575 20.175 8 18.275 24.0 29.5 28.225 9 17.549999999999997 24.5 32.675 25.275 10-14 19.45 29.86 26.424999999999997 24.265 15-19 19.505 28.310000000000002 28.355000000000004 23.830000000000002 20-24 19.045 29.555 27.310000000000002 24.09 25-29 19.77 28.22 28.465 23.544999999999998 30-34 19.25 28.455000000000002 28.555000000000003 23.74 35-39 18.93 28.410000000000004 28.749999999999996 23.91 40-44 18.970000000000002 28.355000000000004 28.884999999999998 23.79 45-49 19.220000000000002 28.439999999999998 28.605000000000004 23.735 50-54 19.31 28.49 28.110000000000003 24.09 55-59 18.85 28.185 28.4 24.565 60-64 19.67 28.09 28.29 23.95 65-69 20.18 28.4 27.169999999999998 24.25 70-74 20.169999999999998 28.09 27.98 23.76 75-79 20.18 27.750000000000004 28.044999999999998 24.025 80-84 19.545 28.29 27.950000000000003 24.215 85-89 19.8 27.565 28.34 24.295 90-94 19.785 28.175 28.134999999999998 23.905 95-99 20.14 27.855 28.685 23.32 100-104 20.195 28.37 28.26 23.175 105-109 20.474999999999998 28.449999999999996 27.305 23.77 110-114 20.175 27.935 28.415000000000003 23.474999999999998 115-119 20.46 27.67 27.685 24.185000000000002 120-124 20.02 28.455000000000002 27.474999999999998 24.05 125-129 19.74 29.060000000000002 27.275 23.925 130-134 20.7 28.27 27.150000000000002 23.880000000000003 135-139 20.51 27.76 27.67 24.060000000000002 140-144 20.65 27.425 27.38 24.545 145-149 20.435 27.775 27.305 24.485 150-151 21.425 28.3625 26.650000000000002 23.5625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 2.0 1 1.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 1.0 10 0.5 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.0 20 1.0 21 1.0 22 1.0 23 1.5 24 2.5 25 2.5 26 4.5 27 8.0 28 11.0 29 13.5 30 20.5 31 26.0 32 42.0 33 53.5 34 59.5 35 75.5 36 93.0 37 119.5 38 134.5 39 160.5 40 199.5 41 227.5 42 261.0 43 298.0 44 295.5 45 281.0 46 255.0 47 226.0 48 223.0 49 198.0 50 157.0 51 126.0 52 104.0 53 76.5 54 59.0 55 41.5 56 28.5 57 29.5 58 22.0 59 11.5 60 7.5 61 7.0 62 6.5 63 7.0 64 5.0 65 3.0 66 2.0 67 1.5 68 1.5 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.5249999999999995 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.425 #Duplication Level Percentage of deduplicated Percentage of total 1 99.42167462911743 98.85000000000001 2 0.5783253708825749 1.15 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.0625 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.16249999999999998 0.0 0.0 0.0 0.0 94-95 0.325 0.0 0.0 0.0 0.0 96-97 0.4125 0.0 0.0 0.0 0.0 98-99 0.475 0.0 0.0 0.0 0.0 100-101 0.5249999999999999 0.0 0.0 0.0 0.0 102-103 0.6125 0.0 0.0 0.0 0.0 104-105 0.7125 0.0 0.0 0.0 0.0 106-107 0.825 0.0 0.0 0.0 0.0 108-109 0.9375 0.0 0.0 0.0 0.0 110-111 1.1375 0.0 0.0 0.0 0.0 112-113 1.4 0.0 0.0 0.0 0.0 114-115 1.6625 0.0 0.0 0.0 0.0 116-117 1.875 0.0 0.0 0.0 0.0 118-119 2.0875 0.0 0.0 0.0 0.0 120-121 2.425 0.0 0.0 0.0 0.0 122-123 2.675 0.0 0.0 0.0 0.0 124-125 3.025 0.0 0.0 0.0 0.0 126-127 3.4375 0.0 0.0 0.0 0.0 128-129 3.7625 0.0 0.0 0.0 0.0 130-131 4.3125 0.0 0.0 0.0 0.0 132-133 4.75 0.0 0.0 0.0 0.0 134-135 5.15 0.0 0.0 0.0 0.0 136-137 5.5 0.0 0.0 0.0 0.0 138-139 5.862500000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7180091 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7180091_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.0765 33.0 33.0 34.0 32.0 34.0 2 32.9595 34.0 33.0 34.0 32.0 34.0 3 33.1035 34.0 33.0 34.0 33.0 34.0 4 33.048 34.0 33.0 34.0 33.0 34.0 5 33.0815 34.0 33.0 34.0 33.0 34.0 6 37.25 38.0 38.0 38.0 38.0 38.0 7 37.19775 38.0 38.0 38.0 37.0 38.0 8 37.24925 38.0 38.0 38.0 37.0 38.0 9 37.19 38.0 38.0 38.0 37.0 38.0 10-14 37.20435 38.0 38.0 38.0 37.0 38.0 15-19 37.1973 38.0 38.0 38.0 37.2 38.0 20-24 37.198049999999995 38.0 38.0 38.0 37.2 38.0 25-29 37.193999999999996 38.0 38.0 38.0 37.2 38.0 30-34 37.14675 38.0 38.0 38.0 37.0 38.0 35-39 37.093599999999995 38.0 38.0 38.0 37.0 38.0 40-44 37.0388 38.0 38.0 38.0 37.0 38.0 45-49 37.0141 38.0 38.0 38.0 37.0 38.0 50-54 37.03795 38.0 38.0 38.0 37.0 38.0 55-59 37.001549999999995 38.0 38.0 38.0 37.0 38.0 60-64 36.925349999999995 38.0 38.0 38.0 36.4 38.0 65-69 36.8281 38.0 38.0 38.0 36.0 38.0 70-74 36.799099999999996 38.0 38.0 38.0 36.0 38.0 75-79 36.774 38.0 38.0 38.0 36.0 38.0 80-84 36.70105 38.0 38.0 38.0 36.0 38.0 85-89 36.5794 38.0 38.0 38.0 35.6 38.0 90-94 36.5269 38.0 38.0 38.0 35.0 38.0 95-99 36.45545 38.0 38.0 38.0 34.8 38.0 100-104 36.31435 38.0 38.0 38.0 34.0 38.0 105-109 36.057 38.0 38.0 38.0 33.6 38.0 110-114 35.92525 38.0 38.0 38.0 33.0 38.0 115-119 35.912099999999995 38.0 38.0 38.0 33.6 38.0 120-124 35.66755 38.0 37.0 38.0 32.2 38.0 125-129 35.485400000000006 38.0 37.0 38.0 31.4 38.0 130-134 35.24285 38.0 36.0 38.0 30.0 38.0 135-139 35.0172 38.0 36.0 38.0 30.0 38.0 140-144 34.713100000000004 38.0 35.8 38.0 28.0 38.0 145-149 34.1533 38.0 35.0 38.0 25.2 38.0 150-151 30.510624999999997 35.5 28.5 38.0 11.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 14.0 3 6.0 4 0.0 5 2.0 6 4.0 7 3.0 8 2.0 9 1.0 10 1.0 11 2.0 12 3.0 13 3.0 14 2.0 15 6.0 16 1.0 17 3.0 18 4.0 19 4.0 20 7.0 21 8.0 22 6.0 23 12.0 24 10.0 25 4.0 26 17.0 27 11.0 28 17.0 29 20.0 30 30.0 31 38.0 32 50.0 33 81.0 34 134.0 35 205.0 36 527.0 37 2762.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.25 17.05 17.125 24.575 2 25.1 23.05 33.725 18.125 3 21.6 26.8 31.4 20.200000000000003 4 24.975 33.45 23.175 18.4 5 23.9 36.675000000000004 22.35 17.075000000000003 6 19.525000000000002 36.025 24.75 19.7 7 19.400000000000002 19.575 39.475 21.55 8 22.775000000000002 23.75 27.125 26.35 9 21.675 25.95 28.15 24.224999999999998 10-14 24.13 28.155 26.625 21.09 15-19 23.86 28.689999999999998 27.49 19.96 20-24 23.01 28.775000000000002 27.865000000000002 20.349999999999998 25-29 23.535 28.884999999999998 27.400000000000002 20.18 30-34 24.18 28.575 27.365000000000002 19.88 35-39 23.64 28.470000000000002 27.72 20.169999999999998 40-44 23.685000000000002 28.425 27.560000000000002 20.330000000000002 45-49 23.79 28.915000000000003 27.245 20.05 50-54 24.58 28.060000000000002 27.700000000000003 19.66 55-59 23.71 28.405 27.485 20.4 60-64 24.085 28.050000000000004 28.055000000000003 19.81 65-69 23.84 27.91 27.894999999999996 20.355 70-74 24.12 28.22 27.205000000000002 20.455000000000002 75-79 23.875 27.779999999999998 27.500000000000004 20.845 80-84 24.07 28.689999999999998 27.605 19.634999999999998 85-89 24.32 28.799999999999997 27.615000000000002 19.265 90-94 23.990000000000002 28.035 27.98 19.994999999999997 95-99 24.279999999999998 27.700000000000003 27.68 20.34 100-104 24.709999999999997 27.935 27.534999999999997 19.82 105-109 24.545 28.23 27.555000000000003 19.67 110-114 23.73 28.634999999999998 27.725 19.91 115-119 24.54 28.134999999999998 27.675 19.650000000000002 120-124 24.255 28.389999999999997 27.675 19.68 125-129 24.825 27.77 28.095 19.31 130-134 24.705 27.79 28.02 19.485 135-139 25.295 28.599999999999998 27.1 19.005 140-144 24.94 28.345 27.295 19.42 145-149 25.83 28.09 27.215 18.865000000000002 150-151 25.212606303151574 28.5767883941971 27.176088044022013 19.034517258629315 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 1.0 14 1.5 15 0.5 16 0.0 17 0.5 18 1.0 19 1.0 20 1.0 21 1.0 22 1.0 23 3.0 24 3.5 25 2.5 26 3.0 27 4.0 28 6.5 29 7.0 30 9.5 31 14.0 32 26.0 33 38.5 34 43.5 35 53.5 36 72.0 37 85.5 38 110.0 39 147.0 40 197.5 41 228.0 42 260.5 43 306.0 44 313.5 45 315.5 46 292.5 47 257.0 48 238.0 49 219.0 50 176.5 51 128.0 52 106.5 53 77.0 54 56.5 55 47.0 56 29.0 57 26.0 58 21.5 59 18.0 60 14.0 61 6.5 62 5.5 63 5.0 64 4.5 65 3.5 66 2.0 67 1.5 68 1.0 69 1.5 70 1.0 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.05 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.25 #Duplication Level Percentage of deduplicated Percentage of total 1 99.26952141057934 98.52499999999999 2 0.7052896725440806 1.4000000000000001 3 0.025188916876574305 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.0625 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.0875 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.16249999999999998 0.0 0.0 0.0 0.0 94-95 0.325 0.0 0.0 0.0 0.0 96-97 0.4125 0.0 0.0 0.0 0.0 98-99 0.475 0.0 0.0 0.0 0.0 100-101 0.5249999999999999 0.0 0.0 0.0 0.0 102-103 0.625 0.0 0.0 0.0 0.0 104-105 0.7375 0.0 0.0 0.0 0.0 106-107 0.85 0.0 0.0 0.0 0.0 108-109 0.9625 0.0 0.0 0.0 0.0 110-111 1.175 0.0 0.0 0.0 0.0 112-113 1.4500000000000002 0.0 0.0 0.0 0.0 114-115 1.6625 0.0 0.0 0.0 0.0 116-117 1.875 0.0 0.0 0.0 0.0 118-119 2.0875 0.0 0.0 0.0 0.0 120-121 2.425 0.0 0.0 0.0 0.0 122-123 2.6625 0.0 0.0 0.0 0.0 124-125 3.0 0.0 0.0 0.0 0.0 126-127 3.4 0.0 0.0 0.0 0.0 128-129 3.7125 0.0 0.0 0.0 0.0 130-131 4.2875 0.0 0.0 0.0 0.0 132-133 4.725 0.0 0.0 0.0 0.0 134-135 5.125 0.0 0.0 0.0 0.0 136-137 5.487500000000001 0.0 0.0 0.0 0.0 138-139 5.875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 607873 spots for SRR7180091.sra Written 607873 spots for SRR7180091.sra Read 607873 spots for SRR7180091.sra Written 607873 spots for SRR7180091.sra Read 607873 spots for SRR7180091.sra Written 607873 spots for SRR7180091.sra Read 607873 spots for SRR7180091.sra Written 607873 spots for SRR7180091.sra Read 607873 spots for SRR7180091.sra Written 607873 spots for SRR7180091.sra Read 607873 spots for SRR7180091.sra Written 607873 spots for SRR7180091.sra Read 607873 spots for SRR7180091.sra Written 607873 spots for SRR7180091.sra Read 607873 spots for SRR7180091.sra Written 607873 spots for SRR7180091.sra Read 607873 spots for SRR7180091.sra Written 607873 spots for SRR7180091.sra Read 607873 spots for SRR7180091.sra Written 607873 spots for SRR7180091.sra Read 607873 spots for SRR7180091.sra Written 607873 spots for SRR7180091.sra Read 607873 spots for SRR7180091.sra Written 607873 spots for SRR7180091.sra Read 607873 spots for SRR7180091.sra Written 607873 spots for SRR7180091.sra Read 607873 spots for SRR7180091.sra Written 607873 spots for SRR7180091.sra Read 607885 spots for SRR7180091.sra Written 607885 spots for SRR7180091.sra Read 607873 spots for SRR7180091.sra Written 607873 spots for SRR7180091.sra Read 607873 spots for SRR7180091.sra Written 607873 spots for SRR7180091.sra Read 607873 spots for SRR7180091.sra Written 607873 spots for SRR7180091.sra Read 607873 spots for SRR7180091.sra Written 607873 spots for SRR7180091.sra Read 607873 spots for SRR7180091.sra Written 607873 spots for SRR7180091.sra SRR ids: ['SRR7180091.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_atg3hg2_ SRR7180091.sra spots: 12157472 blocks: [[1, 607873], [607874, 1215746], [1215747, 1823619], [1823620, 2431492], [2431493, 3039365], [3039366, 3647238], [3647239, 4255111], [4255112, 4862984], [4862985, 5470857], [5470858, 6078730], [6078731, 6686603], [6686604, 7294476], [7294477, 7902349], [7902350, 8510222], [8510223, 9118095], [9118096, 9725968], [9725969, 10333841], [10333842, 10941714], [10941715, 11549587], [11549588, 12157472]] SRR7180091 file size 4098067 SRR7180091 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7180091 SRR7180091_1.fastq SRR7180091_2.fastq Input file: SRR7180091_1.fastq Paired file: SRR7180091_2.fastq trimmed: SRR7180091-trimmed-pair1.fastq, SRR7180091-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 18:18:17 2025 >> started Mon Feb 10 18:18:31 2025 >> done (13.553s) 12157472 read pairs processed; of these: 35357 ( 0.29%) short read pairs filtered out after trimming by size control 23515 ( 0.19%) empty read pairs filtered out after trimming by size control 12098600 (99.52%) read pairs available; of these: 4467465 (36.93%) trimmed read pairs available after processing 7631135 (63.07%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 0 0.00% 20 1 0.00% 21 2 0.00% 22 5 0.00% 23 6 0.00% 24 4 0.00% 25 5 0.00% 26 3 0.00% 27 6 0.00% 28 8 0.00% 29 8 0.00% 30 5 0.00% 31 2 0.00% 32 4 0.00% 33 8 0.00% 34 10 0.00% 35 8 0.00% 36 4 0.00% 37 11 0.00% 38 4 0.00% 39 6 0.00% 40 4 0.00% 41 7 0.00% 42 8 0.00% 43 10 0.00% 44 5 0.00% 45 11 0.00% 46 11 0.00% 47 12 0.00% 48 11 0.00% 49 7 0.00% 50 14 0.00% 51 23 0.00% 52 30 0.00% 53 30 0.00% 54 34 0.00% 55 27 0.00% 56 24 0.00% 57 41 0.00% 58 31 0.00% 59 58 0.00% 60 49 0.00% 61 69 0.00% 62 68 0.00% 63 92 0.00% 64 107 0.00% 65 102 0.00% 66 109 0.00% 67 166 0.00% 68 170 0.00% 69 213 0.00% 70 231 0.00% 71 253 0.00% 72 317 0.00% 73 367 0.00% 74 390 0.00% 75 489 0.00% 76 591 0.00% 77 622 0.01% 78 756 0.01% 79 830 0.01% 80 957 0.01% 81 1002 0.01% 82 1230 0.01% 83 1425 0.01% 84 2961 0.02% 85 4077 0.03% 86 4250 0.04% 87 4506 0.04% 88 4824 0.04% 89 4814 0.04% 90 4916 0.04% 91 5190 0.04% 92 5435 0.04% 93 5610 0.05% 94 5932 0.05% 95 6042 0.05% 96 6436 0.05% 97 7083 0.06% 98 7168 0.06% 99 7629 0.06% 100 8067 0.07% 101 8731 0.07% 102 9001 0.07% 103 9657 0.08% 104 10335 0.09% 105 10993 0.09% 106 11366 0.09% 107 12000 0.10% 108 12982 0.11% 109 13592 0.11% 110 14196 0.12% 111 15111 0.12% 112 15882 0.13% 113 16662 0.14% 114 17312 0.14% 115 18265 0.15% 116 19303 0.16% 117 19845 0.16% 118 21119 0.17% 119 22254 0.18% 120 23321 0.19% 121 24121 0.20% 122 24835 0.21% 123 25414 0.21% 124 26854 0.22% 125 27617 0.23% 126 28536 0.24% 127 29452 0.24% 128 30518 0.25% 129 31708 0.26% 130 33459 0.28% 131 34588 0.29% 132 35817 0.30% 133 37822 0.31% 134 39244 0.32% 135 41204 0.34% 136 42557 0.35% 137 44765 0.37% 138 46589 0.39% 139 49541 0.41% 140 51888 0.43% 141 56083 0.46% 142 60112 0.50% 143 65184 0.54% 144 73485 0.61% 145 84011 0.69% 146 100103 0.83% 147 128419 1.06% 148 187776 1.55% 149 366281 3.03% 150 2231501 18.44% 151 7631135 63.07% 12098600 reads passed initial QC criterion=sequence-density sequence-density=0.62 sequence-density-rank=1 fanout-score=3.77 fanout-score-rank=18 prefix-density=0.79 prefix-fanout=3.0 sequence=TCCACACTTGCAGCCATTCTCAGCACCAAAGTTCATCTCAGACC criterion=fanout-score sequence-density=0.02 sequence-density-rank=31 fanout-score=234.60 fanout-score-rank=1 prefix-density=0.35 prefix-fanout=12.5 sequence=CATCACCATCCCTGATTGATCTTTGATTCACAACAAGACCAACCAACCGTACAATGTTTACATAACTTGGGATAATCTCACAAGAAAGAAAGATCAATACAAAACTAGTCAGCTCAGGATGTTCCAGGCACGGTAGAACCGTGGAACCATAACAACAAGAGACATATTGCAGATAAGTACTGAAAAACAAAACACAGTACGTATTTACATGGGCAACCTTGGTTGAAGGCAACCTCATCAACGATGCTCGCTCTTCGTCTCTCCACTGTACATCCAGTCATAGACAGTGGGTGTGTTAGGCTGTGGCTTGTCAAAAACATGAGCACCAATATTCTTAGTAGCAAGGTTGCTACCAGGGTGGAACACGCTCCTCCAAACATTGCTACGCGCCGACACTGGGGTTGTAGGGGTCACTGGTGTCGTCGGTGTCCCTGGAGTTCCTGGCATAGTCATGGACCTCTGAAACTTATTAACAGGACTGCTCCCCTCTCCGACGTCAATATCTTTGATG criterion=sequence-density sequence-density=1.23 sequence-density-rank=1 fanout-score=2.67 fanout-score-rank=26 prefix-density=1.25 prefix-fanout=2.6 sequence=ATGTACCCTGACTTAGGTTTCTCAGA criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=135.35 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=10.7 sequence=AGAAAAGATAAGCTAGGCAAGATGGTTTTACTAGACAAGATGTGGGATGATGTTGTTGCTGGACCTCAGCCAGAACGTGGCCTTGGGAAGCTTAGAAAGATCAGCACCAGACCACTTAACATCAAAGATATTGACGTCGGAGAGGGGAGCAGTCCTGTTAATAAGTTTCAGAGGTCCATGACTATGCCAGGAACTCCAGGGACACCGACGACACCAGTGACCCCTACAACCCCAGTGTCGGCGCGTAGCAATGTTTGGAGGAGCGTGTTCCACCCTGGTAGCAACCTTGCTACTAAGAATATTGGTGCTCATGTTTTTGACAAGCCACAGCCTAACACACCCACTGTCTATGACTGGATGTACAGTGGAGAGACGAAGAGCGAGCATCGTTGATGAGGTTGCCTTCAACCAAGGTTGCCCATGTAAATACGTACTGTGTTTTGTTTTTCAGTACTTATCTGCAATATGTCTCTTGTTGTTATGGTTCCACGGTTCTACCGTGCCTGGAACA SRR7180091 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 18:19:17 Started mapping on | Feb 10 18:19:17 Finished on | Feb 10 18:20:48 Mapping speed, Million of reads per hour | 478.63 Number of input reads | 12098600 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 11181401 Uniquely mapped reads % | 92.42% Average mapped length | 294.44 Number of splices: Total | 11023159 Number of splices: Annotated (sjdb) | 10774518 Number of splices: GT/AG | 10837406 Number of splices: GC/AG | 145772 Number of splices: AT/AC | 9767 Number of splices: Non-canonical | 30214 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.04% Deletion average length | 2.97 Insertion rate per base | 0.02% Insertion average length | 2.48 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 251231 % of reads mapped to multiple loci | 2.08% Number of reads mapped to too many loci | 36470 % of reads mapped to too many loci | 0.30% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.12% % of reads unmapped: other | 0.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 696922 696922 696922 N_multimapping 251231 251231 251231 N_noFeature 372781 11080445 417941 N_ambiguous 114906 572 58863 UnstrandedReadsAssigned:10693714 PositiveStrandReadsAssigned:100384 NegativeStrandReadsAssigned:10704597 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7180091 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7180091-trimmed-pair1.fastq SRR7180091-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,098,600 reads, 10,593,992 reads pseudoaligned [quant] estimated average fragment length: 235.006 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,119 rounds 52401 SRR7180091.ke.tsv 34699 SRR7180091.se.tsv 87100 total ==> SRR7180091.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1783.99 1342 65.0229 Potri.005G024800.1.v4.1 1035 800.994 522 56.3311 Potri.004G059700.1.v4.1 961 727.005 9 1.07007 Potri.007G009000.2.v4.1 1416 1181.99 0 0 Potri.003G141000.2.v4.1 2943 2708.99 529.592 16.8982 Potri.016G087400.1.v4.1 270 80.2123 664 715.541 Potri.015G069301.1.v4.1 564 333.341 0 0 Potri.010G195200.1.v4.1 1773 1538.99 326 18.31 Potri.012G127500.1.v4.1 977 743 8616 1002.36 ==> SRR7180091.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 52 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 336 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 239 SRR7180091 completed mapping pipeline successfully