Starting /dee2/code/volunteer_pipeline.sh SRR7180095 current disk space = 3056678977536 free memory = 1579283616 SRR7180095 SRAfilesize 377e5679ea7db1c0bed8eb274ab85429 SRR7180095.sra SRR7180095.sra file validated SRR7180095 is paired end SRR7180095 is conventional basespace SRR7180095 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7180095_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 22.03 18.0 18.0 32.0 18.0 33.0 2 27.256 28.0 25.0 31.0 18.0 33.0 3 29.7665 31.0 29.0 33.0 27.0 33.0 4 28.7605 31.0 28.0 33.0 15.0 33.0 5 32.42325 33.0 32.0 33.0 32.0 33.0 6 36.11425 37.0 36.0 38.0 33.0 38.0 7 37.34 38.0 38.0 38.0 36.0 38.0 8 37.403 38.0 38.0 38.0 36.0 38.0 9 37.6655 38.0 38.0 38.0 38.0 38.0 10-14 37.70215 38.0 38.0 38.0 38.0 38.0 15-19 37.70245 38.0 38.0 38.0 38.0 38.0 20-24 37.68155 38.0 38.0 38.0 38.0 38.0 25-29 37.67845 38.0 38.0 38.0 38.0 38.0 30-34 37.6438 38.0 38.0 38.0 38.0 38.0 35-39 37.60145 38.0 38.0 38.0 38.0 38.0 40-44 37.592650000000006 38.0 38.0 38.0 38.0 38.0 45-49 37.55825 38.0 38.0 38.0 38.0 38.0 50-54 37.49465 38.0 38.0 38.0 38.0 38.0 55-59 37.4863 38.0 38.0 38.0 37.8 38.0 60-64 37.43335 38.0 38.0 38.0 37.6 38.0 65-69 37.38865 38.0 38.0 38.0 37.0 38.0 70-74 37.34140000000001 38.0 38.0 38.0 37.0 38.0 75-79 37.3246 38.0 38.0 38.0 37.0 38.0 80-84 37.26655 38.0 38.0 38.0 37.0 38.0 85-89 37.21355 38.0 38.0 38.0 37.0 38.0 90-94 37.12995 38.0 38.0 38.0 36.4 38.0 95-99 37.080149999999996 38.0 38.0 38.0 36.0 38.0 100-104 36.9721 38.0 38.0 38.0 36.0 38.0 105-109 36.77380000000001 38.0 38.0 38.0 35.4 38.0 110-114 36.70075 38.0 38.0 38.0 35.0 38.0 115-119 36.7023 38.0 38.0 38.0 35.0 38.0 120-124 36.591750000000005 38.0 38.0 38.0 34.8 38.0 125-129 36.4504 38.0 38.0 38.0 34.2 38.0 130-134 36.17765 38.0 38.0 38.0 34.0 38.0 135-139 36.05755 38.0 37.8 38.0 33.2 38.0 140-144 35.79285 38.0 37.2 38.0 33.0 38.0 145-149 35.5682 38.0 36.2 38.0 33.0 38.0 150-151 32.8945 37.0 33.5 38.0 17.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 2.0 8 1.0 9 0.0 10 0.0 11 1.0 12 1.0 13 1.0 14 0.0 15 2.0 16 0.0 17 1.0 18 1.0 19 4.0 20 1.0 21 2.0 22 3.0 23 5.0 24 6.0 25 10.0 26 8.0 27 11.0 28 19.0 29 13.0 30 16.0 31 36.0 32 29.0 33 58.0 34 82.0 35 178.0 36 623.0 37 2885.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.86538973131152 13.72705506783719 16.121308858739024 36.286246342112264 2 21.401752190237797 17.521902377972467 39.24906132665832 21.827284105131415 3 19.475 24.9 26.325 29.299999999999997 4 20.75 30.25 23.599999999999998 25.4 5 20.775 34.275 24.65 20.3 6 17.375 35.15 27.750000000000004 19.725 7 13.4 22.900000000000002 44.35 19.35 8 17.7 23.75 30.95 27.6 9 18.05 23.9 33.575 24.474999999999998 10-14 19.235 29.470000000000002 27.189999999999998 24.104999999999997 15-19 18.62 29.565 28.18 23.635 20-24 18.795 29.565 28.715000000000003 22.925 25-29 19.485 29.255 28.494999999999997 22.765 30-34 19.195 29.29 28.305000000000003 23.21 35-39 19.355 28.585 28.425 23.635 40-44 19.580000000000002 29.345 27.99 23.085 45-49 19.675 29.244999999999997 27.500000000000004 23.580000000000002 50-54 18.98 29.575000000000003 27.41 24.035 55-59 19.794999999999998 29.299999999999997 27.355 23.549999999999997 60-64 19.495 28.775000000000002 27.605 24.125 65-69 19.855 28.535 27.775 23.835 70-74 19.335 28.83 27.229999999999997 24.605 75-79 19.445 28.62 28.005000000000003 23.93 80-84 20.09 28.595 27.950000000000003 23.365 85-89 19.645000000000003 28.79 28.1 23.465 90-94 19.994999999999997 28.625 27.605 23.775 95-99 20.495 28.08 28.34 23.085 100-104 20.3 28.655 26.950000000000003 24.095 105-109 20.47 28.185 27.400000000000002 23.945 110-114 20.175 28.7 27.55 23.575 115-119 20.305 27.935 27.855 23.905 120-124 20.365 29.020000000000003 26.71 23.905 125-129 20.665 28.144999999999996 27.105 24.085 130-134 20.669999999999998 28.910000000000004 27.26 23.16 135-139 20.575 28.310000000000002 27.36 23.755000000000003 140-144 20.69 28.435 26.715 24.16 145-149 20.685000000000002 29.185 26.375 23.755000000000003 150-151 20.930814462654823 28.474915551107216 26.56074064806706 24.0335293381709 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 1.0 1 1.0 2 0.5 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.5 11 0.5 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 1.0 20 1.0 21 0.5 22 1.5 23 1.5 24 2.5 25 5.0 26 13.5 27 14.5 28 14.5 29 22.5 30 25.0 31 32.5 32 41.5 33 56.0 34 68.5 35 85.5 36 114.0 37 125.0 38 146.0 39 179.0 40 206.0 41 227.0 42 246.0 43 244.0 44 255.5 45 271.5 46 262.5 47 239.5 48 208.0 49 183.0 50 153.0 51 127.0 52 95.0 53 76.5 54 64.5 55 42.5 56 31.5 57 27.0 58 20.5 59 15.5 60 11.5 61 9.0 62 7.5 63 6.5 64 3.0 65 2.0 66 2.0 67 1.5 68 1.0 69 0.5 70 1.0 71 1.0 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 6.0249999999999995 2 0.125 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.08750000000000001 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59829274416269 99.175 2 0.37660055234747675 0.75 3 0.025106703489831784 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.0625 0.0 0.0 0.0 0.0 84-85 0.0875 0.0 0.0 0.0 0.0 86-87 0.1125 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.16249999999999998 0.0 0.0 0.0 0.0 92-93 0.1875 0.0 0.0 0.0 0.0 94-95 0.225 0.0 0.0 0.0 0.0 96-97 0.325 0.0 0.0 0.0 0.0 98-99 0.5125 0.0 0.0 0.0 0.0 100-101 0.5875 0.0 0.0 0.0 0.0 102-103 0.7 0.0 0.0 0.0 0.0 104-105 0.75 0.0 0.0 0.0 0.0 106-107 0.8875 0.0 0.0 0.0 0.0 108-109 1.0375 0.0 0.0 0.0 0.0 110-111 1.2999999999999998 0.0 0.0 0.0 0.0 112-113 1.4874999999999998 0.0 0.0 0.0 0.0 114-115 1.575 0.0 0.0 0.0 0.0 116-117 1.8375 0.0 0.0 0.0 0.0 118-119 2.0 0.0 0.0 0.0 0.0 120-121 2.325 0.0 0.0 0.0 0.0 122-123 2.7375 0.0 0.0 0.0 0.0 124-125 3.2 0.0 0.0 0.0 0.0 126-127 3.5875 0.0 0.0 0.0 0.0 128-129 3.9000000000000004 0.0 0.0 0.0 0.0 130-131 4.3875 0.0 0.0 0.0 0.0 132-133 4.8875 0.0 0.0 0.0 0.0 134-135 5.4125 0.0 0.0 0.0 0.0 136-137 5.775 0.0 0.0 0.0 0.0 138-139 6.3 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGTCAAA 10 0.006331531 148.67949 1 CATGCAA 10 0.006836113 144.9625 9 TTTTTTT 50 2.1042179E-6 23.194 60-64 >>END_MODULE SRR7180095 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7180095_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.11975 33.0 33.0 34.0 33.0 34.0 2 33.25325 34.0 33.0 34.0 33.0 34.0 3 33.31975 34.0 33.0 34.0 33.0 34.0 4 33.24475 34.0 33.0 34.0 33.0 34.0 5 33.26 34.0 33.0 34.0 33.0 34.0 6 37.326 38.0 38.0 38.0 38.0 38.0 7 37.44075 38.0 38.0 38.0 38.0 38.0 8 37.43775 38.0 38.0 38.0 38.0 38.0 9 37.41375 38.0 38.0 38.0 38.0 38.0 10-14 37.4306 38.0 38.0 38.0 38.0 38.0 15-19 37.3721 38.0 38.0 38.0 38.0 38.0 20-24 37.36225 38.0 38.0 38.0 38.0 38.0 25-29 37.362750000000005 38.0 38.0 38.0 38.0 38.0 30-34 37.321600000000004 38.0 38.0 38.0 38.0 38.0 35-39 37.259750000000004 38.0 38.0 38.0 37.4 38.0 40-44 37.22425 38.0 38.0 38.0 37.0 38.0 45-49 37.2412 38.0 38.0 38.0 37.0 38.0 50-54 37.283 38.0 38.0 38.0 37.0 38.0 55-59 37.2236 38.0 38.0 38.0 37.0 38.0 60-64 37.21655 38.0 38.0 38.0 37.0 38.0 65-69 37.1503 38.0 38.0 38.0 37.0 38.0 70-74 37.1233 38.0 38.0 38.0 37.0 38.0 75-79 37.0979 38.0 38.0 38.0 36.6 38.0 80-84 37.0727 38.0 38.0 38.0 36.2 38.0 85-89 36.93605 38.0 38.0 38.0 36.0 38.0 90-94 36.87015 38.0 38.0 38.0 36.0 38.0 95-99 36.81275 38.0 38.0 38.0 35.8 38.0 100-104 36.722249999999995 38.0 38.0 38.0 35.2 38.0 105-109 36.5306 38.0 38.0 38.0 34.6 38.0 110-114 36.427150000000005 38.0 38.0 38.0 34.0 38.0 115-119 36.1634 38.0 38.0 38.0 34.0 38.0 120-124 36.083200000000005 38.0 38.0 38.0 33.8 38.0 125-129 35.8276 38.0 37.0 38.0 33.0 38.0 130-134 35.69995 38.0 37.0 38.0 33.0 38.0 135-139 35.3121 38.0 36.0 38.0 31.0 38.0 140-144 34.991949999999996 38.0 36.0 38.0 29.4 38.0 145-149 34.55159999999999 38.0 35.4 38.0 28.4 38.0 150-151 30.97575 36.5 30.0 38.0 12.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 8.0 3 2.0 4 0.0 5 5.0 6 0.0 7 2.0 8 1.0 9 1.0 10 0.0 11 1.0 12 1.0 13 1.0 14 2.0 15 2.0 16 2.0 17 2.0 18 2.0 19 6.0 20 3.0 21 0.0 22 12.0 23 6.0 24 4.0 25 6.0 26 12.0 27 16.0 28 11.0 29 24.0 30 18.0 31 44.0 32 37.0 33 65.0 34 122.0 35 184.0 36 535.0 37 2863.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.91745872936468 16.58329164582291 18.90945472736368 29.589794897448723 2 23.925 21.349999999999998 36.7 18.025 3 22.675 25.424999999999997 31.175000000000004 20.724999999999998 4 23.5 34.4 23.549999999999997 18.55 5 25.224999999999998 34.775 23.25 16.75 6 20.025000000000002 36.925000000000004 24.25 18.8 7 20.230057514378593 18.37959489872468 41.01025256314079 20.38009502375594 8 21.80545136284071 24.306076519129782 27.68192048012003 26.206551637909474 9 23.275000000000002 25.525 28.999999999999996 22.2 10-14 23.53 28.565 25.840000000000003 22.065 15-19 23.389677935587116 28.815763152630524 27.460492098419685 20.33406681336267 20-24 23.455554999749886 28.372767745485465 27.667450352658697 20.50422690210595 25-29 23.90673471430001 28.414890423296306 27.15901130791554 20.519363554488145 30-34 24.010012515644554 28.32040050062578 27.694618272841055 19.97496871088861 35-39 23.67169112123792 27.788071510841807 27.763032700686065 20.777204667234216 40-44 24.242575992788822 27.92328108568281 27.247233211477788 20.586909710050577 45-49 24.048036027020263 28.19614711033275 27.06529897423067 20.690517888416313 50-54 23.300825206301575 28.312078019504877 27.901975493873472 20.48512128032008 55-59 24.21468587434974 27.34093637454982 28.04621848739496 20.39815926370548 60-64 23.547354735473547 27.597759775977597 28.442844284428443 20.412041204120413 65-69 23.718557783667553 28.339250887633145 27.70915637345602 20.233034955243287 70-74 23.657365736573656 28.317831783178317 27.71777177717772 20.307030703070307 75-79 23.585 28.62 27.32 20.474999999999998 80-84 24.097409740974097 27.917791779177918 28.18781878187819 19.796979697969796 85-89 24.32 27.66 27.884999999999998 20.135 90-94 24.115000000000002 28.084999999999997 27.365000000000002 20.435 95-99 23.585 28.349999999999998 28.050000000000004 20.015 100-104 23.46 28.33 27.73 20.48 105-109 23.785 28.225 27.650000000000002 20.34 110-114 24.104999999999997 27.500000000000004 28.38 20.015 115-119 24.32 27.384999999999998 28.18 20.115 120-124 24.165 28.189999999999998 27.91 19.735 125-129 24.725 27.365000000000002 28.475 19.435 130-134 24.34 28.17 27.889999999999997 19.6 135-139 24.435000000000002 28.115000000000002 27.834999999999997 19.615 140-144 25.014999999999997 28.310000000000002 27.62 19.055 145-149 24.755 28.035 27.815 19.395 150-151 26.187789895950857 27.980443775855584 26.75191174627053 19.07985458192303 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.0 21 1.5 22 3.0 23 2.0 24 1.5 25 1.5 26 3.0 27 7.0 28 7.5 29 8.0 30 11.5 31 12.5 32 24.5 33 28.5 34 33.0 35 54.0 36 64.5 37 89.0 38 140.5 39 176.5 40 207.5 41 252.0 42 265.5 43 267.0 44 286.5 45 305.0 46 283.0 47 245.5 48 230.0 49 199.0 50 165.5 51 134.5 52 108.5 53 92.0 54 66.0 55 50.5 56 39.0 57 32.5 58 27.0 59 17.0 60 16.5 61 11.5 62 7.0 63 7.5 64 4.0 65 0.5 66 1.0 67 1.5 68 0.5 69 1.5 70 1.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.5 79 1.0 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.025 8 0.025 9 0.0 10-14 0.0 15-19 0.02 20-24 0.045 25-29 0.06999999999999999 30-34 0.125 35-39 0.155 40-44 0.155 45-49 0.075 50-54 0.025 55-59 0.04 60-64 0.01 65-69 0.015 70-74 0.01 75-79 0.0 80-84 0.01 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.2875 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.325 #Duplication Level Percentage of deduplicated Percentage of total 1 99.37075257991442 98.7 2 0.5789076264787314 1.15 3 0.05033979360684621 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.0625 0.0 0.0 0.0 0.0 84-85 0.0875 0.0 0.0 0.0 0.0 86-87 0.1125 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.16249999999999998 0.0 0.0 0.0 0.0 92-93 0.1875 0.0 0.0 0.0 0.0 94-95 0.225 0.0 0.0 0.0 0.0 96-97 0.325 0.0 0.0 0.0 0.0 98-99 0.5125 0.0 0.0 0.0 0.0 100-101 0.6125 0.0 0.0 0.0 0.0 102-103 0.725 0.0 0.0 0.0 0.0 104-105 0.775 0.0 0.0 0.0 0.0 106-107 0.925 0.0 0.0 0.0 0.0 108-109 1.125 0.0 0.0 0.0 0.0 110-111 1.4 0.0 0.0 0.0 0.0 112-113 1.5875 0.0 0.0 0.0 0.0 114-115 1.675 0.0 0.0 0.0 0.0 116-117 1.9375 0.0 0.0 0.0 0.0 118-119 2.1 0.0 0.0 0.0 0.0 120-121 2.425 0.0 0.0 0.0 0.0 122-123 2.8375000000000004 0.0 0.0 0.0 0.0 124-125 3.2875 0.0 0.0 0.0 0.0 126-127 3.6625 0.0 0.0 0.0 0.0 128-129 3.95 0.0 0.0 0.0 0.0 130-131 4.475 0.0 0.0 0.0 0.0 132-133 4.9875 0.0 0.0 0.0 0.0 134-135 5.525 0.0 0.0 0.0 0.0 136-137 5.9 0.0 0.0 0.0 0.0 138-139 6.4375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTGAGTG 10 0.0069124657 144.425 7 GTGGCCG 10 0.0069124657 144.425 6 GCCGTGA 10 0.0069124657 144.425 9 CTTGAGT 10 0.0069124657 144.425 6 TGAGCTT 10 0.0069124657 144.425 2 TGAGTGC 10 0.0069124657 144.425 8 >>END_MODULE Read 793678 spots for SRR7180095.sra Written 793678 spots for SRR7180095.sra Read 793678 spots for SRR7180095.sra Written 793678 spots for SRR7180095.sra Read 793678 spots for SRR7180095.sra Written 793678 spots for SRR7180095.sra Read 793678 spots for SRR7180095.sra Written 793678 spots for SRR7180095.sra Read 793678 spots for SRR7180095.sra Written 793678 spots for SRR7180095.sra Read 793678 spots for SRR7180095.sra Written 793678 spots for SRR7180095.sra Read 793678 spots for SRR7180095.sra Written 793678 spots for SRR7180095.sra Read 793678 spots for SRR7180095.sra Written 793678 spots for SRR7180095.sra Read 793678 spots for SRR7180095.sra Written 793678 spots for SRR7180095.sra Read 793678 spots for SRR7180095.sra Written 793678 spots for SRR7180095.sra Read 793678 spots for SRR7180095.sra Written 793678 spots for SRR7180095.sra Read 793679 spots for SRR7180095.sra Written 793679 spots for SRR7180095.sra Read 793678 spots for SRR7180095.sra Written 793678 spots for SRR7180095.sra Read 793678 spots for SRR7180095.sra Written 793678 spots for SRR7180095.sra Read 793678 spots for SRR7180095.sra Written 793678 spots for SRR7180095.sra Read 793678 spots for SRR7180095.sra Written 793678 spots for SRR7180095.sra Read 793678 spots for SRR7180095.sra Written 793678 spots for SRR7180095.sra Read 793678 spots for SRR7180095.sra Written 793678 spots for SRR7180095.sra Read 793678 spots for SRR7180095.sra Written 793678 spots for SRR7180095.sra Read 793678 spots for SRR7180095.sra Written 793678 spots for SRR7180095.sra SRR ids: ['SRR7180095.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_mhrofoop SRR7180095.sra spots: 15873561 blocks: [[1, 793678], [793679, 1587356], [1587357, 2381034], [2381035, 3174712], [3174713, 3968390], [3968391, 4762068], [4762069, 5555746], [5555747, 6349424], [6349425, 7143102], [7143103, 7936780], [7936781, 8730458], [8730459, 9524136], [9524137, 10317814], [10317815, 11111492], [11111493, 11905170], [11905171, 12698848], [12698849, 13492526], [13492527, 14286204], [14286205, 15079882], [15079883, 15873561]] SRR7180095 file size 5357328 SRR7180095 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7180095 SRR7180095_1.fastq SRR7180095_2.fastq Input file: SRR7180095_1.fastq Paired file: SRR7180095_2.fastq trimmed: SRR7180095-trimmed-pair1.fastq, SRR7180095-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 19:34:21 2025 >> started Mon Feb 10 19:34:37 2025 >> done (16.332s) 15873561 read pairs processed; of these: 20501 ( 0.13%) short read pairs filtered out after trimming by size control 14539 ( 0.09%) empty read pairs filtered out after trimming by size control 15838521 (99.78%) read pairs available; of these: 5938167 (37.49%) trimmed read pairs available after processing 9900354 (62.51%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 2 0.00% 20 1 0.00% 21 3 0.00% 22 5 0.00% 23 6 0.00% 24 8 0.00% 25 2 0.00% 26 11 0.00% 27 7 0.00% 28 5 0.00% 29 5 0.00% 30 5 0.00% 31 3 0.00% 32 6 0.00% 33 6 0.00% 34 5 0.00% 35 5 0.00% 36 7 0.00% 37 6 0.00% 38 11 0.00% 39 5 0.00% 40 9 0.00% 41 5 0.00% 42 14 0.00% 43 14 0.00% 44 11 0.00% 45 7 0.00% 46 13 0.00% 47 21 0.00% 48 19 0.00% 49 24 0.00% 50 31 0.00% 51 41 0.00% 52 42 0.00% 53 40 0.00% 54 52 0.00% 55 44 0.00% 56 62 0.00% 57 64 0.00% 58 74 0.00% 59 86 0.00% 60 108 0.00% 61 109 0.00% 62 135 0.00% 63 140 0.00% 64 136 0.00% 65 160 0.00% 66 203 0.00% 67 212 0.00% 68 270 0.00% 69 287 0.00% 70 344 0.00% 71 386 0.00% 72 444 0.00% 73 580 0.00% 74 649 0.00% 75 762 0.00% 76 857 0.01% 77 992 0.01% 78 1085 0.01% 79 1287 0.01% 80 1444 0.01% 81 1667 0.01% 82 1823 0.01% 83 2203 0.01% 84 3220 0.02% 85 4256 0.03% 86 4691 0.03% 87 5503 0.03% 88 6065 0.04% 89 6191 0.04% 90 6443 0.04% 91 6945 0.04% 92 7127 0.04% 93 7358 0.05% 94 7950 0.05% 95 8579 0.05% 96 9111 0.06% 97 9907 0.06% 98 10426 0.07% 99 11283 0.07% 100 12056 0.08% 101 12507 0.08% 102 13313 0.08% 103 14092 0.09% 104 14991 0.09% 105 16042 0.10% 106 17109 0.11% 107 18454 0.12% 108 19407 0.12% 109 20610 0.13% 110 21731 0.14% 111 22585 0.14% 112 23925 0.15% 113 25133 0.16% 114 26046 0.16% 115 27904 0.18% 116 28946 0.18% 117 30486 0.19% 118 31892 0.20% 119 33347 0.21% 120 35297 0.22% 121 36401 0.23% 122 37683 0.24% 123 38334 0.24% 124 40239 0.25% 125 40883 0.26% 126 42594 0.27% 127 44334 0.28% 128 46011 0.29% 129 47584 0.30% 130 49982 0.32% 131 52323 0.33% 132 53812 0.34% 133 55901 0.35% 134 57418 0.36% 135 60271 0.38% 136 61552 0.39% 137 64342 0.41% 138 67135 0.42% 139 71855 0.45% 140 75601 0.48% 141 79713 0.50% 142 85350 0.54% 143 92404 0.58% 144 100563 0.63% 145 112880 0.71% 146 131190 0.83% 147 166195 1.05% 148 239053 1.51% 149 463187 2.92% 150 2825376 17.84% 151 9900354 62.51% 15838521 reads passed initial QC criterion=sequence-density sequence-density=0.49 sequence-density-rank=1 fanout-score=3.01 fanout-score-rank=25 prefix-density=0.69 prefix-fanout=2.1 sequence=CACTTGCAGCCATTCTCAGCACCA criterion=fanout-score sequence-density=0.01 sequence-density-rank=28 fanout-score=231.37 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=14.7 sequence=AAGAAACAACATTCTGAACATAAAGACACCAAATACTTAAAAACTACAATAGATGAAAGCCCAAATGACCCATAAAGTATTCAGACCACCCATAATTTAAAGCTGCCAGCCAGGTGCATTGCTTCCGGTTCCCGTCCCTGTAGTATATCCGGTGCCACCAGTCCCAGTGCCAAATGCAGCGTCACCGGCACGCGTATTATGGCCAGTGGTGTCACCTGGAAGCCCATCTGGATGTGTCCTCGCCACACCCTCCTCCACTTGCCCACCATATGGCTGTCCGGTTCCATGTCCTGGCATAGCCGACATTTGATGAGTGCCCATGGGGTAACCAGTGACCCCAGTGGCTGAATGGGTGTGGGTGTCATGGCCGCCACTTGTCATGTAACCACCAGTACCTCCAGTTGCTGAAGCAGCATGCTTCGATGCCGCATTGTGCTGTTTTGCATCTTGTTTATTGAGCTCTGCTTGTGTCATCCTCTCTTGTTTCTTTTCTCTTGCCATTTCT criterion=sequence-density sequence-density=0.57 sequence-density-rank=1 fanout-score=2.96 fanout-score-rank=18 prefix-density=0.57 prefix-fanout=2.9 sequence=ATGTACCCTGACTT criterion=fanout-score sequence-density=0.02 sequence-density-rank=25 fanout-score=39.34 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=7.8 sequence=AAAAGAAACAAGAGAGGATGACACAAGCAGAGCTCAATAAACAAGATGCAAAACAGCACAATGCGGCATCGAAGCATGCTGCTTCAGCAACTGGAGGTACTGGTGGTTACATGACAAGTGGCGGCCATGACACCCACACCCATTCAGCCACTGGGGTCACTGGTTACCCCATGGGCACTCATCAAATGTCGGCTATGCCAGGACATGGAACCGGACAGCCATATGGTGGGCAAGTGGAGGAGGGTGTGGCGAGGACACATCCAGATGGGCTTCCAGGTGACACCACTGGCCATAATACGCGTGCCGGTGACGCTGCATTTGGCACTGGGACTGGTGGCACCGGATATACTACAGGGACGGGAACCGGAAGCAATGCACCTGGCTGGCAGCTTTAAATTATGGGTGGTCTGAATACTTTATGGGTCATTTGGGCTTTCATCTATTGTAGTTTTTAAGTATTTGGTGTCTTTATGTTCAGAATGTTGTTTCTT SRR7180095 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 19:35:48 Started mapping on | Feb 10 19:35:48 Finished on | Feb 10 19:37:45 Mapping speed, Million of reads per hour | 487.34 Number of input reads | 15838521 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 14866761 Uniquely mapped reads % | 93.86% Average mapped length | 294.28 Number of splices: Total | 13644178 Number of splices: Annotated (sjdb) | 13340113 Number of splices: GT/AG | 13427349 Number of splices: GC/AG | 165609 Number of splices: AT/AC | 10566 Number of splices: Non-canonical | 40654 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.04% Deletion average length | 2.66 Insertion rate per base | 0.02% Insertion average length | 2.45 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 354502 % of reads mapped to multiple loci | 2.24% Number of reads mapped to too many loci | 33060 % of reads mapped to too many loci | 0.21% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.64% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 638731 638731 638731 N_multimapping 354502 354502 354502 N_noFeature 444315 14697941 508767 N_ambiguous 176815 735 72321 UnstrandedReadsAssigned:14245631 PositiveStrandReadsAssigned:168085 NegativeStrandReadsAssigned:14285673 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7180095 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7180095-trimmed-pair1.fastq SRR7180095-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,838,521 reads, 14,173,153 reads pseudoaligned [quant] estimated average fragment length: 223.434 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,210 rounds 52401 SRR7180095.ke.tsv 34699 SRR7180095.se.tsv 87100 total ==> SRR7180095.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1795.57 1511 50.689 Potri.005G024800.1.v4.1 1035 812.566 3205 237.586 Potri.004G059700.1.v4.1 961 738.585 15 1.22332 Potri.007G009000.2.v4.1 1416 1193.57 0 0 Potri.003G141000.2.v4.1 2943 2720.57 958 21.2108 Potri.016G087400.1.v4.1 270 82.4784 1756 1282.44 Potri.015G069301.1.v4.1 564 343.377 0 0 Potri.010G195200.1.v4.1 1773 1550.57 553 21.4826 Potri.012G127500.1.v4.1 977 754.571 5999 478.883 ==> SRR7180095.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 77 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 626 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 162 SRR7180095 completed mapping pipeline successfully