Starting /dee2/code/volunteer_pipeline.sh SRR7180092 current disk space = 3056703651840 free memory = 1579166132 SRR7180092 SRAfilesize 4cc7e90ef3d96c9ee88b1a525433ace5 SRR7180092.sra SRR7180092.sra file validated SRR7180092 is paired end SRR7180092 is conventional basespace SRR7180092 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7180092_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 24.95275 27.0 18.0 32.0 18.0 33.0 2 25.84225 27.0 18.0 31.0 18.0 33.0 3 28.73075 30.0 27.0 33.0 18.0 33.0 4 32.072 33.0 32.0 33.0 32.0 33.0 5 32.2015 33.0 32.0 33.0 31.0 33.0 6 35.87325 37.0 36.0 38.0 33.0 38.0 7 36.6135 38.0 37.0 38.0 34.0 38.0 8 36.85175 38.0 37.0 38.0 35.0 38.0 9 37.17275 38.0 38.0 38.0 36.0 38.0 10-14 37.4415 38.0 38.0 38.0 37.0 38.0 15-19 37.51989999999999 38.0 38.0 38.0 37.2 38.0 20-24 37.477999999999994 38.0 38.0 38.0 37.4 38.0 25-29 37.513099999999994 38.0 38.0 38.0 37.8 38.0 30-34 37.483799999999995 38.0 38.0 38.0 37.6 38.0 35-39 37.4802 38.0 38.0 38.0 37.2 38.0 40-44 37.4725 38.0 38.0 38.0 37.2 38.0 45-49 37.42525 38.0 38.0 38.0 37.0 38.0 50-54 37.364 38.0 38.0 38.0 37.0 38.0 55-59 37.3639 38.0 38.0 38.0 37.0 38.0 60-64 37.294999999999995 38.0 38.0 38.0 37.0 38.0 65-69 37.2712 38.0 38.0 38.0 36.8 38.0 70-74 37.2296 38.0 38.0 38.0 36.6 38.0 75-79 37.18759999999999 38.0 38.0 38.0 36.0 38.0 80-84 37.12935 38.0 38.0 38.0 36.0 38.0 85-89 37.0315 38.0 38.0 38.0 36.0 38.0 90-94 37.0173 38.0 38.0 38.0 36.0 38.0 95-99 36.938599999999994 38.0 38.0 38.0 35.8 38.0 100-104 36.81230000000001 38.0 38.0 38.0 35.2 38.0 105-109 36.712650000000004 38.0 38.0 38.0 34.8 38.0 110-114 36.574400000000004 38.0 38.0 38.0 34.4 38.0 115-119 36.44279999999999 38.0 38.0 38.0 34.0 38.0 120-124 36.221 38.0 37.8 38.0 33.8 38.0 125-129 36.186249999999994 38.0 37.6 38.0 33.6 38.0 130-134 36.032650000000004 38.0 37.4 38.0 33.4 38.0 135-139 35.8083 38.0 36.8 38.0 32.6 38.0 140-144 35.3634 38.0 36.0 38.0 31.0 38.0 145-149 34.9739 38.0 36.0 38.0 30.0 38.0 150-151 32.41275 37.0 33.5 38.0 16.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 2.0 15 2.0 16 0.0 17 1.0 18 0.0 19 4.0 20 2.0 21 4.0 22 6.0 23 5.0 24 7.0 25 9.0 26 9.0 27 15.0 28 10.0 29 23.0 30 29.0 31 25.0 32 69.0 33 89.0 34 142.0 35 259.0 36 647.0 37 2640.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.20052770448549 17.229551451187337 11.556728232189974 35.0131926121372 2 20.275000000000002 21.3 34.475 23.95 3 18.7 26.924999999999997 26.724999999999998 27.650000000000002 4 22.650000000000002 32.65 24.0 20.7 5 20.875 34.675 25.45 19.0 6 17.1 35.4 26.174999999999997 21.325 7 13.375 21.6 43.95 21.075 8 18.55 23.525 30.225 27.700000000000003 9 17.9 22.3 31.85 27.950000000000003 10-14 20.055 28.63 26.900000000000002 24.415 15-19 19.78 28.09 27.68 24.45 20-24 19.75 27.750000000000004 28.360000000000003 24.14 25-29 19.455 27.98 28.685 23.880000000000003 30-34 20.175 27.865000000000002 27.810000000000002 24.15 35-39 19.63 28.360000000000003 27.685 24.325 40-44 20.185 28.575 27.185 24.055 45-49 19.835 28.139999999999997 27.900000000000002 24.125 50-54 20.485 28.205000000000002 27.435 23.875 55-59 20.105 28.22 27.534999999999997 24.14 60-64 20.32 28.015 27.639999999999997 24.025 65-69 20.585 28.24 27.735 23.44 70-74 20.155 27.79 27.55 24.505 75-79 20.225 27.855 27.944999999999997 23.974999999999998 80-84 20.405 28.335 27.435 23.825 85-89 20.419999999999998 27.98 27.775 23.825 90-94 20.11 28.01 28.025 23.855 95-99 20.51 27.68 27.935 23.875 100-104 20.845 27.625 27.650000000000002 23.880000000000003 105-109 20.31 27.985 27.83 23.875 110-114 20.47 28.175 27.665 23.69 115-119 20.77 28.449999999999996 26.805 23.974999999999998 120-124 20.305 27.950000000000003 27.62 24.125 125-129 20.95 27.51 27.700000000000003 23.84 130-134 20.93 28.335 26.8 23.935000000000002 135-139 20.365 28.194999999999997 27.375 24.065 140-144 20.830000000000002 28.110000000000003 27.284999999999997 23.775 145-149 21.2 27.705000000000002 26.88 24.215 150-151 21.275 26.724999999999998 27.474999999999998 24.525 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.0 20 1.0 21 1.0 22 0.5 23 1.0 24 3.0 25 2.5 26 3.5 27 6.0 28 7.5 29 11.0 30 12.5 31 17.0 32 28.0 33 34.5 34 46.0 35 66.0 36 86.5 37 98.0 38 120.5 39 158.0 40 189.0 41 221.5 42 250.0 43 271.0 44 277.0 45 277.0 46 270.0 47 263.0 48 242.5 49 212.0 50 184.5 51 149.5 52 122.0 53 97.0 54 68.5 55 52.5 56 42.5 57 27.0 58 20.5 59 18.0 60 11.0 61 6.5 62 8.0 63 7.0 64 4.0 65 1.0 66 0.0 67 1.0 68 1.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 5.25 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.875 #Duplication Level Percentage of deduplicated Percentage of total 1 99.87484355444305 99.75 2 0.1251564455569462 0.25 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.037500000000000006 0.0 0.0 0.0 0.0 86-87 0.0875 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.16249999999999998 0.0 0.0 0.0 0.0 92-93 0.1875 0.0 0.0 0.0 0.0 94-95 0.2625 0.0 0.0 0.0 0.0 96-97 0.42500000000000004 0.0 0.0 0.0 0.0 98-99 0.525 0.0 0.0 0.0 0.0 100-101 0.575 0.0 0.0 0.0 0.0 102-103 0.7125 0.0 0.0 0.0 0.0 104-105 0.925 0.0 0.0 0.0 0.0 106-107 1.025 0.0 0.0 0.0 0.0 108-109 1.2375 0.0 0.0 0.0 0.0 110-111 1.3375 0.0 0.0 0.0 0.0 112-113 1.575 0.0 0.0 0.0 0.0 114-115 1.7875 0.0 0.0 0.0 0.0 116-117 1.925 0.0 0.0 0.0 0.0 118-119 2.125 0.0 0.0 0.0 0.0 120-121 2.3125 0.0 0.0 0.0 0.0 122-123 2.5875 0.0 0.0 0.0 0.0 124-125 2.9375 0.0 0.0 0.0 0.0 126-127 3.2875 0.0 0.0 0.0 0.0 128-129 3.5625 0.0 0.0 0.0 0.0 130-131 4.1 0.0 0.0 0.0 0.0 132-133 4.525 0.0 0.0 0.0 0.0 134-135 5.0375 0.0 0.0 0.0 0.0 136-137 5.425 0.0 0.0 0.0 0.0 138-139 5.975 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7180092 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7180092_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.79725 33.0 33.0 34.0 32.0 34.0 2 32.94725 33.0 33.0 34.0 32.0 34.0 3 32.9325 34.0 33.0 34.0 32.0 34.0 4 32.8745 34.0 33.0 34.0 32.0 34.0 5 32.97575 34.0 33.0 34.0 32.0 34.0 6 37.08075 38.0 38.0 38.0 37.0 38.0 7 37.1885 38.0 38.0 38.0 37.0 38.0 8 37.07275 38.0 38.0 38.0 36.0 38.0 9 37.11175 38.0 38.0 38.0 37.0 38.0 10-14 37.16835 38.0 38.0 38.0 37.0 38.0 15-19 37.07685 38.0 38.0 38.0 37.0 38.0 20-24 37.04684999999999 38.0 38.0 38.0 36.8 38.0 25-29 37.0907 38.0 38.0 38.0 37.0 38.0 30-34 37.04684999999999 38.0 38.0 38.0 36.8 38.0 35-39 37.004450000000006 38.0 38.0 38.0 36.8 38.0 40-44 37.009 38.0 38.0 38.0 36.4 38.0 45-49 37.004 38.0 38.0 38.0 36.4 38.0 50-54 36.97775 38.0 38.0 38.0 36.0 38.0 55-59 36.92784999999999 38.0 38.0 38.0 36.0 38.0 60-64 36.77005 38.0 38.0 38.0 35.8 38.0 65-69 36.82095 38.0 38.0 38.0 36.0 38.0 70-74 36.746750000000006 38.0 38.0 38.0 35.8 38.0 75-79 36.719300000000004 38.0 38.0 38.0 35.2 38.0 80-84 36.670249999999996 38.0 38.0 38.0 35.2 38.0 85-89 36.521499999999996 38.0 38.0 38.0 34.6 38.0 90-94 36.390049999999995 38.0 38.0 38.0 34.2 38.0 95-99 36.29105 38.0 38.0 38.0 34.0 38.0 100-104 36.17705 38.0 38.0 38.0 34.0 38.0 105-109 36.087599999999995 38.0 38.0 38.0 33.6 38.0 110-114 36.0476 38.0 37.8 38.0 33.4 38.0 115-119 36.00865 38.0 37.8 38.0 33.4 38.0 120-124 35.76199999999999 38.0 37.0 38.0 32.2 38.0 125-129 35.56 38.0 36.6 38.0 31.0 38.0 130-134 35.23225000000001 38.0 36.0 38.0 30.0 38.0 135-139 34.9985 38.0 35.8 38.0 28.0 38.0 140-144 34.62065 38.0 35.0 38.0 27.2 38.0 145-149 33.87285 38.0 35.0 38.0 23.2 38.0 150-151 30.413875 36.5 29.0 38.0 8.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 9.0 3 2.0 4 3.0 5 2.0 6 1.0 7 1.0 8 1.0 9 4.0 10 0.0 11 2.0 12 1.0 13 1.0 14 2.0 15 1.0 16 5.0 17 3.0 18 0.0 19 3.0 20 2.0 21 5.0 22 10.0 23 11.0 24 5.0 25 16.0 26 18.0 27 18.0 28 29.0 29 29.0 30 42.0 31 59.0 32 70.0 33 100.0 34 128.0 35 245.0 36 598.0 37 2574.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.95 16.1 15.675 28.275 2 23.200000000000003 23.325000000000003 35.125 18.35 3 22.05 24.525 31.374999999999996 22.05 4 24.6 33.675 22.25 19.475 5 23.825 36.975 21.8 17.4 6 19.75 36.025 25.025 19.2 7 18.875 17.925 40.699999999999996 22.5 8 20.424999999999997 24.6 27.925 27.05 9 23.025000000000002 25.1 27.85 24.025 10-14 23.76 28.515 25.564999999999998 22.16 15-19 23.61 28.12 27.465 20.805 20-24 22.89759367652209 28.470658862374304 27.610185602081145 21.021561859022462 25-29 23.427255893098444 28.542115009258794 26.610279765777488 21.42034933186527 30-34 23.42044658055472 28.036447381596076 27.400620807049165 21.14248523080004 35-39 23.870353671976755 27.988177537320908 27.38202584911332 20.75944294158902 40-44 23.471074380165287 27.998998246932132 27.693463561232157 20.836463811670423 45-49 23.552954124768622 27.675221371754468 27.795287408074444 20.976537095402474 50-54 22.99 28.02 27.884999999999998 21.105 55-59 24.335 27.500000000000004 27.395000000000003 20.77 60-64 24.01 27.515 27.845 20.630000000000003 65-69 23.525 27.584999999999997 27.310000000000002 21.58 70-74 24.01 27.88 27.595 20.515 75-79 23.515 27.889999999999997 27.939999999999998 20.655 80-84 23.66 27.935 27.755000000000003 20.65 85-89 24.055 27.845 27.22 20.880000000000003 90-94 23.69 28.134999999999998 27.310000000000002 20.865000000000002 95-99 24.03 27.215 27.985 20.77 100-104 23.805 27.884999999999998 27.61 20.7 105-109 23.7 28.655 27.255000000000003 20.39 110-114 23.905 28.720000000000002 26.939999999999998 20.435 115-119 23.97 28.084999999999997 27.355 20.59 120-124 24.265 28.08 27.405 20.25 125-129 23.86 28.065 27.87 20.205000000000002 130-134 24.55 27.665 27.689999999999998 20.095 135-139 24.975 28.15 27.500000000000004 19.375 140-144 25.735000000000003 27.46 27.205000000000002 19.6 145-149 25.945 27.54 27.165 19.35 150-151 26.1125 27.6125 27.2625 19.0125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 1.0 17 1.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 2.5 26 4.0 27 3.5 28 5.5 29 7.0 30 7.5 31 10.0 32 16.0 33 23.5 34 31.0 35 44.5 36 61.0 37 87.5 38 120.5 39 157.5 40 187.0 41 215.5 42 255.0 43 275.5 44 293.5 45 306.5 46 296.0 47 279.0 48 247.5 49 206.0 50 188.5 51 163.0 52 117.0 53 88.0 54 70.5 55 55.5 56 46.0 57 34.5 58 22.5 59 17.0 60 14.5 61 12.0 62 9.5 63 7.5 64 3.5 65 1.5 66 0.5 67 0.0 68 0.5 69 0.5 70 0.0 71 0.0 72 0.5 73 1.0 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.055 25-29 0.095 30-34 0.13 35-39 0.19 40-44 0.17500000000000002 45-49 0.055 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.45 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59778783308195 99.05000000000001 2 0.2765208647561589 0.5499999999999999 3 0.10055304172951231 0.3 4 0.025138260432378077 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.037500000000000006 0.0 0.0 0.0 0.0 86-87 0.0875 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.16249999999999998 0.0 0.0 0.0 0.0 92-93 0.1875 0.0 0.0 0.0 0.0 94-95 0.2625 0.0 0.0 0.0 0.0 96-97 0.42500000000000004 0.0 0.0 0.0 0.0 98-99 0.5375 0.0 0.0 0.0 0.0 100-101 0.6 0.0 0.0 0.0 0.0 102-103 0.7375 0.0 0.0 0.0 0.0 104-105 0.95 0.0 0.0 0.0 0.0 106-107 1.0499999999999998 0.0 0.0 0.0 0.0 108-109 1.2875 0.0 0.0 0.0 0.0 110-111 1.4125 0.0 0.0 0.0 0.0 112-113 1.675 0.0 0.0 0.0 0.0 114-115 1.8875 0.0 0.0 0.0 0.0 116-117 2.0250000000000004 0.0 0.0 0.0 0.0 118-119 2.2249999999999996 0.0 0.0 0.0 0.0 120-121 2.4125 0.0 0.0 0.0 0.0 122-123 2.6875 0.0 0.0 0.0 0.0 124-125 3.0374999999999996 0.0 0.0 0.0 0.0 126-127 3.3625 0.0 0.0 0.0 0.0 128-129 3.6625 0.0 0.0 0.0 0.0 130-131 4.225 0.0 0.0 0.0 0.0 132-133 4.65 0.0 0.0 0.0 0.0 134-135 5.1625 0.0 0.0 0.0 0.0 136-137 5.55 0.0 0.0 0.0 0.0 138-139 6.0875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATTCATG 10 0.006830828 145.0 6 CCGAACC 10 0.006830828 145.0 2 GAGGTTC 10 0.006830828 145.0 9 >>END_MODULE Read 928260 spots for SRR7180092.sra Written 928260 spots for SRR7180092.sra Read 928260 spots for SRR7180092.sra Written 928260 spots for SRR7180092.sra Read 928260 spots for SRR7180092.sra Written 928260 spots for SRR7180092.sra Read 928260 spots for SRR7180092.sra Written 928260 spots for SRR7180092.sra Read 928260 spots for SRR7180092.sra Written 928260 spots for SRR7180092.sra Read 928260 spots for SRR7180092.sra Written 928260 spots for SRR7180092.sra Read 928260 spots for SRR7180092.sra Written 928260 spots for SRR7180092.sra Read 928260 spots for SRR7180092.sra Written 928260 spots for SRR7180092.sra Read 928260 spots for SRR7180092.sra Written 928260 spots for SRR7180092.sra Read 928260 spots for SRR7180092.sra Written 928260 spots for SRR7180092.sra Read 928260 spots for SRR7180092.sra Written 928260 spots for SRR7180092.sra Read 928260 spots for SRR7180092.sra Written 928260 spots for SRR7180092.sra Read 928260 spots for SRR7180092.sra Written 928260 spots for SRR7180092.sra Read 928260 spots for SRR7180092.sra Written 928260 spots for SRR7180092.sra Read 928260 spots for SRR7180092.sra Written 928260 spots for SRR7180092.sra Read 928260 spots for SRR7180092.sra Written 928260 spots for SRR7180092.sra Read 928260 spots for SRR7180092.sra Written 928260 spots for SRR7180092.sra Read 928270 spots for SRR7180092.sra Written 928270 spots for SRR7180092.sra Read 928260 spots for SRR7180092.sra Written 928260 spots for SRR7180092.sra Read 928260 spots for SRR7180092.sra Written 928260 spots for SRR7180092.sra SRR ids: ['SRR7180092.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_048r3of0 SRR7180092.sra spots: 18565210 blocks: [[1, 928260], [928261, 1856520], [1856521, 2784780], [2784781, 3713040], [3713041, 4641300], [4641301, 5569560], [5569561, 6497820], [6497821, 7426080], [7426081, 8354340], [8354341, 9282600], [9282601, 10210860], [10210861, 11139120], [11139121, 12067380], [12067381, 12995640], [12995641, 13923900], [13923901, 14852160], [14852161, 15780420], [15780421, 16708680], [16708681, 17636940], [17636941, 18565210]] SRR7180092 file size 6269440 SRR7180092 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7180092 SRR7180092_1.fastq SRR7180092_2.fastq Input file: SRR7180092_1.fastq Paired file: SRR7180092_2.fastq trimmed: SRR7180092-trimmed-pair1.fastq, SRR7180092-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 19:33:20 2025 >> started Mon Feb 10 19:33:39 2025 >> done (19.565s) 18565210 read pairs processed; of these: 28124 ( 0.15%) short read pairs filtered out after trimming by size control 24067 ( 0.13%) empty read pairs filtered out after trimming by size control 18513019 (99.72%) read pairs available; of these: 7272440 (39.28%) trimmed read pairs available after processing 11240579 (60.72%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 2 0.00% 20 2 0.00% 21 2 0.00% 22 6 0.00% 23 4 0.00% 24 2 0.00% 25 6 0.00% 26 6 0.00% 27 6 0.00% 28 9 0.00% 29 10 0.00% 30 3 0.00% 31 4 0.00% 32 8 0.00% 33 6 0.00% 34 9 0.00% 35 6 0.00% 36 9 0.00% 37 19 0.00% 38 6 0.00% 39 9 0.00% 40 41 0.00% 41 23 0.00% 42 12 0.00% 43 10 0.00% 44 44 0.00% 45 89 0.00% 46 63 0.00% 47 21 0.00% 48 43 0.00% 49 80 0.00% 50 143 0.00% 51 75 0.00% 52 49 0.00% 53 56 0.00% 54 97 0.00% 55 173 0.00% 56 71 0.00% 57 53 0.00% 58 68 0.00% 59 209 0.00% 60 107 0.00% 61 89 0.00% 62 106 0.00% 63 140 0.00% 64 169 0.00% 65 146 0.00% 66 211 0.00% 67 255 0.00% 68 258 0.00% 69 325 0.00% 70 372 0.00% 71 391 0.00% 72 547 0.00% 73 589 0.00% 74 653 0.00% 75 777 0.00% 76 872 0.00% 77 1091 0.01% 78 1211 0.01% 79 1294 0.01% 80 1420 0.01% 81 1643 0.01% 82 1915 0.01% 83 2150 0.01% 84 3587 0.02% 85 4564 0.02% 86 4934 0.03% 87 5622 0.03% 88 5790 0.03% 89 6119 0.03% 90 6489 0.04% 91 6857 0.04% 92 7396 0.04% 93 7581 0.04% 94 8266 0.04% 95 8734 0.05% 96 9538 0.05% 97 10178 0.05% 98 10636 0.06% 99 11233 0.06% 100 12001 0.06% 101 12663 0.07% 102 13527 0.07% 103 14590 0.08% 104 15506 0.08% 105 16585 0.09% 106 17531 0.09% 107 18605 0.10% 108 19932 0.11% 109 20575 0.11% 110 21646 0.12% 111 22559 0.12% 112 24054 0.13% 113 25479 0.14% 114 26499 0.14% 115 28219 0.15% 116 29091 0.16% 117 30745 0.17% 118 32171 0.17% 119 34464 0.19% 120 35024 0.19% 121 37748 0.20% 122 38845 0.21% 123 39775 0.21% 124 41515 0.22% 125 42204 0.23% 126 44112 0.24% 127 45917 0.25% 128 47757 0.26% 129 49544 0.27% 130 52252 0.28% 131 53970 0.29% 132 56505 0.31% 133 59231 0.32% 134 61843 0.33% 135 64653 0.35% 136 67431 0.36% 137 70844 0.38% 138 74441 0.40% 139 79064 0.43% 140 83667 0.45% 141 90594 0.49% 142 98797 0.53% 143 108228 0.58% 144 121740 0.66% 145 141709 0.77% 146 171822 0.93% 147 222174 1.20% 148 329664 1.78% 149 633580 3.42% 150 3635535 19.64% 151 11240579 60.72% 18513019 reads passed initial QC criterion=sequence-density sequence-density=0.66 sequence-density-rank=1 fanout-score=3.06 fanout-score-rank=20 prefix-density=1.00 prefix-fanout=2.0 sequence=CACTTGCAGCCATTCTCAGCACCAGAGTTCATCTCAGACC criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=257.13 fanout-score-rank=1 prefix-density=0.21 prefix-fanout=16.5 sequence=TTGAAGAAAAACATTACGATTATTACATTACATGCGCAATTGGGATAAAAAGGCCCTTGAAGAAATACACGTCACTGTTATAGCACGCGCTTACTTATAGGTACAAATGCACAAAAGGCCAACACGGAGAAAATGGAACAAACTGGGCTTGATTTTCATCTTTAATACATCATCAAATGGCCAAAAGTAAAGCATCACAATCATCACTTCTTGAAAGGAATGGCTCT criterion=sequence-density sequence-density=0.90 sequence-density-rank=1 fanout-score=2.65 fanout-score-rank=19 prefix-density=0.91 prefix-fanout=2.6 sequence=ATGTACCCTGACTT criterion=fanout-score sequence-density=0.17 sequence-density-rank=15 fanout-score=41.07 fanout-score-rank=1 prefix-density=0.53 prefix-fanout=12.8 sequence=TTGGTGCTGAGA SRR7180092 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 19:34:43 Started mapping on | Feb 10 19:34:43 Finished on | Feb 10 19:37:20 Mapping speed, Million of reads per hour | 424.50 Number of input reads | 18513019 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 17042725 Uniquely mapped reads % | 92.06% Average mapped length | 294.79 Number of splices: Total | 17322497 Number of splices: Annotated (sjdb) | 16998424 Number of splices: GT/AG | 17054898 Number of splices: GC/AG | 211885 Number of splices: AT/AC | 14054 Number of splices: Non-canonical | 41660 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.69 Insertion rate per base | 0.02% Insertion average length | 2.56 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 430079 % of reads mapped to multiple loci | 2.32% Number of reads mapped to too many loci | 42716 % of reads mapped to too many loci | 0.23% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.34% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1064913 1064913 1064913 N_multimapping 430079 430079 430079 N_noFeature 396219 16883421 459311 N_ambiguous 182842 828 86185 UnstrandedReadsAssigned:16463664 PositiveStrandReadsAssigned:158476 NegativeStrandReadsAssigned:16497229 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7180092 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7180092-trimmed-pair1.fastq SRR7180092-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,513,019 reads, 16,333,893 reads pseudoaligned [quant] estimated average fragment length: 234.186 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,106 rounds 52401 SRR7180092.ke.tsv 34699 SRR7180092.se.tsv 87100 total ==> SRR7180092.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1784.81 1465 44.0147 Potri.005G024800.1.v4.1 1035 801.814 670 44.8079 Potri.004G059700.1.v4.1 961 727.831 5 0.368378 Potri.007G009000.2.v4.1 1416 1182.81 0 0 Potri.003G141000.2.v4.1 2943 2709.81 836 16.5432 Potri.016G087400.1.v4.1 270 80.696 1321.63 878.239 Potri.015G069301.1.v4.1 564 333.813 0 0 Potri.010G195200.1.v4.1 1773 1539.81 681 23.7155 Potri.012G127500.1.v4.1 977 743.825 3767 271.568 ==> SRR7180092.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 46 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 621 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 293 SRR7180092 completed mapping pipeline successfully