Starting /dee2/code/volunteer_pipeline.sh SRR7180097 current disk space = 2818986946560 free memory = 1578697908 SRR7180097 SRAfilesize b17ee0dd6f1946bcaa4e76f001ec8b43 SRR7180097.sra SRR7180097.sra file validated SRR7180097 is paired end SRR7180097 is conventional basespace SRR7180097 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7180097_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 21.22075 18.0 18.0 27.0 18.0 32.0 2 23.233 18.0 18.0 29.0 18.0 31.0 3 27.8495 29.0 27.0 31.0 25.0 33.0 4 31.05675 32.0 32.0 33.0 27.0 33.0 5 32.24025 33.0 32.0 33.0 32.0 33.0 6 36.90475 38.0 37.0 38.0 35.0 38.0 7 37.4115 38.0 38.0 38.0 37.0 38.0 8 37.47475 38.0 38.0 38.0 37.0 38.0 9 37.58925 38.0 38.0 38.0 38.0 38.0 10-14 37.65855 38.0 38.0 38.0 38.0 38.0 15-19 37.660399999999996 38.0 38.0 38.0 38.0 38.0 20-24 37.6802 38.0 38.0 38.0 38.0 38.0 25-29 37.67155 38.0 38.0 38.0 38.0 38.0 30-34 37.6363 38.0 38.0 38.0 38.0 38.0 35-39 37.62835 38.0 38.0 38.0 38.0 38.0 40-44 37.60885 38.0 38.0 38.0 38.0 38.0 45-49 37.6091 38.0 38.0 38.0 38.0 38.0 50-54 37.568 38.0 38.0 38.0 38.0 38.0 55-59 37.5038 38.0 38.0 38.0 37.6 38.0 60-64 37.533300000000004 38.0 38.0 38.0 38.0 38.0 65-69 37.4178 38.0 38.0 38.0 37.0 38.0 70-74 37.376400000000004 38.0 38.0 38.0 37.0 38.0 75-79 37.301050000000004 38.0 38.0 38.0 37.0 38.0 80-84 37.263200000000005 38.0 38.0 38.0 37.0 38.0 85-89 37.2165 38.0 38.0 38.0 36.8 38.0 90-94 37.19515 38.0 38.0 38.0 36.4 38.0 95-99 37.1728 38.0 38.0 38.0 36.0 38.0 100-104 37.06585 38.0 38.0 38.0 36.0 38.0 105-109 36.94175 38.0 38.0 38.0 36.0 38.0 110-114 36.782050000000005 38.0 38.0 38.0 35.0 38.0 115-119 36.78775 38.0 38.0 38.0 35.0 38.0 120-124 36.6317 38.0 38.0 38.0 34.8 38.0 125-129 36.546949999999995 38.0 38.0 38.0 34.4 38.0 130-134 36.3086 38.0 38.0 38.0 34.0 38.0 135-139 36.12005 38.0 37.6 38.0 33.2 38.0 140-144 35.9892 38.0 37.2 38.0 33.0 38.0 145-149 35.70165 38.0 36.0 38.0 32.8 38.0 150-151 32.624875 37.0 33.5 38.0 16.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 1.0 10 0.0 11 0.0 12 1.0 13 1.0 14 0.0 15 1.0 16 1.0 17 1.0 18 2.0 19 2.0 20 2.0 21 2.0 22 4.0 23 1.0 24 4.0 25 3.0 26 6.0 27 8.0 28 14.0 29 20.0 30 21.0 31 25.0 32 32.0 33 72.0 34 118.0 35 206.0 36 614.0 37 2838.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 24.65825446898002 20.136698212407993 13.459516298633018 41.74553101997897 2 17.75 19.075 36.975 26.200000000000003 3 18.45 23.175 26.650000000000002 31.724999999999998 4 21.349999999999998 30.275000000000002 22.85 25.525 5 21.625 30.975 26.424999999999997 20.974999999999998 6 18.075 33.775 27.275 20.875 7 13.725000000000001 26.55 41.5 18.224999999999998 8 17.675 25.324999999999996 32.95 24.05 9 17.075000000000003 25.624999999999996 34.699999999999996 22.6 10-14 18.995 31.035 27.32 22.650000000000002 15-19 19.29 29.925 27.605 23.18 20-24 18.72 30.035 28.255000000000003 22.99 25-29 19.415 29.45 27.765 23.369999999999997 30-34 19.259999999999998 29.86 27.805000000000003 23.075000000000003 35-39 19.255 29.42 27.889999999999997 23.435 40-44 19.134999999999998 30.165 27.089999999999996 23.61 45-49 19.525000000000002 29.770000000000003 27.04 23.665 50-54 19.925 29.475 27.12 23.48 55-59 19.09 29.56 27.644999999999996 23.705000000000002 60-64 19.16 29.09 27.605 24.145 65-69 19.25 28.845 27.894999999999996 24.01 70-74 19.85 28.860000000000003 27.465 23.825 75-79 19.705000000000002 28.794999999999998 27.87 23.630000000000003 80-84 20.02 28.835 27.37 23.775 85-89 20.005 28.27 28.389999999999997 23.335 90-94 19.955000000000002 28.15 27.905 23.990000000000002 95-99 20.275000000000002 28.075 27.965 23.685000000000002 100-104 20.1 28.78 27.255000000000003 23.865 105-109 19.97 28.494999999999997 27.800000000000004 23.735 110-114 20.599999999999998 28.63 27.04 23.73 115-119 20.405 29.185 26.845000000000002 23.565 120-124 20.315 28.544999999999998 27.395000000000003 23.745 125-129 20.919999999999998 28.27 27.224999999999998 23.585 130-134 21.060000000000002 28.249999999999996 27.334999999999997 23.355 135-139 21.195 28.515 26.735 23.555 140-144 20.845 28.28 27.365000000000002 23.51 145-149 21.365000000000002 28.115000000000002 26.575 23.945 150-151 20.95583635681221 28.5124483923433 26.348054547729262 24.183660703115226 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 3.0 1 1.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.5 16 0.5 17 0.0 18 0.0 19 0.5 20 1.0 21 0.5 22 1.5 23 2.0 24 1.5 25 4.0 26 9.5 27 15.0 28 17.0 29 19.0 30 24.5 31 35.5 32 53.5 33 69.0 34 78.5 35 95.0 36 116.5 37 129.5 38 148.5 39 174.5 40 187.5 41 198.0 42 221.0 43 242.0 44 257.5 45 275.0 46 280.5 47 249.5 48 207.0 49 183.5 50 167.0 51 141.5 52 103.0 53 68.5 54 52.0 55 44.0 56 35.0 57 26.5 58 16.5 59 10.5 60 7.5 61 6.5 62 5.0 63 3.0 64 2.5 65 1.0 66 1.5 67 1.5 68 0.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.5 74 0.5 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.9 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.08750000000000001 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67385850476668 99.325 2 0.3010536879076769 0.6 3 0.025087807325639738 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.0875 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1125 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.1875 0.0 0.0 0.0 0.0 88-89 0.25 0.0 0.0 0.0 0.0 90-91 0.35 0.0 0.0 0.0 0.0 92-93 0.4875 0.0 0.0 0.0 0.0 94-95 0.575 0.0 0.0 0.0 0.0 96-97 0.625 0.0 0.0 0.0 0.0 98-99 0.8 0.0 0.0 0.0 0.0 100-101 0.925 0.0 0.0 0.0 0.0 102-103 1.1875 0.0 0.0 0.0 0.0 104-105 1.275 0.0 0.0 0.0 0.0 106-107 1.5 0.0 0.0 0.0 0.0 108-109 1.7999999999999998 0.0 0.0 0.0 0.0 110-111 2.0 0.0 0.0 0.0 0.0 112-113 2.3375 0.0 0.0 0.0 0.0 114-115 2.7125 0.0 0.0 0.0 0.0 116-117 3.125 0.0 0.0 0.0 0.0 118-119 3.4625 0.0 0.0 0.0 0.0 120-121 3.7625 0.0 0.0 0.0 0.0 122-123 4.2625 0.0 0.0 0.0 0.0 124-125 4.987500000000001 0.0 0.0 0.0 0.0 126-127 5.5125 0.0 0.0 0.0 0.0 128-129 6.0125 0.0 0.0 0.0 0.0 130-131 6.6 0.0 0.0 0.0 0.0 132-133 7.05 0.0 0.0 0.0 0.0 134-135 7.6875 0.0 0.0 0.0 0.0 136-137 8.4875 0.0 0.0 0.0 0.0 138-139 9.2375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTCAATT 10 0.0063298983 148.6923 1 TCCAACC 10 0.0068343505 144.975 2 TGTGTAT 10 0.0068343505 144.975 5 TTTTTTT 35 0.003540148 20.710714 55-59 >>END_MODULE SRR7180097 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7180097_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.9585 33.0 33.0 34.0 33.0 34.0 2 33.1345 34.0 33.0 34.0 33.0 34.0 3 33.168 34.0 33.0 34.0 33.0 34.0 4 33.19325 34.0 33.0 34.0 33.0 34.0 5 33.14225 34.0 33.0 34.0 33.0 34.0 6 37.32375 38.0 38.0 38.0 38.0 38.0 7 37.33775 38.0 38.0 38.0 38.0 38.0 8 37.3065 38.0 38.0 38.0 38.0 38.0 9 37.31425 38.0 38.0 38.0 38.0 38.0 10-14 37.314949999999996 38.0 38.0 38.0 38.0 38.0 15-19 37.23145 38.0 38.0 38.0 38.0 38.0 20-24 37.2755 38.0 38.0 38.0 38.0 38.0 25-29 37.335699999999996 38.0 38.0 38.0 38.0 38.0 30-34 37.297999999999995 38.0 38.0 38.0 37.8 38.0 35-39 37.2472 38.0 38.0 38.0 37.6 38.0 40-44 37.24400000000001 38.0 38.0 38.0 37.4 38.0 45-49 37.27995 38.0 38.0 38.0 37.8 38.0 50-54 37.227999999999994 38.0 38.0 38.0 37.2 38.0 55-59 37.19045 38.0 38.0 38.0 37.0 38.0 60-64 37.1356 38.0 38.0 38.0 37.0 38.0 65-69 37.041399999999996 38.0 38.0 38.0 37.0 38.0 70-74 37.1011 38.0 38.0 38.0 37.0 38.0 75-79 37.089800000000004 38.0 38.0 38.0 37.0 38.0 80-84 36.986700000000006 38.0 38.0 38.0 36.6 38.0 85-89 36.845150000000004 38.0 38.0 38.0 36.0 38.0 90-94 36.80135 38.0 38.0 38.0 36.0 38.0 95-99 36.798350000000006 38.0 38.0 38.0 36.0 38.0 100-104 36.56015 38.0 38.0 38.0 34.8 38.0 105-109 36.480650000000004 38.0 38.0 38.0 34.4 38.0 110-114 36.50575 38.0 38.0 38.0 35.0 38.0 115-119 36.4396 38.0 38.0 38.0 34.4 38.0 120-124 36.26075 38.0 38.0 38.0 34.0 38.0 125-129 35.99604999999999 38.0 37.8 38.0 33.6 38.0 130-134 35.80995 38.0 37.2 38.0 33.0 38.0 135-139 35.714549999999996 38.0 36.6 38.0 33.0 38.0 140-144 35.356899999999996 38.0 36.2 38.0 31.0 38.0 145-149 34.813599999999994 38.0 35.8 38.0 29.4 38.0 150-151 31.162625 36.5 31.0 38.0 13.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 12.0 3 3.0 4 3.0 5 0.0 6 0.0 7 1.0 8 2.0 9 3.0 10 2.0 11 1.0 12 0.0 13 2.0 14 0.0 15 3.0 16 1.0 17 2.0 18 2.0 19 5.0 20 1.0 21 3.0 22 2.0 23 3.0 24 14.0 25 7.0 26 10.0 27 16.0 28 17.0 29 17.0 30 35.0 31 25.0 32 44.0 33 72.0 34 111.0 35 186.0 36 428.0 37 2967.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.77705247301029 15.992970123022848 17.373838814963598 30.856138589003262 2 24.031007751937985 23.1807951987997 36.1090272568142 16.67916979244811 3 22.1055263815954 24.63115778944736 31.607901975493874 21.655413853463365 4 25.624999999999996 33.375 21.349999999999998 19.650000000000002 5 23.775 35.325 23.7 17.2 6 19.950000000000003 36.425000000000004 24.8 18.825 7 19.225 19.075 42.25 19.45 8 23.150000000000002 24.325 27.150000000000002 25.374999999999996 9 22.0 25.275 29.75 22.975 10-14 24.5 28.015 25.775 21.709999999999997 15-19 23.94 28.32 27.169999999999998 20.57 20-24 23.735 28.285 27.26 20.72 25-29 23.485 28.735 27.650000000000002 20.13 30-34 23.35116755837792 28.061403070153506 28.181409070453523 20.40602030101505 35-39 24.0748149629926 27.410482096419287 27.560512102420482 20.954190838167634 40-44 24.003401190416646 27.724703646276193 27.629670384634625 20.642224778672535 45-49 23.235 28.76 27.29 20.715 50-54 23.59 28.325 27.595 20.49 55-59 23.86 27.735 27.625 20.78 60-64 24.154999999999998 28.215 27.295 20.335 65-69 23.735 28.395 27.450000000000003 20.419999999999998 70-74 24.03 28.09 27.400000000000002 20.48 75-79 23.755000000000003 27.644999999999996 28.115000000000002 20.485 80-84 24.03 27.24 27.834999999999997 20.895 85-89 24.33 27.750000000000004 27.41 20.51 90-94 23.745 28.449999999999996 28.044999999999998 19.759999999999998 95-99 23.86 27.66 28.065 20.415 100-104 24.115000000000002 28.139999999999997 27.534999999999997 20.21 105-109 24.25 27.825 28.365000000000002 19.56 110-114 24.435000000000002 27.665 27.415 20.485 115-119 24.39 27.77 28.265 19.575 120-124 24.565 27.665 27.965 19.805 125-129 24.39 28.465 27.555000000000003 19.59 130-134 24.64 27.935 27.744999999999997 19.68 135-139 25.014999999999997 27.855 28.110000000000003 19.02 140-144 25.235000000000003 28.53 26.884999999999998 19.35 145-149 26.125 28.01 27.665 18.2 150-151 26.75279066850621 27.317195534930388 26.81550232033112 19.114511476232284 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.0 21 0.0 22 1.0 23 2.0 24 1.5 25 3.5 26 3.0 27 1.5 28 5.5 29 7.0 30 8.5 31 12.0 32 20.0 33 32.5 34 43.5 35 52.5 36 60.0 37 83.0 38 118.5 39 149.0 40 184.5 41 216.5 42 256.5 43 308.0 44 316.5 45 302.0 46 291.0 47 269.5 48 234.0 49 205.5 50 181.5 51 147.5 52 111.0 53 91.5 54 74.0 55 48.5 56 40.5 57 29.5 58 17.0 59 17.0 60 15.5 61 7.5 62 6.0 63 5.5 64 3.5 65 2.0 66 1.5 67 2.5 68 2.0 69 1.0 70 0.5 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.42500000000000004 2 0.025 3 0.025 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.005 35-39 0.02 40-44 0.034999999999999996 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.3375 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67394030599448 99.35000000000001 2 0.32605969400551793 0.65 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.0875 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1125 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.1875 0.0 0.0 0.0 0.0 88-89 0.25 0.0 0.0 0.0 0.0 90-91 0.35 0.0 0.0 0.0 0.0 92-93 0.4875 0.0 0.0 0.0 0.0 94-95 0.575 0.0 0.0 0.0 0.0 96-97 0.625 0.0 0.0 0.0 0.0 98-99 0.8 0.0 0.0 0.0 0.0 100-101 0.9 0.0 0.0 0.0 0.0 102-103 1.1625 0.0 0.0 0.0 0.0 104-105 1.25 0.0 0.0 0.0 0.0 106-107 1.475 0.0 0.0 0.0 0.0 108-109 1.775 0.0 0.0 0.0 0.0 110-111 1.95 0.0 0.0 0.0 0.0 112-113 2.2875 0.0 0.0 0.0 0.0 114-115 2.6375 0.0 0.0 0.0 0.0 116-117 3.05 0.0 0.0 0.0 0.0 118-119 3.375 0.0 0.0 0.0 0.0 120-121 3.6624999999999996 0.0 0.0 0.0 0.0 122-123 4.1625 0.0 0.0 0.0 0.0 124-125 4.862500000000001 0.0 0.0 0.0 0.0 126-127 5.4 0.0 0.0 0.0 0.0 128-129 5.9125 0.0 0.0 0.0 0.0 130-131 6.449999999999999 0.0 0.0 0.0 0.0 132-133 6.9 0.0 0.0 0.0 0.0 134-135 7.5375 0.0 0.0 0.0 0.0 136-137 8.3375 0.0 0.0 0.0 0.0 138-139 9.100000000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAGGATT 10 0.006830828 145.0 8 TTGGAGG 10 0.006830828 145.0 6 GGAAAGT 10 0.006830828 145.0 1 CCCCCCC 85 2.0147776E-4 13.6470585 120-124 >>END_MODULE Read 686648 spots for SRR7180097.sra Written 686648 spots for SRR7180097.sra Read 686648 spots for SRR7180097.sra Written 686648 spots for SRR7180097.sra Read 686648 spots for SRR7180097.sra Written 686648 spots for SRR7180097.sra Read 686648 spots for SRR7180097.sra Written 686648 spots for SRR7180097.sra Read 686648 spots for SRR7180097.sra Written 686648 spots for SRR7180097.sra Read 686648 spots for SRR7180097.sra Written 686648 spots for SRR7180097.sra Read 686648 spots for SRR7180097.sra Written 686648 spots for SRR7180097.sra Read 686648 spots for SRR7180097.sra Written 686648 spots for SRR7180097.sra Read 686648 spots for SRR7180097.sra Written 686648 spots for SRR7180097.sra Read 686648 spots for SRR7180097.sra Written 686648 spots for SRR7180097.sra Read 686648 spots for SRR7180097.sra Written 686648 spots for SRR7180097.sra Read 686648 spots for SRR7180097.sra Written 686648 spots for SRR7180097.sra Read 686648 spots for SRR7180097.sra Written 686648 spots for SRR7180097.sra Read 686648 spots for SRR7180097.sra Written 686648 spots for SRR7180097.sra Read 686648 spots for SRR7180097.sra Written 686648 spots for SRR7180097.sra Read 686648 spots for SRR7180097.sra Written 686648 spots for SRR7180097.sra Read 686648 spots for SRR7180097.sra Written 686648 spots for SRR7180097.sra Read 686665 spots for SRR7180097.sra Written 686665 spots for SRR7180097.sra Read 686648 spots for SRR7180097.sra Written 686648 spots for SRR7180097.sra Read 686648 spots for SRR7180097.sra Written 686648 spots for SRR7180097.sra SRR ids: ['SRR7180097.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_qc9q4z9a SRR7180097.sra spots: 13732977 blocks: [[1, 686648], [686649, 1373296], [1373297, 2059944], [2059945, 2746592], [2746593, 3433240], [3433241, 4119888], [4119889, 4806536], [4806537, 5493184], [5493185, 6179832], [6179833, 6866480], [6866481, 7553128], [7553129, 8239776], [8239777, 8926424], [8926425, 9613072], [9613073, 10299720], [10299721, 10986368], [10986369, 11673016], [11673017, 12359664], [12359665, 13046312], [13046313, 13732977]] SRR7180097 file size 4631954 SRR7180097 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7180097 SRR7180097_1.fastq SRR7180097_2.fastq Input file: SRR7180097_1.fastq Paired file: SRR7180097_2.fastq trimmed: SRR7180097-trimmed-pair1.fastq, SRR7180097-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Apr 10 15:45:57 2025 >> started Thu Apr 10 15:48:37 2025 >> done (160.350s) 13732977 read pairs processed; of these: 24193 ( 0.18%) short read pairs filtered out after trimming by size control 19504 ( 0.14%) empty read pairs filtered out after trimming by size control 13689280 (99.68%) read pairs available; of these: 5408386 (39.51%) trimmed read pairs available after processing 8280894 (60.49%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 4 0.00% 20 3 0.00% 21 4 0.00% 22 11 0.00% 23 8 0.00% 24 7 0.00% 25 8 0.00% 26 7 0.00% 27 14 0.00% 28 6 0.00% 29 10 0.00% 30 13 0.00% 31 9 0.00% 32 10 0.00% 33 10 0.00% 34 9 0.00% 35 16 0.00% 36 7 0.00% 37 10 0.00% 38 24 0.00% 39 35 0.00% 40 12 0.00% 41 7 0.00% 42 15 0.00% 43 15 0.00% 44 18 0.00% 45 41 0.00% 46 24 0.00% 47 22 0.00% 48 22 0.00% 49 35 0.00% 50 42 0.00% 51 43 0.00% 52 29 0.00% 53 50 0.00% 54 47 0.00% 55 94 0.00% 56 145 0.00% 57 83 0.00% 58 93 0.00% 59 98 0.00% 60 111 0.00% 61 136 0.00% 62 199 0.00% 63 183 0.00% 64 192 0.00% 65 220 0.00% 66 244 0.00% 67 267 0.00% 68 357 0.00% 69 388 0.00% 70 445 0.00% 71 532 0.00% 72 630 0.00% 73 700 0.01% 74 832 0.01% 75 1014 0.01% 76 1242 0.01% 77 1324 0.01% 78 1538 0.01% 79 1751 0.01% 80 1858 0.01% 81 2099 0.02% 82 2386 0.02% 83 2745 0.02% 84 4169 0.03% 85 5177 0.04% 86 5695 0.04% 87 6365 0.05% 88 6885 0.05% 89 7394 0.05% 90 7723 0.06% 91 8302 0.06% 92 8498 0.06% 93 8952 0.07% 94 9754 0.07% 95 10499 0.08% 96 11298 0.08% 97 12009 0.09% 98 12863 0.09% 99 13604 0.10% 100 14523 0.11% 101 15316 0.11% 102 16074 0.12% 103 17114 0.13% 104 18195 0.13% 105 19525 0.14% 106 20622 0.15% 107 21963 0.16% 108 22861 0.17% 109 24572 0.18% 110 25467 0.19% 111 26798 0.20% 112 27901 0.20% 113 28802 0.21% 114 30552 0.22% 115 32182 0.24% 116 33140 0.24% 117 34362 0.25% 118 36247 0.26% 119 37692 0.28% 120 39951 0.29% 121 41408 0.30% 122 41422 0.30% 123 42617 0.31% 124 44947 0.33% 125 46103 0.34% 126 47488 0.35% 127 49365 0.36% 128 49935 0.36% 129 51804 0.38% 130 53612 0.39% 131 55147 0.40% 132 57320 0.42% 133 58788 0.43% 134 60951 0.45% 135 63312 0.46% 136 64287 0.47% 137 66438 0.49% 138 69007 0.50% 139 72082 0.53% 140 74113 0.54% 141 77336 0.56% 142 82038 0.60% 143 87822 0.64% 144 96023 0.70% 145 105144 0.77% 146 118700 0.87% 147 144425 1.06% 148 199220 1.46% 149 368385 2.69% 150 2313548 16.90% 151 8280894 60.49% 13689280 reads passed initial QC criterion=sequence-density sequence-density=0.29 sequence-density-rank=1 fanout-score=3.45 fanout-score-rank=31 prefix-density=0.40 prefix-fanout=2.5 sequence=CATCTCAGACCTCTCATAGAACATCTTAACTGGTGCAACACCTGCAATGATTGTCTCAGTTGTGGTGTTCTCTGAGAAACCTAAGTCAGGGTACATGCCACATTTGCA criterion=fanout-score sequence-density=0.07 sequence-density-rank=35 fanout-score=353.34 fanout-score-rank=1 prefix-density=0.73 prefix-fanout=31.7 sequence=TCTTCTTCTTCCT criterion=sequence-density sequence-density=0.31 sequence-density-rank=1 fanout-score=7.94 fanout-score-rank=11 prefix-density=0.46 prefix-fanout=5.3 sequence=GGTGCTGAGAATGGCTGCAAGTG criterion=fanout-score sequence-density=0.09 sequence-density-rank=22 fanout-score=140.62 fanout-score-rank=1 prefix-density=0.53 prefix-fanout=24.8 sequence=AGGAAGAAGAAGA SRR7180097 testing PE reads STAR mapping to Ensembl genome Started job on | Apr 10 15:49:52 Started mapping on | Apr 10 15:49:52 Finished on | Apr 10 15:51:11 Mapping speed, Million of reads per hour | 623.82 Number of input reads | 13689280 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 13003040 Uniquely mapped reads % | 94.99% Average mapped length | 292.38 Number of splices: Total | 11356067 Number of splices: Annotated (sjdb) | 11127252 Number of splices: GT/AG | 11168699 Number of splices: GC/AG | 139601 Number of splices: AT/AC | 9823 Number of splices: Non-canonical | 37944 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.04% Deletion average length | 2.60 Insertion rate per base | 0.02% Insertion average length | 2.51 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 352365 % of reads mapped to multiple loci | 2.57% Number of reads mapped to too many loci | 66061 % of reads mapped to too many loci | 0.48% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.88% % of reads unmapped: other | 0.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 356370 356370 356370 N_multimapping 352365 352365 352365 N_noFeature 321668 12854367 376892 N_ambiguous 151671 834 57821 UnstrandedReadsAssigned:12529701 PositiveStrandReadsAssigned:147839 NegativeStrandReadsAssigned:12568327 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7180097 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7180097-trimmed-pair1.fastq SRR7180097-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,689,280 reads, 12,520,408 reads pseudoaligned [quant] estimated average fragment length: 212.908 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,135 rounds 52401 SRR7180097.ke.tsv 34699 SRR7180097.se.tsv 87100 total ==> SRR7180097.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1806.09 897 32.9966 Potri.005G024800.1.v4.1 1035 823.092 256 20.6637 Potri.004G059700.1.v4.1 961 749.101 32 2.83809 Potri.007G009000.2.v4.1 1416 1204.09 0 0 Potri.003G141000.2.v4.1 2943 2731.09 269.131 6.54703 Potri.016G087400.1.v4.1 270 88.4881 1180 885.959 Potri.015G069301.1.v4.1 564 353.686 0 0 Potri.010G195200.1.v4.1 1773 1561.09 248 10.5545 Potri.012G127500.1.v4.1 977 765.096 4049 351.599 ==> SRR7180097.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 23 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 643 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 69 SRR7180097 completed mapping pipeline successfully