Starting /dee2/code/volunteer_pipeline.sh SRR7180093 current disk space = 3057673535488 free memory = 1444973788 SRR7180093 SRAfilesize b565dadfb0f895bbeecd303c940343a8 SRR7180093.sra SRR7180093.sra file validated SRR7180093 is paired end SRR7180093 is conventional basespace SRR7180093 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7180093_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 22.6565 18.0 18.0 32.0 18.0 33.0 2 27.86025 27.0 27.0 31.0 25.0 33.0 3 30.86525 32.0 32.0 33.0 27.0 33.0 4 30.46825 31.0 29.0 33.0 27.0 33.0 5 32.26125 33.0 32.0 33.0 32.0 33.0 6 36.6205 38.0 37.0 38.0 34.0 38.0 7 36.80025 38.0 37.0 38.0 34.0 38.0 8 37.2555 38.0 38.0 38.0 36.0 38.0 9 37.44575 38.0 38.0 38.0 37.0 38.0 10-14 37.60185 38.0 38.0 38.0 37.8 38.0 15-19 37.59755 38.0 38.0 38.0 38.0 38.0 20-24 37.60405 38.0 38.0 38.0 38.0 38.0 25-29 37.5976 38.0 38.0 38.0 38.0 38.0 30-34 37.5582 38.0 38.0 38.0 37.8 38.0 35-39 37.53365 38.0 38.0 38.0 38.0 38.0 40-44 37.560900000000004 38.0 38.0 38.0 38.0 38.0 45-49 37.50545 38.0 38.0 38.0 37.2 38.0 50-54 37.468900000000005 38.0 38.0 38.0 37.0 38.0 55-59 37.3965 38.0 38.0 38.0 37.0 38.0 60-64 37.38875 38.0 38.0 38.0 37.0 38.0 65-69 37.36024999999999 38.0 38.0 38.0 37.0 38.0 70-74 37.318349999999995 38.0 38.0 38.0 36.8 38.0 75-79 37.2721 38.0 38.0 38.0 36.8 38.0 80-84 37.223600000000005 38.0 38.0 38.0 36.0 38.0 85-89 37.112350000000006 38.0 38.0 38.0 36.0 38.0 90-94 37.099599999999995 38.0 38.0 38.0 36.0 38.0 95-99 37.04315 38.0 38.0 38.0 36.0 38.0 100-104 36.8874 38.0 38.0 38.0 35.4 38.0 105-109 36.826350000000005 38.0 38.0 38.0 35.0 38.0 110-114 36.61935 38.0 38.0 38.0 35.0 38.0 115-119 36.5826 38.0 38.0 38.0 34.0 38.0 120-124 36.461400000000005 38.0 38.0 38.0 34.0 38.0 125-129 36.286899999999996 38.0 38.0 38.0 33.8 38.0 130-134 36.0187 38.0 37.4 38.0 33.4 38.0 135-139 35.782250000000005 38.0 36.4 38.0 32.6 38.0 140-144 35.602250000000005 38.0 36.0 38.0 32.0 38.0 145-149 35.2319 38.0 36.0 38.0 31.0 38.0 150-151 32.561499999999995 37.0 33.5 38.0 16.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 1.0 10 0.0 11 0.0 12 0.0 13 0.0 14 1.0 15 2.0 16 0.0 17 1.0 18 1.0 19 0.0 20 3.0 21 2.0 22 5.0 23 4.0 24 4.0 25 9.0 26 7.0 27 6.0 28 17.0 29 21.0 30 24.0 31 48.0 32 49.0 33 75.0 34 121.0 35 233.0 36 629.0 37 2737.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.55716162943495 13.16688567674113 13.771353482260185 36.50459921156373 2 21.05 18.975 37.8 22.175 3 18.5 26.275 28.025 27.200000000000003 4 22.25 32.300000000000004 23.65 21.8 5 21.825 35.5 24.275 18.4 6 17.175 36.075 25.874999999999996 20.875 7 14.075 21.45 43.175000000000004 21.3 8 17.8 23.275000000000002 29.95 28.975 9 17.65 21.9 33.375 27.075 10-14 19.35 28.96 27.255000000000003 24.435000000000002 15-19 19.794999999999998 27.435 28.865000000000002 23.905 20-24 19.49 28.694999999999997 28.13 23.685000000000002 25-29 19.905 28.744999999999997 27.98 23.369999999999997 30-34 19.439999999999998 28.865000000000002 28.405 23.29 35-39 20.04 28.04 28.000000000000004 23.919999999999998 40-44 20.205000000000002 27.810000000000002 27.775 24.21 45-49 19.63 28.499999999999996 27.955000000000002 23.915 50-54 20.19 28.26 27.755000000000003 23.794999999999998 55-59 20.25 28.185 28.08 23.485 60-64 20.3 28.000000000000004 27.810000000000002 23.89 65-69 19.545 28.185 27.875 24.395 70-74 20.075000000000003 27.815 28.355000000000004 23.755000000000003 75-79 19.91 27.63 28.075 24.385 80-84 20.294999999999998 27.38 28.439999999999998 23.885 85-89 20.07 28.17 28.515 23.244999999999997 90-94 19.78 28.754999999999995 27.82 23.645 95-99 20.305 27.765 28.144999999999996 23.785 100-104 20.27 28.18 27.445000000000004 24.104999999999997 105-109 20.335 27.965 28.105000000000004 23.595 110-114 20.265 27.875 28.165000000000003 23.695 115-119 19.97 28.99 27.400000000000002 23.64 120-124 20.27 27.775 28.185 23.77 125-129 20.605 27.845 28.16 23.39 130-134 20.615 28.275 27.27 23.84 135-139 20.14 28.28 27.529999999999998 24.05 140-144 20.315 28.439999999999998 27.750000000000004 23.494999999999997 145-149 20.810000000000002 27.965 27.35 23.875 150-151 21.099999999999998 27.737499999999997 27.500000000000004 23.6625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 1.5 23 1.5 24 1.5 25 3.0 26 4.0 27 5.5 28 8.5 29 13.5 30 14.0 31 17.0 32 26.0 33 34.5 34 45.0 35 58.0 36 76.5 37 97.5 38 139.0 39 176.5 40 205.0 41 243.0 42 268.0 43 290.5 44 294.5 45 282.0 46 279.5 47 273.5 48 248.0 49 214.5 50 167.5 51 131.5 52 113.5 53 75.5 54 43.0 55 34.0 56 27.5 57 21.0 58 17.0 59 11.5 60 9.0 61 7.0 62 5.5 63 4.0 64 4.0 65 3.0 66 1.0 67 0.5 68 0.0 69 0.5 70 0.5 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.875 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.875 #Duplication Level Percentage of deduplicated Percentage of total 1 99.87484355444305 99.75 2 0.1251564455569462 0.25 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0125 0.0 0.0 0.0 0.0 80-81 0.037500000000000006 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.0875 0.0 0.0 0.0 0.0 86-87 0.1375 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.225 0.0 0.0 0.0 0.0 92-93 0.30000000000000004 0.0 0.0 0.0 0.0 94-95 0.35 0.0 0.0 0.0 0.0 96-97 0.4 0.0 0.0 0.0 0.0 98-99 0.5 0.0 0.0 0.0 0.0 100-101 0.6625 0.0 0.0 0.0 0.0 102-103 0.75 0.0 0.0 0.0 0.0 104-105 0.8375 0.0 0.0 0.0 0.0 106-107 0.9375 0.0 0.0 0.0 0.0 108-109 1.0375 0.0 0.0 0.0 0.0 110-111 1.0625 0.0 0.0 0.0 0.0 112-113 1.3 0.0 0.0 0.0 0.0 114-115 1.45 0.0 0.0 0.0 0.0 116-117 1.675 0.0 0.0 0.0 0.0 118-119 2.0125 0.0 0.0 0.0 0.0 120-121 2.1875 0.0 0.0 0.0 0.0 122-123 2.5 0.0 0.0 0.0 0.0 124-125 2.7375 0.0 0.0 0.0 0.0 126-127 2.9749999999999996 0.0 0.0 0.0 0.0 128-129 3.4125 0.0 0.0 0.0 0.0 130-131 3.875 0.0 0.0 0.0 0.0 132-133 4.3375 0.0 0.0 0.0 0.0 134-135 4.775 0.0 0.0 0.0 0.0 136-137 5.1 0.0 0.0 0.0 0.0 138-139 5.575 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAACATC 10 0.0068378756 144.95 4 AACATCA 10 0.0068378756 144.95 5 GATCGGA 40 0.0076702754 18.11875 140-144 >>END_MODULE SRR7180093 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7180093_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.8505 33.0 33.0 34.0 32.0 34.0 2 33.00075 33.0 33.0 34.0 32.0 34.0 3 33.09625 34.0 33.0 34.0 32.0 34.0 4 33.089 34.0 33.0 34.0 32.0 34.0 5 33.0575 34.0 33.0 34.0 33.0 34.0 6 37.258 38.0 38.0 38.0 37.0 38.0 7 37.15675 38.0 38.0 38.0 37.0 38.0 8 37.17875 38.0 38.0 38.0 37.0 38.0 9 37.17125 38.0 38.0 38.0 37.0 38.0 10-14 37.25215 38.0 38.0 38.0 37.0 38.0 15-19 37.23684999999999 38.0 38.0 38.0 37.0 38.0 20-24 37.2487 38.0 38.0 38.0 37.0 38.0 25-29 37.18730000000001 38.0 38.0 38.0 37.0 38.0 30-34 37.1306 38.0 38.0 38.0 37.0 38.0 35-39 37.1157 38.0 38.0 38.0 37.0 38.0 40-44 37.08995 38.0 38.0 38.0 37.0 38.0 45-49 37.10475 38.0 38.0 38.0 36.8 38.0 50-54 37.094350000000006 38.0 38.0 38.0 37.0 38.0 55-59 37.02695000000001 38.0 38.0 38.0 36.2 38.0 60-64 37.0053 38.0 38.0 38.0 36.0 38.0 65-69 36.919799999999995 38.0 38.0 38.0 36.0 38.0 70-74 36.87415 38.0 38.0 38.0 36.0 38.0 75-79 36.8377 38.0 38.0 38.0 35.8 38.0 80-84 36.8271 38.0 38.0 38.0 35.8 38.0 85-89 36.701499999999996 38.0 38.0 38.0 35.0 38.0 90-94 36.55200000000001 38.0 38.0 38.0 34.6 38.0 95-99 36.505399999999995 38.0 38.0 38.0 34.4 38.0 100-104 36.3891 38.0 38.0 38.0 34.0 38.0 105-109 36.19799999999999 38.0 38.0 38.0 33.8 38.0 110-114 36.1958 38.0 38.0 38.0 34.0 38.0 115-119 36.10695 38.0 37.4 38.0 33.6 38.0 120-124 35.79425 38.0 37.0 38.0 33.0 38.0 125-129 35.55319999999999 38.0 36.8 38.0 31.0 38.0 130-134 35.18945 38.0 36.0 38.0 29.4 38.0 135-139 34.894600000000004 38.0 35.6 38.0 28.6 38.0 140-144 34.696799999999996 38.0 35.6 38.0 27.6 38.0 145-149 34.09755 38.0 35.0 38.0 25.2 38.0 150-151 30.372999999999998 36.5 29.0 38.0 8.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 9.0 3 1.0 4 1.0 5 0.0 6 2.0 7 2.0 8 0.0 9 0.0 10 0.0 11 0.0 12 2.0 13 2.0 14 1.0 15 5.0 16 4.0 17 8.0 18 4.0 19 2.0 20 5.0 21 3.0 22 6.0 23 4.0 24 7.0 25 13.0 26 14.0 27 16.0 28 19.0 29 30.0 30 37.0 31 50.0 32 68.0 33 104.0 34 128.0 35 253.0 36 544.0 37 2656.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.9 16.475 18.025 27.6 2 24.775 22.5 33.800000000000004 18.925 3 20.200000000000003 27.675 31.724999999999998 20.4 4 24.7 33.85 22.400000000000002 19.05 5 25.174999999999997 36.325 21.55 16.950000000000003 6 18.55 37.525 24.2 19.725 7 19.325 18.15 41.8 20.724999999999998 8 19.225 24.224999999999998 29.349999999999998 27.200000000000003 9 22.6 25.775 28.4 23.225 10-14 23.22 28.765 26.22 21.795 15-19 23.52 28.849999999999998 27.200000000000003 20.43 20-24 22.473989595838333 28.84653861544618 27.63605442176871 21.04341736694678 25-29 22.907180385288967 28.19114335751814 27.62071553665249 21.280960720540406 30-34 23.050355390930022 28.53639002903193 27.550305335869457 20.862949244168586 35-39 22.801922691768475 28.154416182655716 28.194472261165632 20.849188864410173 40-44 23.32415519399249 28.335419274092615 27.784730913642054 20.55569461827284 45-49 23.429057434460677 28.40704422653592 28.146888132879727 20.017010206123675 50-54 23.045761440360092 28.432108027006752 27.881970492623154 20.640160040010002 55-59 23.792379237923793 27.37273727372737 27.792779277927792 21.04210421042104 60-64 23.62618130906545 27.78138906945347 28.001400070003502 20.591029551477575 65-69 23.001150057502876 29.17145857292865 27.69638481924096 20.131006550327516 70-74 23.215 28.535 27.425 20.825 75-79 23.705000000000002 27.825 27.865000000000002 20.605 80-84 22.915 28.645 27.855 20.585 85-89 23.53617680884044 28.456422821141057 27.726386319315964 20.281014050702534 90-94 23.494999999999997 28.53 27.544999999999998 20.43 95-99 23.715 28.435 27.775 20.075000000000003 100-104 24.12 28.000000000000004 27.775 20.105 105-109 23.375 28.465 27.834999999999997 20.325 110-114 23.695 28.110000000000003 27.875 20.32 115-119 23.66 28.18 28.255000000000003 19.905 120-124 24.16 28.299999999999997 27.675 19.865 125-129 24.099999999999998 27.965 27.48 20.455000000000002 130-134 24.15 28.494999999999997 27.384999999999998 19.97 135-139 24.875 28.139999999999997 26.924999999999997 20.06 140-144 24.474999999999998 27.88 27.655 19.99 145-149 24.93 27.900000000000002 27.445000000000004 19.725 150-151 25.44386096524131 27.956989247311824 26.944236059014752 19.654913728432106 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 1.0 23 1.0 24 1.5 25 2.0 26 1.5 27 2.0 28 3.0 29 5.5 30 9.0 31 8.0 32 13.5 33 27.5 34 40.0 35 58.5 36 71.5 37 94.5 38 130.0 39 169.0 40 222.5 41 261.0 42 269.5 43 294.5 44 317.0 45 316.0 46 304.0 47 272.0 48 245.5 49 210.0 50 167.0 51 134.0 52 100.0 53 67.5 54 42.5 55 32.5 56 26.5 57 18.5 58 15.0 59 12.5 60 10.0 61 5.5 62 4.5 63 5.0 64 2.5 65 1.0 66 1.5 67 1.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.04 25-29 0.075 30-34 0.11 35-39 0.13999999999999999 40-44 0.125 45-49 0.06 50-54 0.025 55-59 0.01 60-64 0.005 65-69 0.005 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.005 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.5 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64824120603015 99.15 2 0.2763819095477387 0.5499999999999999 3 0.02512562814070352 0.075 4 0.02512562814070352 0.1 5 0.02512562814070352 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCTTGAGCAAATTCAGTTTCTAAGCAAAAGCTTTCCAGGCCCCTTTATCC 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0125 0.0 0.0 0.0 0.0 80-81 0.037500000000000006 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.0875 0.0 0.0 0.0 0.0 86-87 0.1375 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.225 0.0 0.0 0.0 0.0 92-93 0.30000000000000004 0.0 0.0 0.0 0.0 94-95 0.35 0.0 0.0 0.0 0.0 96-97 0.4 0.0 0.0 0.0 0.0 98-99 0.5 0.0 0.0 0.0 0.0 100-101 0.6625 0.0 0.0 0.0 0.0 102-103 0.75 0.0 0.0 0.0 0.0 104-105 0.8375 0.0 0.0 0.0 0.0 106-107 0.9375 0.0 0.0 0.0 0.0 108-109 1.0499999999999998 0.0 0.0 0.0 0.0 110-111 1.0875 0.0 0.0 0.0 0.0 112-113 1.325 0.0 0.0 0.0 0.0 114-115 1.475 0.0 0.0 0.0 0.0 116-117 1.7 0.0 0.0 0.0 0.0 118-119 2.0375 0.0 0.0 0.0 0.0 120-121 2.2125 0.0 0.0 0.0 0.0 122-123 2.5250000000000004 0.0 0.0 0.0 0.0 124-125 2.7625 0.0 0.0 0.0 0.0 126-127 2.9875 0.0 0.0 0.0 0.0 128-129 3.425 0.0 0.0 0.0 0.0 130-131 3.9 0.0 0.0 0.0 0.0 132-133 4.375 0.0 0.0 0.0 0.0 134-135 4.8125 0.0 0.0 0.0 0.0 136-137 5.125 0.0 0.0 0.0 0.0 138-139 5.6 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GATCGGA 40 0.0076550315 18.125 140-144 >>END_MODULE Read 937279 spots for SRR7180093.sra Written 937279 spots for SRR7180093.sra Read 937279 spots for SRR7180093.sra Written 937279 spots for SRR7180093.sra Read 937279 spots for SRR7180093.sra Written 937279 spots for SRR7180093.sra Read 937279 spots for SRR7180093.sra Written 937279 spots for SRR7180093.sra Read 937279 spots for SRR7180093.sra Written 937279 spots for SRR7180093.sra Read 937279 spots for SRR7180093.sra Written 937279 spots for SRR7180093.sra Read 937279 spots for SRR7180093.sra Written 937279 spots for SRR7180093.sra Read 937279 spots for SRR7180093.sra Written 937279 spots for SRR7180093.sra Read 937279 spots for SRR7180093.sra Written 937279 spots for SRR7180093.sra Read 937279 spots for SRR7180093.sra Written 937279 spots for SRR7180093.sra Read 937279 spots for SRR7180093.sra Written 937279 spots for SRR7180093.sra Read 937279 spots for SRR7180093.sra Written 937279 spots for SRR7180093.sra Read 937279 spots for SRR7180093.sra Written 937279 spots for SRR7180093.sra Read 937279 spots for SRR7180093.sra Written 937279 spots for SRR7180093.sra Read 937279 spots for SRR7180093.sra Written 937279 spots for SRR7180093.sra Read 937279 spots for SRR7180093.sra Written 937279 spots for SRR7180093.sra Read 937279 spots for SRR7180093.sra Written 937279 spots for SRR7180093.sra Read 937279 spots for SRR7180093.sra Written 937279 spots for SRR7180093.sra Read 937294 spots for SRR7180093.sra Written 937294 spots for SRR7180093.sra Read 937279 spots for SRR7180093.sra Written 937279 spots for SRR7180093.sra SRR ids: ['SRR7180093.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_00rel275 SRR7180093.sra spots: 18745595 blocks: [[1, 937279], [937280, 1874558], [1874559, 2811837], [2811838, 3749116], [3749117, 4686395], [4686396, 5623674], [5623675, 6560953], [6560954, 7498232], [7498233, 8435511], [8435512, 9372790], [9372791, 10310069], [10310070, 11247348], [11247349, 12184627], [12184628, 13121906], [13121907, 14059185], [14059186, 14996464], [14996465, 15933743], [15933744, 16871022], [16871023, 17808301], [17808302, 18745595]] SRR7180093 file size 6330566 SRR7180093 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7180093 SRR7180093_1.fastq SRR7180093_2.fastq Input file: SRR7180093_1.fastq Paired file: SRR7180093_2.fastq trimmed: SRR7180093-trimmed-pair1.fastq, SRR7180093-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 18:22:42 2025 >> started Mon Feb 10 18:23:02 2025 >> done (19.835s) 18745595 read pairs processed; of these: 18262 ( 0.10%) short read pairs filtered out after trimming by size control 15288 ( 0.08%) empty read pairs filtered out after trimming by size control 18712045 (99.82%) read pairs available; of these: 6782285 (36.25%) trimmed read pairs available after processing 11929760 (63.75%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 1 0.00% 20 2 0.00% 21 1 0.00% 22 4 0.00% 23 5 0.00% 24 0 0.00% 25 4 0.00% 26 3 0.00% 27 4 0.00% 28 2 0.00% 29 2 0.00% 30 1 0.00% 31 2 0.00% 32 2 0.00% 33 2 0.00% 34 7 0.00% 35 1 0.00% 36 5 0.00% 37 4 0.00% 38 2 0.00% 39 3 0.00% 40 4 0.00% 41 6 0.00% 42 10 0.00% 43 6 0.00% 44 4 0.00% 45 8 0.00% 46 9 0.00% 47 13 0.00% 48 6 0.00% 49 16 0.00% 50 17 0.00% 51 21 0.00% 52 18 0.00% 53 23 0.00% 54 31 0.00% 55 41 0.00% 56 39 0.00% 57 33 0.00% 58 46 0.00% 59 61 0.00% 60 72 0.00% 61 78 0.00% 62 83 0.00% 63 112 0.00% 64 120 0.00% 65 139 0.00% 66 164 0.00% 67 170 0.00% 68 214 0.00% 69 294 0.00% 70 312 0.00% 71 347 0.00% 72 403 0.00% 73 500 0.00% 74 582 0.00% 75 647 0.00% 76 825 0.00% 77 857 0.00% 78 953 0.01% 79 1146 0.01% 80 1320 0.01% 81 1329 0.01% 82 1643 0.01% 83 1845 0.01% 84 2956 0.02% 85 3630 0.02% 86 3960 0.02% 87 4199 0.02% 88 4601 0.02% 89 4938 0.03% 90 5202 0.03% 91 5579 0.03% 92 6010 0.03% 93 6480 0.03% 94 7020 0.04% 95 7520 0.04% 96 8341 0.04% 97 8739 0.05% 98 9373 0.05% 99 9902 0.05% 100 10580 0.06% 101 11160 0.06% 102 12045 0.06% 103 12859 0.07% 104 13703 0.07% 105 14758 0.08% 106 15559 0.08% 107 16665 0.09% 108 17803 0.10% 109 18695 0.10% 110 19953 0.11% 111 20637 0.11% 112 21406 0.11% 113 22725 0.12% 114 23742 0.13% 115 25226 0.13% 116 26420 0.14% 117 27959 0.15% 118 29676 0.16% 119 31321 0.17% 120 33968 0.18% 121 34351 0.18% 122 34761 0.19% 123 36339 0.19% 124 38040 0.20% 125 38833 0.21% 126 40504 0.22% 127 42292 0.23% 128 44032 0.24% 129 46046 0.25% 130 48378 0.26% 131 50229 0.27% 132 53021 0.28% 133 55184 0.29% 134 57452 0.31% 135 60313 0.32% 136 63119 0.34% 137 67063 0.36% 138 70531 0.38% 139 74823 0.40% 140 80199 0.43% 141 86352 0.46% 142 93812 0.50% 143 103835 0.55% 144 117547 0.63% 145 134512 0.72% 146 161614 0.86% 147 212099 1.13% 148 312927 1.67% 149 596276 3.19% 150 3387867 18.11% 151 11929760 63.75% 18712045 reads passed initial QC criterion=sequence-density sequence-density=0.51 sequence-density-rank=1 fanout-score=2.74 fanout-score-rank=27 prefix-density=0.65 prefix-fanout=2.2 sequence=CATCTCAGACCTCTCATAGAACATCTTAACTGGTGCAACACCTGCAATGATTGTCTCAGTTGTGGTGTTCTCTGAGAAACCTAAGTCAGGGTACATGCCACATTTGCA criterion=fanout-score sequence-density=0.01 sequence-density-rank=36 fanout-score=59.60 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=7.7 sequence=CTTTAGCTTCTACTTTTATTTAATAGTTTTATAGATTACACAAAGGAAATACAACACAAGATCTCCCCACAAATCACACACATTGATGCAGTACTGAACTCGTTGCACGAAAGCGCTTAGATATATATTATACAAGTACTAGCATGATCACAAACATGTGATGCTTATTGGTCGAGATCGATGACCCCTTCTATTACTCCGTGCTAAGGGCTTCGTCGATGTCTTTAGTCATATGAACCATAAGATCAACATAAATCTCTGGAACCGGGACTTCAGGATGGAGTTTTTCGTATTCAATGGTCAGTTTTGCCAAGCAGCCCGAGCCTTTTGGTGTAAGCTGCCAGACGGGCCTATAGACCTTGTAAATTTTCATGACATCTCCTTCCAAACCATTAAGAGTTATGATCTTGTTCTCATCATCGAAGGAAACCTCCTCTTTAAAGACCCCGGCTTTCCCTCCGATTGTGTACTGCCAAATCCTGATAGAGCCCGCAGTCTCCCAGTCACCTGC criterion=sequence-density sequence-density=0.54 sequence-density-rank=1 fanout-score=2.90 fanout-score-rank=29 prefix-density=0.70 prefix-fanout=2.2 sequence=GGTTTCTCAGAGA criterion=fanout-score sequence-density=0.01 sequence-density-rank=37 fanout-score=191.24 fanout-score-rank=1 prefix-density=0.17 prefix-fanout=12.7 sequence=TTTCTTTGAGAGTGCATAGATTTGTGTTGATATAGAAAACAATGGCACTACATGGAAAGATTGAGACAACATTAGAACTCAAGTCCTCCGCAGAGAAGTTCTACAAAGTGTGGAGGAGCCAGTCCTTCCATGTTCCCAAACATGCTTCCAAGCATATCCAAGGAGTTGATATACATGCAGGTGACTGGGAGACTGCGGGCTCTATCAGGATTTGGCAGTACACAATCGGAGGGAAAGCCGGGGTCTTTAAAGAGGAGGTTTCCTTCGATGATGAGAACAAGATCATAACTCTTAATGGTTTGGAAGGAGATGTCATGAAAATTTACAAGGTCTATAGGCCCGTCTGGCAGCTTACACCAAAAGGCTCGGGCTGCTTGGCAAAACTGACCATTGAATACGAAAAACTCCATCCTGAAGTCCCGGTTCCAGAGATTTATGTTGATCTTATGGTTCATATGACTAAAGACATCGACGAAGCCCTTAGCACGGAGTAATAGAAGGGGTCATCGAT SRR7180093 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 18:24:00 Started mapping on | Feb 10 18:24:01 Finished on | Feb 10 18:26:04 Mapping speed, Million of reads per hour | 547.67 Number of input reads | 18712045 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 17737537 Uniquely mapped reads % | 94.79% Average mapped length | 295.56 Number of splices: Total | 18380991 Number of splices: Annotated (sjdb) | 18043372 Number of splices: GT/AG | 18092610 Number of splices: GC/AG | 231032 Number of splices: AT/AC | 14096 Number of splices: Non-canonical | 43253 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.03% Deletion average length | 2.66 Insertion rate per base | 0.02% Insertion average length | 2.57 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 438969 % of reads mapped to multiple loci | 2.35% Number of reads mapped to too many loci | 35170 % of reads mapped to too many loci | 0.19% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.62% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 552218 552218 552218 N_multimapping 438969 438969 438969 N_noFeature 380982 17570694 459475 N_ambiguous 182680 1034 93727 UnstrandedReadsAssigned:17173875 PositiveStrandReadsAssigned:165809 NegativeStrandReadsAssigned:17184335 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7180093 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7180093-trimmed-pair1.fastq SRR7180093-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,712,045 reads, 16,972,412 reads pseudoaligned [quant] estimated average fragment length: 243.537 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,045 rounds 52401 SRR7180093.ke.tsv 34699 SRR7180093.se.tsv 87100 total ==> SRR7180093.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1775.46 1331 41.5573 Potri.005G024800.1.v4.1 1035 792.463 160 11.1924 Potri.004G059700.1.v4.1 961 718.495 41 3.1633 Potri.007G009000.2.v4.1 1416 1173.46 0 0 Potri.003G141000.2.v4.1 2943 2700.46 543 11.1466 Potri.016G087400.1.v4.1 270 79.7122 1180 820.613 Potri.015G069301.1.v4.1 564 326.509 0 0 Potri.010G195200.1.v4.1 1773 1530.46 254.728 9.22646 Potri.012G127500.1.v4.1 977 734.474 4949 373.527 ==> SRR7180093.se.tsv <== Potri.001G166300.v4.1 1 Potri.001G448400.v4.1 121 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 440 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 2810 Potri.001G452600.v4.1 282 SRR7180093 completed mapping pipeline successfully