Starting /dee2/code/volunteer_pipeline.sh SRR7180096 current disk space = 3057316216832 free memory = 1174477156 SRR7180096 SRAfilesize 102d246b98c73bbce993aa9f2265d372 SRR7180096.sra SRR7180096.sra file validated SRR7180096 is paired end SRR7180096 is conventional basespace SRR7180096 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7180096_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 20.13825 18.0 18.0 18.0 18.0 32.0 2 29.2275 29.0 27.0 31.0 27.0 33.0 3 30.682 31.0 29.0 33.0 27.0 33.0 4 31.51875 32.0 32.0 33.0 30.0 33.0 5 32.651 33.0 33.0 33.0 32.0 33.0 6 36.67375 38.0 37.0 38.0 34.0 38.0 7 37.2845 38.0 38.0 38.0 36.0 38.0 8 37.38075 38.0 38.0 38.0 37.0 38.0 9 37.53125 38.0 38.0 38.0 37.0 38.0 10-14 37.6009 38.0 38.0 38.0 38.0 38.0 15-19 37.62645 38.0 38.0 38.0 38.0 38.0 20-24 37.61730000000001 38.0 38.0 38.0 38.0 38.0 25-29 37.5938 38.0 38.0 38.0 38.0 38.0 30-34 37.535799999999995 38.0 38.0 38.0 38.0 38.0 35-39 37.49915 38.0 38.0 38.0 38.0 38.0 40-44 37.4799 38.0 38.0 38.0 37.8 38.0 45-49 37.5013 38.0 38.0 38.0 37.8 38.0 50-54 37.46495 38.0 38.0 38.0 37.2 38.0 55-59 37.400600000000004 38.0 38.0 38.0 37.0 38.0 60-64 37.3587 38.0 38.0 38.0 37.0 38.0 65-69 37.28685 38.0 38.0 38.0 37.0 38.0 70-74 37.276650000000004 38.0 38.0 38.0 37.0 38.0 75-79 37.21975 38.0 38.0 38.0 36.6 38.0 80-84 37.1611 38.0 38.0 38.0 36.4 38.0 85-89 37.055150000000005 38.0 38.0 38.0 36.0 38.0 90-94 37.0244 38.0 38.0 38.0 36.0 38.0 95-99 36.94605 38.0 38.0 38.0 36.0 38.0 100-104 36.8116 38.0 38.0 38.0 35.4 38.0 105-109 36.742200000000004 38.0 38.0 38.0 35.0 38.0 110-114 36.6078 38.0 38.0 38.0 34.6 38.0 115-119 36.4887 38.0 38.0 38.0 34.0 38.0 120-124 36.4024 38.0 38.0 38.0 34.0 38.0 125-129 36.24335 38.0 38.0 38.0 33.8 38.0 130-134 35.9677 38.0 37.4 38.0 33.0 38.0 135-139 35.67315000000001 38.0 36.8 38.0 32.2 38.0 140-144 35.4493 38.0 36.0 38.0 31.2 38.0 145-149 35.01955 38.0 36.0 38.0 30.4 38.0 150-151 32.181 36.5 33.5 38.0 16.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 0.0 8 1.0 9 0.0 10 0.0 11 0.0 12 0.0 13 1.0 14 2.0 15 1.0 16 0.0 17 3.0 18 2.0 19 2.0 20 2.0 21 4.0 22 3.0 23 7.0 24 5.0 25 6.0 26 7.0 27 11.0 28 26.0 29 32.0 30 29.0 31 49.0 32 45.0 33 61.0 34 91.0 35 219.0 36 582.0 37 2808.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 20.635761589403973 12.980132450331125 27.39072847682119 38.99337748344371 2 20.375 18.3 38.275 23.05 3 18.625 24.325 28.1 28.95 4 23.525 30.55 23.1 22.825 5 22.650000000000002 33.300000000000004 25.6 18.45 6 18.609304652326163 33.19159579789895 27.163581790895446 21.03551775887944 7 14.224999999999998 22.85 44.0 18.925 8 18.45 22.85 31.55 27.150000000000002 9 19.325 22.7 31.85 26.125 10-14 20.625 28.42 26.875 24.08 15-19 20.419999999999998 27.565 27.815 24.2 20-24 20.06 28.01 28.13 23.799999999999997 25-29 20.72 28.134999999999998 28.194999999999997 22.95 30-34 20.27 26.97 28.865000000000002 23.895 35-39 20.674999999999997 27.915 27.905 23.505000000000003 40-44 19.72 28.625 27.525 24.13 45-49 20.86 28.005000000000003 27.415 23.72 50-54 20.955 27.61 27.445000000000004 23.990000000000002 55-59 20.18 27.150000000000002 28.470000000000002 24.2 60-64 20.665 27.205000000000002 27.700000000000003 24.43 65-69 20.415 27.435 28.24 23.91 70-74 20.794999999999998 27.625 27.855 23.724999999999998 75-79 20.555 27.915 27.3 24.23 80-84 20.685000000000002 27.375 27.815 24.125 85-89 20.72 27.944999999999997 27.72 23.615 90-94 21.04 28.065 27.339999999999996 23.555 95-99 20.385 27.505000000000003 28.235 23.875 100-104 21.23 27.250000000000004 27.88 23.64 105-109 21.085 27.275 27.744999999999997 23.895 110-114 21.185000000000002 27.96 27.065 23.79 115-119 21.625 27.389999999999997 27.35 23.635 120-124 21.205 28.15 26.8 23.845 125-129 21.310000000000002 27.689999999999998 27.245 23.755000000000003 130-134 21.404999999999998 28.065 27.26 23.27 135-139 21.584999999999997 27.810000000000002 26.955000000000002 23.65 140-144 21.78 28.18 26.779999999999998 23.26 145-149 21.725 28.075 26.284999999999997 23.915 150-151 21.40623045164519 27.361441261103465 27.073689478293506 24.15863880895784 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 1.0 19 1.0 20 1.0 21 1.5 22 2.0 23 1.5 24 2.5 25 4.5 26 3.5 27 3.5 28 8.0 29 14.5 30 19.5 31 24.0 32 26.0 33 28.5 34 42.0 35 67.5 36 90.0 37 96.0 38 115.5 39 151.0 40 186.0 41 232.5 42 249.5 43 265.5 44 268.5 45 267.0 46 279.5 47 248.0 48 217.0 49 194.0 50 166.5 51 145.0 52 121.5 53 101.5 54 84.0 55 59.5 56 40.0 57 32.5 58 29.0 59 25.0 60 20.5 61 18.0 62 14.0 63 7.5 64 5.0 65 5.5 66 4.5 67 1.5 68 1.5 69 1.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 5.625 2 0.0 3 0.0 4 0.0 5 0.0 6 0.05 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.08750000000000001 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62358845671268 99.25 2 0.37641154328732745 0.75 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.0625 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88-89 0.2 0.0 0.0 0.0 0.0 90-91 0.2 0.0 0.0 0.0 0.0 92-93 0.2 0.0 0.0 0.0 0.0 94-95 0.2 0.0 0.0 0.0 0.0 96-97 0.225 0.0 0.0 0.0 0.0 98-99 0.25 0.0 0.0 0.0 0.0 100-101 0.3125 0.0 0.0 0.0 0.0 102-103 0.38749999999999996 0.0 0.0 0.0 0.0 104-105 0.525 0.0 0.0 0.0 0.0 106-107 0.7 0.0 0.0 0.0 0.0 108-109 0.8625 0.0 0.0 0.0 0.0 110-111 1.025 0.0 0.0 0.0 0.0 112-113 1.25 0.0 0.0 0.0 0.0 114-115 1.4125 0.0 0.0 0.0 0.0 116-117 1.5625 0.0 0.0 0.0 0.0 118-119 1.85 0.0 0.0 0.0 0.0 120-121 2.1375 0.0 0.0 0.0 0.0 122-123 2.3875 0.0 0.0 0.0 0.0 124-125 2.8 0.0 0.0 0.0 0.0 126-127 3.05 0.0 0.0 0.0 0.0 128-129 3.2875 0.0 0.0 0.0 0.0 130-131 3.5250000000000004 0.0 0.0 0.0 0.0 132-133 3.9625000000000004 0.0 0.0 0.0 0.0 134-135 4.3875 0.0 0.0 0.0 0.0 136-137 4.75 0.0 0.0 0.0 0.0 138-139 5.275 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACAATCT 10 0.0068378756 144.95 145 >>END_MODULE SRR7180096 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7180096_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.928 33.0 33.0 34.0 32.0 34.0 2 33.2155 34.0 33.0 34.0 33.0 34.0 3 33.2215 34.0 33.0 34.0 33.0 34.0 4 33.21225 34.0 33.0 34.0 33.0 34.0 5 33.1955 34.0 33.0 34.0 33.0 34.0 6 37.351 38.0 38.0 38.0 38.0 38.0 7 37.404 38.0 38.0 38.0 38.0 38.0 8 37.36525 38.0 38.0 38.0 38.0 38.0 9 37.26975 38.0 38.0 38.0 38.0 38.0 10-14 37.34595 38.0 38.0 38.0 38.0 38.0 15-19 37.2918 38.0 38.0 38.0 37.6 38.0 20-24 37.2528 38.0 38.0 38.0 37.2 38.0 25-29 37.31335 38.0 38.0 38.0 37.6 38.0 30-34 37.278749999999995 38.0 38.0 38.0 37.4 38.0 35-39 37.190149999999996 38.0 38.0 38.0 37.0 38.0 40-44 37.186899999999994 38.0 38.0 38.0 37.0 38.0 45-49 37.23795 38.0 38.0 38.0 37.0 38.0 50-54 37.15925 38.0 38.0 38.0 37.0 38.0 55-59 37.1306 38.0 38.0 38.0 37.0 38.0 60-64 37.03225 38.0 38.0 38.0 36.6 38.0 65-69 36.973650000000006 38.0 38.0 38.0 36.2 38.0 70-74 36.9762 38.0 38.0 38.0 36.6 38.0 75-79 36.92175 38.0 38.0 38.0 36.0 38.0 80-84 36.8689 38.0 38.0 38.0 36.0 38.0 85-89 36.703250000000004 38.0 38.0 38.0 35.8 38.0 90-94 36.622949999999996 38.0 38.0 38.0 35.0 38.0 95-99 36.59805 38.0 38.0 38.0 35.0 38.0 100-104 36.416 38.0 38.0 38.0 34.4 38.0 105-109 36.34054999999999 38.0 38.0 38.0 34.0 38.0 110-114 36.28685 38.0 38.0 38.0 34.0 38.0 115-119 36.05285 38.0 38.0 38.0 33.8 38.0 120-124 35.948750000000004 38.0 37.6 38.0 33.4 38.0 125-129 35.60695 38.0 37.0 38.0 31.6 38.0 130-134 35.448 38.0 36.4 38.0 31.0 38.0 135-139 35.216150000000006 38.0 36.0 38.0 31.0 38.0 140-144 34.88439999999999 38.0 35.8 38.0 28.8 38.0 145-149 34.32395 38.0 35.4 38.0 26.4 38.0 150-151 30.831875 36.5 30.0 38.0 8.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 8.0 3 5.0 4 1.0 5 0.0 6 1.0 7 4.0 8 0.0 9 0.0 10 2.0 11 1.0 12 1.0 13 2.0 14 1.0 15 2.0 16 5.0 17 1.0 18 3.0 19 3.0 20 3.0 21 6.0 22 6.0 23 11.0 24 6.0 25 11.0 26 18.0 27 25.0 28 18.0 29 23.0 30 40.0 31 42.0 32 41.0 33 73.0 34 99.0 35 206.0 36 534.0 37 2798.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.91346877351392 14.597441685477802 18.1840983195385 32.30499122146978 2 23.911955977988995 21.5607803901951 36.16808404202101 18.3591795897949 3 20.860430215107552 25.812906453226613 31.765882941470736 21.5607803901951 4 24.15 32.275 22.675 20.9 5 23.9 35.55 23.225 17.325 6 19.125 36.375 24.15 20.349999999999998 7 16.825000000000003 17.375 44.574999999999996 21.224999999999998 8 20.375 23.05 28.65 27.925 9 21.45 26.025 28.4 24.125 10-14 23.615 27.16 26.71 22.515 15-19 23.31 27.67 27.74 21.279999999999998 20-24 23.27 28.194999999999997 26.875 21.66 25-29 23.345 28.49 26.939999999999998 21.224999999999998 30-34 23.170792698174544 28.66216554138535 26.936734183545884 21.230307576894223 35-39 23.248949369621773 27.966780068040826 27.62157294376626 21.162697618571144 40-44 22.986090263184227 28.124687281096765 27.604323026118283 21.28489942960072 45-49 22.93 27.694999999999997 27.544999999999998 21.83 50-54 23.630000000000003 27.27 27.625 21.475 55-59 23.57 27.58 27.375 21.475 60-64 23.445 27.18 28.194999999999997 21.18 65-69 23.535 27.61 26.950000000000003 21.905 70-74 23.435 27.97 27.07 21.525 75-79 23.385 27.73 27.57 21.315 80-84 24.09 27.98 26.685 21.245 85-89 23.87 27.839999999999996 27.560000000000002 20.73 90-94 23.755000000000003 28.294999999999998 26.529999999999998 21.42 95-99 24.135 27.279999999999998 27.16 21.425 100-104 23.715 28.04 27.465 20.78 105-109 23.18 28.175 27.54 21.105 110-114 23.97 27.689999999999998 27.24 21.099999999999998 115-119 23.815 27.93 27.165 21.09 120-124 23.995 27.555000000000003 26.889999999999997 21.560000000000002 125-129 24.215 28.660000000000004 26.855 20.27 130-134 24.765 27.965 27.295 19.975 135-139 24.834999999999997 28.194999999999997 26.540000000000003 20.43 140-144 24.834999999999997 28.53 26.939999999999998 19.695 145-149 25.314999999999998 27.915 26.369999999999997 20.4 150-151 25.269626285427638 28.053674441936295 26.699272636067217 19.977426636568847 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 1.0 23 1.5 24 1.5 25 2.0 26 2.5 27 4.5 28 5.5 29 5.0 30 7.5 31 12.5 32 19.0 33 30.0 34 37.5 35 48.0 36 65.5 37 78.0 38 117.5 39 150.5 40 185.5 41 234.5 42 259.5 43 280.5 44 288.0 45 281.0 46 265.0 47 247.0 48 228.0 49 201.0 50 178.0 51 150.5 52 115.0 53 96.0 54 80.5 55 61.0 56 52.5 57 45.0 58 37.5 59 28.5 60 24.0 61 21.5 62 15.5 63 10.5 64 5.5 65 5.5 66 4.5 67 2.5 68 1.5 69 0.5 70 1.0 71 1.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.325 2 0.05 3 0.05 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.025 35-39 0.06 40-44 0.06999999999999999 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.325 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.325 #Duplication Level Percentage of deduplicated Percentage of total 1 99.49660206393153 98.825 2 0.4278882456581928 0.8500000000000001 3 0.025169896803423106 0.075 4 0.0 0.0 5 0.05033979360684621 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTTTGAGAGTGCATAGATTTGTGTTGATATAGAAAACAATGGCACTACAT 5 0.125 No Hit TTTGTGTTGATATAGAAAACAATGGCACTACATGGAAAGATTGAGACAAC 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.175 0.0 0.0 0.0 0.0 92-93 0.175 0.0 0.0 0.0 0.0 94-95 0.175 0.0 0.0 0.0 0.0 96-97 0.2 0.0 0.0 0.0 0.0 98-99 0.225 0.0 0.0 0.0 0.0 100-101 0.2875 0.0 0.0 0.0 0.0 102-103 0.36250000000000004 0.0 0.0 0.0 0.0 104-105 0.5 0.0 0.0 0.0 0.0 106-107 0.675 0.0 0.0 0.0 0.0 108-109 0.8375 0.0 0.0 0.0 0.0 110-111 1.0 0.0 0.0 0.0 0.0 112-113 1.225 0.0 0.0 0.0 0.0 114-115 1.375 0.0 0.0 0.0 0.0 116-117 1.5125000000000002 0.0 0.0 0.0 0.0 118-119 1.8 0.0 0.0 0.0 0.0 120-121 2.0875000000000004 0.0 0.0 0.0 0.0 122-123 2.3375 0.0 0.0 0.0 0.0 124-125 2.775 0.0 0.0 0.0 0.0 126-127 3.0250000000000004 0.0 0.0 0.0 0.0 128-129 3.2625 0.0 0.0 0.0 0.0 130-131 3.5250000000000004 0.0 0.0 0.0 0.0 132-133 3.9375 0.0 0.0 0.0 0.0 134-135 4.4125 0.0 0.0 0.0 0.0 136-137 4.775 0.0 0.0 0.0 0.0 138-139 5.300000000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAGTGTA 10 0.006577216 146.82278 145 AACTGGC 10 0.006832588 144.9875 5 TGGACTT 25 8.716269E-4 86.9925 4 >>END_MODULE Read 816516 spots for SRR7180096.sra Written 816516 spots for SRR7180096.sra Read 816516 spots for SRR7180096.sra Written 816516 spots for SRR7180096.sra Read 816516 spots for SRR7180096.sra Written 816516 spots for SRR7180096.sra Read 816516 spots for SRR7180096.sra Written 816516 spots for SRR7180096.sra Read 816516 spots for SRR7180096.sra Written 816516 spots for SRR7180096.sra Read 816516 spots for SRR7180096.sra Written 816516 spots for SRR7180096.sra Read 816516 spots for SRR7180096.sra Written 816516 spots for SRR7180096.sra Read 816516 spots for SRR7180096.sra Written 816516 spots for SRR7180096.sra Read 816516 spots for SRR7180096.sra Written 816516 spots for SRR7180096.sra Read 816516 spots for SRR7180096.sra Written 816516 spots for SRR7180096.sra Read 816516 spots for SRR7180096.sra Written 816516 spots for SRR7180096.sra Read 816516 spots for SRR7180096.sra Written 816516 spots for SRR7180096.sra Read 816516 spots for SRR7180096.sra Written 816516 spots for SRR7180096.sra Read 816516 spots for SRR7180096.sra Written 816516 spots for SRR7180096.sra Read 816516 spots for SRR7180096.sra Written 816516 spots for SRR7180096.sra Read 816516 spots for SRR7180096.sra Written 816516 spots for SRR7180096.sra Read 816516 spots for SRR7180096.sra Written 816516 spots for SRR7180096.sra Read 816516 spots for SRR7180096.sra Written 816516 spots for SRR7180096.sra Read 816516 spots for SRR7180096.sra Written 816516 spots for SRR7180096.sra Read 816516 spots for SRR7180096.sra Written 816516 spots for SRR7180096.sra SRR ids: ['SRR7180096.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_dqs7pxu3 SRR7180096.sra spots: 16330320 blocks: [[1, 816516], [816517, 1633032], [1633033, 2449548], [2449549, 3266064], [3266065, 4082580], [4082581, 4899096], [4899097, 5715612], [5715613, 6532128], [6532129, 7348644], [7348645, 8165160], [8165161, 8981676], [8981677, 9798192], [9798193, 10614708], [10614709, 11431224], [11431225, 12247740], [12247741, 13064256], [13064257, 13880772], [13880773, 14697288], [14697289, 15513804], [15513805, 16330320]] SRR7180096 file size 5512109 SRR7180096 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7180096 SRR7180096_1.fastq SRR7180096_2.fastq Input file: SRR7180096_1.fastq Paired file: SRR7180096_2.fastq trimmed: SRR7180096-trimmed-pair1.fastq, SRR7180096-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 18:55:47 2025 >> started Mon Feb 10 18:56:04 2025 >> done (16.894s) 16330320 read pairs processed; of these: 18704 ( 0.11%) short read pairs filtered out after trimming by size control 13902 ( 0.09%) empty read pairs filtered out after trimming by size control 16297714 (99.80%) read pairs available; of these: 5963292 (36.59%) trimmed read pairs available after processing 10334422 (63.41%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 6 0.00% 20 2 0.00% 21 2 0.00% 22 3 0.00% 23 3 0.00% 24 7 0.00% 25 3 0.00% 26 9 0.00% 27 4 0.00% 28 4 0.00% 29 10 0.00% 30 6 0.00% 31 4 0.00% 32 2 0.00% 33 3 0.00% 34 5 0.00% 35 7 0.00% 36 9 0.00% 37 16 0.00% 38 10 0.00% 39 45 0.00% 40 14 0.00% 41 6 0.00% 42 18 0.00% 43 11 0.00% 44 15 0.00% 45 43 0.00% 46 13 0.00% 47 15 0.00% 48 17 0.00% 49 25 0.00% 50 40 0.00% 51 19 0.00% 52 37 0.00% 53 57 0.00% 54 56 0.00% 55 92 0.00% 56 112 0.00% 57 60 0.00% 58 75 0.00% 59 55 0.00% 60 73 0.00% 61 115 0.00% 62 179 0.00% 63 147 0.00% 64 148 0.00% 65 155 0.00% 66 145 0.00% 67 175 0.00% 68 239 0.00% 69 227 0.00% 70 270 0.00% 71 348 0.00% 72 406 0.00% 73 440 0.00% 74 521 0.00% 75 607 0.00% 76 758 0.00% 77 800 0.00% 78 1014 0.01% 79 1159 0.01% 80 1143 0.01% 81 1273 0.01% 82 1622 0.01% 83 1849 0.01% 84 2782 0.02% 85 3552 0.02% 86 3946 0.02% 87 4656 0.03% 88 4788 0.03% 89 5044 0.03% 90 5326 0.03% 91 5562 0.03% 92 5817 0.04% 93 6071 0.04% 94 6609 0.04% 95 6848 0.04% 96 7371 0.05% 97 7884 0.05% 98 8370 0.05% 99 8863 0.05% 100 9245 0.06% 101 9957 0.06% 102 10766 0.07% 103 11348 0.07% 104 11792 0.07% 105 12893 0.08% 106 13672 0.08% 107 14602 0.09% 108 15637 0.10% 109 16211 0.10% 110 16963 0.10% 111 17907 0.11% 112 18961 0.12% 113 20073 0.12% 114 21120 0.13% 115 22256 0.14% 116 23349 0.14% 117 24135 0.15% 118 25854 0.16% 119 27261 0.17% 120 29232 0.18% 121 31023 0.19% 122 30120 0.18% 123 31041 0.19% 124 32839 0.20% 125 34210 0.21% 126 35705 0.22% 127 37037 0.23% 128 38439 0.24% 129 40045 0.25% 130 42283 0.26% 131 43467 0.27% 132 46318 0.28% 133 48290 0.30% 134 49946 0.31% 135 52083 0.32% 136 54569 0.33% 137 57312 0.35% 138 60962 0.37% 139 64272 0.39% 140 68499 0.42% 141 73980 0.45% 142 80039 0.49% 143 87303 0.54% 144 98498 0.60% 145 110512 0.68% 146 130163 0.80% 147 169225 1.04% 148 249304 1.53% 149 495234 3.04% 150 3089097 18.95% 151 10334422 63.41% 16297714 reads passed initial QC criterion=sequence-density sequence-density=0.27 sequence-density-rank=1 fanout-score=2.41 fanout-score-rank=28 prefix-density=0.30 prefix-fanout=2.2 sequence=CAGGTGCAGTTTGATCCACACTTGCAGCCATTCTCAGCACC criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=127.27 fanout-score-rank=1 prefix-density=0.15 prefix-fanout=11.7 sequence=CAACAACTTCCCTATCTTTAATCCTCTCACTCCACAAATTCATAAGCTTCACCATTTTACTTCACCAATTCCTTAGAGATGTAATAGCCCATAACAATAGGAAATATCAGAAATCCAATAAGAATCAGCAATTCAGGAAGAAATATGACAAGGAGTAGTAGTGTGGATGTTGTTGTTAGACACTTCTTTTTGTCTTTAAATATAAGGCGTGGTAGAATTACTGGCACTCCAATGATTCCATATAACGGCCATAATGGAGCTATAGAATACAACACCAACGTCGCAAAAAACCAGCAAAAATTCTTAACATTATTTTTAGAAATCCCATACTGCCACCGAATATTCAGTCCTTTAAGAAATCGAACAGCATACCCAACATAGTAAAAACCATCAATAATGCAAATACCGTTACCACAAGTGCAAA criterion=sequence-density sequence-density=0.40 sequence-density-rank=1 fanout-score=2.56 fanout-score-rank=33 prefix-density=0.42 prefix-fanout=2.5 sequence=ATGTACCCTGACTTAGGTTTCTCAGA criterion=fanout-score sequence-density=0.06 sequence-density-rank=32 fanout-score=25.75 fanout-score-rank=1 prefix-density=0.21 prefix-fanout=7.1 sequence=GTGATTTTGATTTTGACCCATGTGGTTACTCTATGAATGCCATTGAAGGGAGTGCAATTTCCACAATCCACGTCACTCCAGAAGATGGTTTCAGCTATGCAAGTTTTGAGGCTGTGGGCTATGATCTTCAAGATTTGAATTTGAGTCGGCTGCTTGAAAGGGTCTTGGCTTGCTTTGAACCGACCATGTTCTCCGTTGCCTTGCATTCTAATATCAAGGGTGCCGAACTTAGAGCAAAGTTTCCCCTGGACGTGGAAGGTTACTCTGGCGGAGGAGGGAACTATGAAATGCTTGGGAAAGGTGGATCGATCATCTACCACAGCTTTGCAAGGACTGGAGGCAGTGCATCTCCCAGGTCTATCCTGAAATGTTGTTGGAGTGAGGATGAGAAGGACGAGGAAGCTGAAGAGAAGTAGTTCTTTTCAGC SRR7180096 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 18:57:01 Started mapping on | Feb 10 18:57:01 Finished on | Feb 10 19:01:05 Mapping speed, Million of reads per hour | 240.46 Number of input reads | 16297714 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 14056000 Uniquely mapped reads % | 86.25% Average mapped length | 295.61 Number of splices: Total | 13426129 Number of splices: Annotated (sjdb) | 13160711 Number of splices: GT/AG | 13198369 Number of splices: GC/AG | 176486 Number of splices: AT/AC | 11328 Number of splices: Non-canonical | 39946 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.03% Deletion average length | 2.61 Insertion rate per base | 0.02% Insertion average length | 2.54 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 418025 % of reads mapped to multiple loci | 2.56% Number of reads mapped to too many loci | 72774 % of reads mapped to too many loci | 0.45% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 10.60% % of reads unmapped: other | 0.14% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1840612 1840612 1840612 N_multimapping 418025 418025 418025 N_noFeature 350375 13931430 406504 N_ambiguous 164529 1297 95036 UnstrandedReadsAssigned:13541096 PositiveStrandReadsAssigned:123273 NegativeStrandReadsAssigned:13554460 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7180096 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7180096-trimmed-pair1.fastq SRR7180096-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,297,714 reads, 13,543,990 reads pseudoaligned [quant] estimated average fragment length: 237.624 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,038 rounds 52401 SRR7180096.ke.tsv 34699 SRR7180096.se.tsv 87100 total ==> SRR7180096.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1781.38 1913 77.255 Potri.005G024800.1.v4.1 1035 798.376 707 63.7058 Potri.004G059700.1.v4.1 961 724.403 6 0.595851 Potri.007G009000.2.v4.1 1416 1179.38 0 0 Potri.003G141000.2.v4.1 2943 2706.38 452.233 12.021 Potri.016G087400.1.v4.1 270 78.0289 483 445.306 Potri.015G069301.1.v4.1 564 330.333 0 0 Potri.010G195200.1.v4.1 1773 1536.38 554 25.9406 Potri.012G127500.1.v4.1 977 740.393 14456 1404.6 ==> SRR7180096.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 10 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 426 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 496 SRR7180096 completed mapping pipeline successfully