Starting /dee2/code/volunteer_pipeline.sh SRR7180094 current disk space = 3056879648768 free memory = 1325929500 SRR7180094 SRAfilesize 8ae3a3a547886210481d227d64922496 SRR7180094.sra SRR7180094.sra file validated SRR7180094 is paired end SRR7180094 is conventional basespace SRR7180094 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7180094_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 19.32825 18.0 18.0 18.0 18.0 32.0 2 22.09125 18.0 18.0 27.0 18.0 30.0 3 28.257 27.0 27.0 32.0 25.0 32.0 4 29.263 31.0 29.0 31.0 25.0 33.0 5 32.11425 33.0 32.0 33.0 32.0 33.0 6 35.80625 37.0 35.0 38.0 31.0 38.0 7 36.719 38.0 37.0 38.0 34.0 38.0 8 37.32475 38.0 38.0 38.0 36.0 38.0 9 37.44825 38.0 38.0 38.0 37.0 38.0 10-14 37.51505 38.0 38.0 38.0 37.0 38.0 15-19 37.539699999999996 38.0 38.0 38.0 37.8 38.0 20-24 37.5492 38.0 38.0 38.0 37.8 38.0 25-29 37.576499999999996 38.0 38.0 38.0 38.0 38.0 30-34 37.548100000000005 38.0 38.0 38.0 38.0 38.0 35-39 37.5251 38.0 38.0 38.0 37.8 38.0 40-44 37.49395 38.0 38.0 38.0 37.6 38.0 45-49 37.4851 38.0 38.0 38.0 37.2 38.0 50-54 37.5173 38.0 38.0 38.0 37.4 38.0 55-59 37.431850000000004 38.0 38.0 38.0 37.0 38.0 60-64 37.363299999999995 38.0 38.0 38.0 37.0 38.0 65-69 37.3055 38.0 38.0 38.0 37.0 38.0 70-74 37.3214 38.0 38.0 38.0 37.0 38.0 75-79 37.29425 38.0 38.0 38.0 36.8 38.0 80-84 37.2159 38.0 38.0 38.0 36.2 38.0 85-89 37.150600000000004 38.0 38.0 38.0 36.0 38.0 90-94 37.078649999999996 38.0 38.0 38.0 36.0 38.0 95-99 37.03574999999999 38.0 38.0 38.0 36.0 38.0 100-104 36.931149999999995 38.0 38.0 38.0 35.6 38.0 105-109 36.8182 38.0 38.0 38.0 35.0 38.0 110-114 36.64020000000001 38.0 38.0 38.0 34.4 38.0 115-119 36.5703 38.0 38.0 38.0 34.0 38.0 120-124 36.48405 38.0 38.0 38.0 34.0 38.0 125-129 36.25105 38.0 37.8 38.0 33.8 38.0 130-134 36.0529 38.0 37.2 38.0 33.0 38.0 135-139 35.8703 38.0 36.4 38.0 33.0 38.0 140-144 35.699650000000005 38.0 36.0 38.0 32.2 38.0 145-149 35.3297 38.0 36.0 38.0 31.2 38.0 150-151 32.589875 36.5 33.5 38.0 16.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 0.0 15 0.0 16 0.0 17 1.0 18 1.0 19 0.0 20 1.0 21 3.0 22 1.0 23 4.0 24 8.0 25 7.0 26 3.0 27 17.0 28 18.0 29 19.0 30 36.0 31 37.0 32 49.0 33 90.0 34 124.0 35 253.0 36 748.0 37 2579.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 31.386477242830836 15.759010786635097 11.628518810839253 41.225993159694816 2 18.025 19.525000000000002 36.199999999999996 26.25 3 20.200000000000003 22.025 26.75 31.025000000000002 4 22.275 28.849999999999998 22.175 26.700000000000003 5 20.925 32.75 25.424999999999997 20.9 6 18.35 33.675 27.025 20.95 7 14.674999999999999 22.725 43.45 19.15 8 18.3 24.775 30.85 26.075 9 18.35 24.224999999999998 32.1 25.324999999999996 10-14 19.67 28.675 27.794999999999998 23.86 15-19 19.28 28.37 28.189999999999998 24.16 20-24 20.064999999999998 28.050000000000004 28.415000000000003 23.47 25-29 19.515 27.93 28.544999999999998 24.01 30-34 19.585 28.09 28.235 24.09 35-39 19.75 28.084999999999997 27.834999999999997 24.33 40-44 19.73 27.950000000000003 28.225 24.095 45-49 19.49 28.46 27.384999999999998 24.665 50-54 19.72 28.199999999999996 28.07 24.01 55-59 18.935 28.485 28.17 24.41 60-64 20.31 27.134999999999998 28.34 24.215 65-69 19.875 28.33 27.284999999999997 24.51 70-74 19.655 27.860000000000003 27.91 24.575 75-79 19.759999999999998 27.54 28.125 24.575 80-84 20.465 27.125 28.360000000000003 24.05 85-89 19.825 27.229999999999997 28.535 24.41 90-94 20.599999999999998 27.865000000000002 27.355 24.18 95-99 19.84 27.544999999999998 28.505000000000003 24.11 100-104 20.385 27.99 27.555000000000003 24.07 105-109 20.185 28.405 27.525 23.885 110-114 20.7 27.634999999999998 27.705000000000002 23.96 115-119 20.645 27.905 27.715 23.735 120-124 20.47 27.529999999999998 27.700000000000003 24.3 125-129 20.335 27.71 27.67 24.285 130-134 20.919999999999998 27.58 27.589999999999996 23.91 135-139 21.025 27.560000000000002 27.83 23.585 140-144 21.285 27.47 27.435 23.810000000000002 145-149 21.055 28.7 26.405 23.84 150-151 21.3625 27.85 26.575 24.212500000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 2.0 1 1.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 1.0 24 0.5 25 1.5 26 4.0 27 6.0 28 6.5 29 11.0 30 16.5 31 18.0 32 24.0 33 33.5 34 45.0 35 60.0 36 83.0 37 112.0 38 134.0 39 154.5 40 189.5 41 224.0 42 239.0 43 262.5 44 286.5 45 290.0 46 279.5 47 259.0 48 249.0 49 224.0 50 180.5 51 143.5 52 116.0 53 94.5 54 70.5 55 51.5 56 30.0 57 16.0 58 18.5 59 17.0 60 12.5 61 10.0 62 5.0 63 5.0 64 4.5 65 1.0 66 0.5 67 0.5 68 1.5 69 1.5 70 0.5 71 0.0 72 0.0 73 1.0 74 1.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.9750000000000005 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.84977466199298 99.7 2 0.15022533800701052 0.3 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.0625 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.1125 0.0 0.0 0.0 0.0 92-93 0.1875 0.0 0.0 0.0 0.0 94-95 0.325 0.0 0.0 0.0 0.0 96-97 0.375 0.0 0.0 0.0 0.0 98-99 0.5625 0.0 0.0 0.0 0.0 100-101 0.7250000000000001 0.0 0.0 0.0 0.0 102-103 0.85 0.0 0.0 0.0 0.0 104-105 0.9624999999999999 0.0 0.0 0.0 0.0 106-107 1.125 0.0 0.0 0.0 0.0 108-109 1.35 0.0 0.0 0.0 0.0 110-111 1.65 0.0 0.0 0.0 0.0 112-113 2.0 0.0 0.0 0.0 0.0 114-115 2.3125 0.0 0.0 0.0 0.0 116-117 2.55 0.0 0.0 0.0 0.0 118-119 2.8375 0.0 0.0 0.0 0.0 120-121 3.1875 0.0 0.0 0.0 0.0 122-123 3.6375 0.0 0.0 0.0 0.0 124-125 3.95 0.0 0.0 0.0 0.0 126-127 4.3875 0.0 0.0 0.0 0.0 128-129 4.7375 0.0 0.0 0.0 0.0 130-131 5.3125 0.0 0.0 0.0 0.0 132-133 5.9625 0.0 0.0 0.0 0.0 134-135 6.6375 0.0 0.0 0.0 0.0 136-137 7.35 0.0 0.0 0.0 0.0 138-139 8.175 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7180094 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7180094_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.7655 33.0 33.0 34.0 32.0 34.0 2 32.84625 33.0 33.0 34.0 32.0 34.0 3 33.01425 34.0 33.0 34.0 32.0 34.0 4 32.97375 34.0 33.0 34.0 32.0 34.0 5 32.81175 34.0 33.0 34.0 32.0 34.0 6 37.0445 38.0 38.0 38.0 37.0 38.0 7 37.08275 38.0 38.0 38.0 37.0 38.0 8 36.9705 38.0 38.0 38.0 36.0 38.0 9 37.08125 38.0 38.0 38.0 37.0 38.0 10-14 37.05585 38.0 38.0 38.0 37.0 38.0 15-19 37.044349999999994 38.0 38.0 38.0 36.8 38.0 20-24 37.05695 38.0 38.0 38.0 37.0 38.0 25-29 37.005900000000004 38.0 38.0 38.0 37.0 38.0 30-34 36.9009 38.0 38.0 38.0 36.2 38.0 35-39 36.8586 38.0 38.0 38.0 36.2 38.0 40-44 36.87505 38.0 38.0 38.0 36.0 38.0 45-49 36.91975 38.0 38.0 38.0 36.0 38.0 50-54 36.932849999999995 38.0 38.0 38.0 36.2 38.0 55-59 36.85655 38.0 38.0 38.0 36.0 38.0 60-64 36.79315 38.0 38.0 38.0 36.0 38.0 65-69 36.722 38.0 38.0 38.0 35.8 38.0 70-74 36.7313 38.0 38.0 38.0 35.8 38.0 75-79 36.69555 38.0 38.0 38.0 35.8 38.0 80-84 36.722449999999995 38.0 38.0 38.0 35.4 38.0 85-89 36.53035 38.0 38.0 38.0 35.0 38.0 90-94 36.486 38.0 38.0 38.0 34.8 38.0 95-99 36.41324999999999 38.0 38.0 38.0 34.4 38.0 100-104 36.2716 38.0 38.0 38.0 34.0 38.0 105-109 36.09285 38.0 38.0 38.0 33.4 38.0 110-114 36.107749999999996 38.0 38.0 38.0 34.0 38.0 115-119 36.00834999999999 38.0 37.8 38.0 33.4 38.0 120-124 35.8006 38.0 37.2 38.0 32.6 38.0 125-129 35.443999999999996 38.0 36.2 38.0 31.0 38.0 130-134 35.2176 38.0 36.0 38.0 30.6 38.0 135-139 34.898 38.0 36.0 38.0 28.2 38.0 140-144 34.6201 38.0 35.2 38.0 27.6 38.0 145-149 33.863600000000005 38.0 35.0 38.0 21.8 38.0 150-151 30.26525 36.5 29.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 10.0 3 6.0 4 3.0 5 3.0 6 0.0 7 1.0 8 2.0 9 0.0 10 0.0 11 2.0 12 5.0 13 2.0 14 2.0 15 1.0 16 1.0 17 1.0 18 2.0 19 2.0 20 1.0 21 8.0 22 11.0 23 8.0 24 12.0 25 14.0 26 19.0 27 23.0 28 34.0 29 39.0 30 44.0 31 41.0 32 69.0 33 90.0 34 114.0 35 245.0 36 540.0 37 2645.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.599999999999994 16.325 18.9 30.175 2 23.95 23.3 33.025 19.725 3 21.75 27.275 28.875 22.1 4 24.6 34.225 22.650000000000002 18.525 5 23.1 36.05 24.349999999999998 16.5 6 19.400000000000002 37.025000000000006 25.424999999999997 18.15 7 19.6 17.45 41.725 21.224999999999998 8 22.875 24.2 27.275 25.650000000000002 9 22.05 25.4 30.425 22.125 10-14 23.905 28.349999999999998 25.814999999999998 21.93 15-19 23.07 29.07 27.16 20.7 20-24 23.63918351010606 28.34200520312187 27.476485891534917 20.542325395237143 25-29 23.89911929543635 28.672938350680543 27.126701361088873 20.301240992794238 30-34 23.221704960704812 28.818140861991292 27.181258447214297 20.7788957300896 35-39 23.763963332164504 27.92165506186445 27.565997094625054 20.74838451134599 40-44 23.060744153437827 28.98993439831739 27.152085732885972 20.797235715358806 45-49 23.87409927942354 28.32766212970376 27.386909527622098 20.411329063250598 50-54 23.85215564669401 28.76863058917675 27.328198459537862 20.051015304591377 55-59 23.845 28.84 26.845000000000002 20.47 60-64 24.665 28.455000000000002 26.63 20.25 65-69 24.245 28.565 27.26 19.93 70-74 23.849999999999998 28.194999999999997 27.515 20.44 75-79 23.91 28.345 27.35 20.395 80-84 24.4 28.43 27.375 19.794999999999998 85-89 24.365000000000002 29.025000000000002 26.77 19.84 90-94 24.195 27.925 28.110000000000003 19.77 95-99 24.654999999999998 27.810000000000002 27.500000000000004 20.035 100-104 24.7 28.415000000000003 26.705000000000002 20.18 105-109 24.675 27.47 27.62 20.235 110-114 24.215 28.205000000000002 27.26 20.32 115-119 24.6 28.035 27.05 20.315 120-124 24.385 28.910000000000004 26.845000000000002 19.86 125-129 25.545 28.084999999999997 26.919999999999998 19.45 130-134 24.825 28.24 26.86 20.075000000000003 135-139 25.629999999999995 27.715 27.205000000000002 19.45 140-144 25.91 27.555000000000003 27.18 19.355 145-149 26.435 27.779999999999998 26.450000000000003 19.335 150-151 26.4599224709266 26.92259597349006 27.397774165311993 19.219707390271353 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.5 14 1.0 15 0.5 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 0.5 22 0.5 23 0.5 24 0.0 25 0.5 26 4.0 27 6.5 28 5.5 29 7.5 30 10.5 31 13.5 32 18.0 33 27.0 34 35.0 35 42.0 36 54.0 37 81.5 38 116.0 39 149.0 40 193.0 41 232.5 42 261.5 43 298.5 44 322.0 45 320.5 46 305.5 47 295.0 48 270.0 49 213.5 50 165.0 51 133.5 52 103.0 53 78.5 54 66.0 55 46.5 56 27.5 57 23.0 58 19.0 59 10.5 60 10.0 61 8.5 62 5.0 63 5.5 64 3.5 65 1.0 66 0.5 67 0.0 68 0.5 69 1.0 70 0.5 71 0.0 72 1.0 73 1.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.06 25-29 0.08 30-34 0.11499999999999999 35-39 0.185 40-44 0.155 45-49 0.08 50-54 0.03 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0375 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.5227329816629 99.05000000000001 2 0.4772670183371013 0.95 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.0625 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.1125 0.0 0.0 0.0 0.0 92-93 0.1875 0.0 0.0 0.0 0.0 94-95 0.325 0.0 0.0 0.0 0.0 96-97 0.3625 0.0 0.0 0.0 0.0 98-99 0.5375 0.0 0.0 0.0 0.0 100-101 0.7 0.0 0.0 0.0 0.0 102-103 0.825 0.0 0.0 0.0 0.0 104-105 0.9375 0.0 0.0 0.0 0.0 106-107 1.1 0.0 0.0 0.0 0.0 108-109 1.325 0.0 0.0 0.0 0.0 110-111 1.625 0.0 0.0 0.0 0.0 112-113 1.975 0.0 0.0 0.0 0.0 114-115 2.3125 0.0 0.0 0.0 0.0 116-117 2.5375 0.0 0.0 0.0 0.0 118-119 2.8375 0.0 0.0 0.0 0.0 120-121 3.1875 0.0 0.0 0.0 0.0 122-123 3.6125 0.0 0.0 0.0 0.0 124-125 3.925 0.0 0.0 0.0 0.0 126-127 4.325 0.0 0.0 0.0 0.0 128-129 4.6875 0.0 0.0 0.0 0.0 130-131 5.275 0.0 0.0 0.0 0.0 132-133 5.925 0.0 0.0 0.0 0.0 134-135 6.612500000000001 0.0 0.0 0.0 0.0 136-137 7.375 0.0 0.0 0.0 0.0 138-139 8.2 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GACATTG 10 0.006830828 145.0 3 GACCTGA 10 0.006830828 145.0 9 >>END_MODULE Read 889882 spots for SRR7180094.sra Written 889882 spots for SRR7180094.sra Read 889882 spots for SRR7180094.sra Written 889882 spots for SRR7180094.sra Read 889882 spots for SRR7180094.sra Written 889882 spots for SRR7180094.sra Read 889882 spots for SRR7180094.sra Written 889882 spots for SRR7180094.sra Read 889882 spots for SRR7180094.sra Written 889882 spots for SRR7180094.sra Read 889882 spots for SRR7180094.sra Written 889882 spots for SRR7180094.sra Read 889882 spots for SRR7180094.sra Written 889882 spots for SRR7180094.sra Read 889882 spots for SRR7180094.sra Written 889882 spots for SRR7180094.sra Read 889895 spots for SRR7180094.sra Written 889895 spots for SRR7180094.sra Read 889882 spots for SRR7180094.sra Written 889882 spots for SRR7180094.sra Read 889882 spots for SRR7180094.sra Written 889882 spots for SRR7180094.sra Read 889882 spots for SRR7180094.sra Written 889882 spots for SRR7180094.sra Read 889882 spots for SRR7180094.sra Written 889882 spots for SRR7180094.sra Read 889882 spots for SRR7180094.sra Written 889882 spots for SRR7180094.sra Read 889882 spots for SRR7180094.sra Written 889882 spots for SRR7180094.sra Read 889882 spots for SRR7180094.sra Written 889882 spots for SRR7180094.sra Read 889882 spots for SRR7180094.sra Written 889882 spots for SRR7180094.sra Read 889882 spots for SRR7180094.sra Written 889882 spots for SRR7180094.sra Read 889882 spots for SRR7180094.sra Written 889882 spots for SRR7180094.sra Read 889882 spots for SRR7180094.sra Written 889882 spots for SRR7180094.sra SRR ids: ['SRR7180094.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_6eamo7ri SRR7180094.sra spots: 17797653 blocks: [[1, 889882], [889883, 1779764], [1779765, 2669646], [2669647, 3559528], [3559529, 4449410], [4449411, 5339292], [5339293, 6229174], [6229175, 7119056], [7119057, 8008938], [8008939, 8898820], [8898821, 9788702], [9788703, 10678584], [10678585, 11568466], [11568467, 12458348], [12458349, 13348230], [13348231, 14238112], [14238113, 15127994], [15127995, 16017876], [16017877, 16907758], [16907759, 17797653]] SRR7180094 file size 6009340 SRR7180094 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7180094 SRR7180094_1.fastq SRR7180094_2.fastq Input file: SRR7180094_1.fastq Paired file: SRR7180094_2.fastq trimmed: SRR7180094-trimmed-pair1.fastq, SRR7180094-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 19:34:38 2025 >> started Mon Feb 10 19:35:03 2025 >> done (25.478s) 17797653 read pairs processed; of these: 29363 ( 0.16%) short read pairs filtered out after trimming by size control 24411 ( 0.14%) empty read pairs filtered out after trimming by size control 17743879 (99.70%) read pairs available; of these: 6800739 (38.33%) trimmed read pairs available after processing 10943140 (61.67%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 0 0.00% 20 2 0.00% 21 6 0.00% 22 1 0.00% 23 0 0.00% 24 7 0.00% 25 4 0.00% 26 7 0.00% 27 2 0.00% 28 3 0.00% 29 2 0.00% 30 9 0.00% 31 3 0.00% 32 4 0.00% 33 8 0.00% 34 8 0.00% 35 7 0.00% 36 8 0.00% 37 8 0.00% 38 4 0.00% 39 8 0.00% 40 11 0.00% 41 6 0.00% 42 19 0.00% 43 8 0.00% 44 11 0.00% 45 4 0.00% 46 17 0.00% 47 17 0.00% 48 19 0.00% 49 27 0.00% 50 28 0.00% 51 25 0.00% 52 34 0.00% 53 31 0.00% 54 43 0.00% 55 55 0.00% 56 44 0.00% 57 62 0.00% 58 63 0.00% 59 84 0.00% 60 102 0.00% 61 108 0.00% 62 130 0.00% 63 152 0.00% 64 163 0.00% 65 185 0.00% 66 202 0.00% 67 255 0.00% 68 320 0.00% 69 348 0.00% 70 449 0.00% 71 510 0.00% 72 572 0.00% 73 665 0.00% 74 774 0.00% 75 889 0.01% 76 1107 0.01% 77 1257 0.01% 78 1358 0.01% 79 1641 0.01% 80 1818 0.01% 81 2058 0.01% 82 2411 0.01% 83 2824 0.02% 84 4156 0.02% 85 5469 0.03% 86 5927 0.03% 87 6553 0.04% 88 7025 0.04% 89 7534 0.04% 90 7884 0.04% 91 8390 0.05% 92 8862 0.05% 93 9535 0.05% 94 10210 0.06% 95 10964 0.06% 96 11857 0.07% 97 12739 0.07% 98 13744 0.08% 99 14703 0.08% 100 15541 0.09% 101 16566 0.09% 102 17390 0.10% 103 18311 0.10% 104 19571 0.11% 105 20928 0.12% 106 21762 0.12% 107 23371 0.13% 108 25084 0.14% 109 26513 0.15% 110 27836 0.16% 111 29405 0.17% 112 30670 0.17% 113 31491 0.18% 114 33083 0.19% 115 35033 0.20% 116 36163 0.20% 117 37997 0.21% 118 40205 0.23% 119 42221 0.24% 120 44634 0.25% 121 46258 0.26% 122 46268 0.26% 123 47883 0.27% 124 49692 0.28% 125 51410 0.29% 126 52656 0.30% 127 54964 0.31% 128 56606 0.32% 129 58916 0.33% 130 61232 0.35% 131 63116 0.36% 132 66353 0.37% 133 68311 0.38% 134 70674 0.40% 135 73218 0.41% 136 75861 0.43% 137 78918 0.44% 138 81785 0.46% 139 86366 0.49% 140 90664 0.51% 141 95885 0.54% 142 102609 0.58% 143 111110 0.63% 144 122139 0.69% 145 137129 0.77% 146 158764 0.89% 147 201031 1.13% 148 286454 1.61% 149 522056 2.94% 150 3022076 17.03% 151 10943140 61.67% 17743879 reads passed initial QC criterion=sequence-density sequence-density=0.37 sequence-density-rank=1 fanout-score=2.78 fanout-score-rank=34 prefix-density=0.51 prefix-fanout=2.0 sequence=CATCTCAGACCTCTCATAGAACATCTTAACTGGTGCAACACCTGCAATGATTGTCTCAGTTGTGGTGTTCTCTGAGAAACCTAAGTCAGGGTACATGCCACATTTGCAGCCACTGCC criterion=fanout-score sequence-density=0.02 sequence-density-rank=34 fanout-score=36.63 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=7.7 sequence=AGCAGCAGGAAATACAAGACACTTACAGATTACTAGCCATCAAATGAGATCCTGTAGAAAGGATTTGAGGAGGCCATGGCTAGCTAACTGTACTTTAATTTACAGCAAATACTATATTAGACAAACATGGAGTGACCAGACTTCTTCTTTTTATTTATTATAGTTCCATAAAACTGCTTGGTTGGAGCCAT criterion=sequence-density sequence-density=0.60 sequence-density-rank=1 fanout-score=2.18 fanout-score-rank=36 prefix-density=0.62 prefix-fanout=2.1 sequence=GGCAGTGGCTGCAAATGTGGCATGTACCCTGACTTAGGTTTCTCAGA criterion=fanout-score sequence-density=0.02 sequence-density-rank=37 fanout-score=36.18 fanout-score-rank=1 prefix-density=0.15 prefix-fanout=5.5 sequence=TCTTTGAGAGTGCATAGATTTGTGTTGATATAGAAAACAATGGCACTACATGGAAAGATTGAGACAACATTAGAACTCAAGTCCTCCGCAGAGAAGTTCTACAAAGTGTGGAGGAGCCAGTCCTTCCATGTTCCCAAACATGCTTCCAAGCATATCCAAGGAGTTGATATACATGCAGGTGACTGGGAGACTGCGGGCTCTATCAGGATTTGGCAGTACACAATCGGAGGGAAAGCCGGGGTCTTTAAAGAGGAGGTTTCC SRR7180094 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 19:35:57 Started mapping on | Feb 10 19:35:57 Finished on | Feb 10 19:38:17 Mapping speed, Million of reads per hour | 456.27 Number of input reads | 17743879 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 16609954 Uniquely mapped reads % | 93.61% Average mapped length | 293.71 Number of splices: Total | 16408882 Number of splices: Annotated (sjdb) | 16074485 Number of splices: GT/AG | 16146587 Number of splices: GC/AG | 202432 Number of splices: AT/AC | 13798 Number of splices: Non-canonical | 46065 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.03% Deletion average length | 2.64 Insertion rate per base | 0.02% Insertion average length | 2.57 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 382654 % of reads mapped to multiple loci | 2.16% Number of reads mapped to too many loci | 45147 % of reads mapped to too many loci | 0.25% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.91% % of reads unmapped: other | 0.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 774977 774977 774977 N_multimapping 382654 382654 382654 N_noFeature 399134 16451957 467546 N_ambiguous 166894 934 76724 UnstrandedReadsAssigned:16043926 PositiveStrandReadsAssigned:157063 NegativeStrandReadsAssigned:16065684 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7180094 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7180094-trimmed-pair1.fastq SRR7180094-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,743,879 reads, 15,956,583 reads pseudoaligned [quant] estimated average fragment length: 222.511 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,146 rounds 52401 SRR7180094.ke.tsv 34699 SRR7180094.se.tsv 87100 total ==> SRR7180094.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1796.49 2154 71.0277 Potri.005G024800.1.v4.1 1035 813.489 503 36.6288 Potri.004G059700.1.v4.1 961 739.499 37 2.96395 Potri.007G009000.2.v4.1 1416 1194.49 0 0 Potri.003G141000.2.v4.1 2943 2721.49 923 20.091 Potri.016G087400.1.v4.1 270 85.2012 1234 857.978 Potri.015G069301.1.v4.1 564 344.672 0 0 Potri.010G195200.1.v4.1 1773 1551.49 569 21.7255 Potri.012G127500.1.v4.1 977 755.494 12116 950.025 ==> SRR7180094.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 48 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 729 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 4 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 505 SRR7180094 completed mapping pipeline successfully