Starting /dee2/code/volunteer_pipeline.sh SRR7180098 current disk space = 3057320398848 free memory = 1444164448 SRR7180098 SRAfilesize 6a084f5c34dec7642e01dc6835ff544c SRR7180098.sra SRR7180098.sra file validated SRR7180098 is paired end SRR7180098 is conventional basespace SRR7180098 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7180098_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.0745 33.0 33.0 34.0 32.0 34.0 2 32.456 33.0 33.0 34.0 31.0 34.0 3 32.32175 33.0 33.0 33.0 30.0 34.0 4 31.96275 33.0 31.0 33.0 29.0 34.0 5 32.461 33.0 33.0 33.0 31.0 34.0 6 36.72875 38.0 37.0 38.0 34.0 38.0 7 37.4965 38.0 38.0 38.0 37.0 38.0 8 37.59475 38.0 38.0 38.0 37.0 38.0 9 37.65325 38.0 38.0 38.0 38.0 38.0 10-14 37.6814 38.0 38.0 38.0 38.0 38.0 15-19 37.660000000000004 38.0 38.0 38.0 38.0 38.0 20-24 37.6617 38.0 38.0 38.0 38.0 38.0 25-29 37.66590000000001 38.0 38.0 38.0 38.0 38.0 30-34 37.631 38.0 38.0 38.0 38.0 38.0 35-39 37.624900000000004 38.0 38.0 38.0 38.0 38.0 40-44 37.61325000000001 38.0 38.0 38.0 38.0 38.0 45-49 37.5846 38.0 38.0 38.0 38.0 38.0 50-54 37.5557 38.0 38.0 38.0 38.0 38.0 55-59 37.5711 38.0 38.0 38.0 38.0 38.0 60-64 37.513 38.0 38.0 38.0 38.0 38.0 65-69 37.4443 38.0 38.0 38.0 37.4 38.0 70-74 37.431 38.0 38.0 38.0 37.0 38.0 75-79 37.38525 38.0 38.0 38.0 37.2 38.0 80-84 37.34685 38.0 38.0 38.0 37.0 38.0 85-89 37.321 38.0 38.0 38.0 37.0 38.0 90-94 37.2702 38.0 38.0 38.0 37.0 38.0 95-99 37.21465 38.0 38.0 38.0 36.8 38.0 100-104 37.18655 38.0 38.0 38.0 36.6 38.0 105-109 37.03945 38.0 38.0 38.0 36.0 38.0 110-114 36.99 38.0 38.0 38.0 36.0 38.0 115-119 36.889149999999994 38.0 38.0 38.0 35.4 38.0 120-124 36.808299999999996 38.0 38.0 38.0 35.0 38.0 125-129 36.66505 38.0 38.0 38.0 35.0 38.0 130-134 36.46985 38.0 38.0 38.0 34.2 38.0 135-139 36.290499999999994 38.0 38.0 38.0 34.0 38.0 140-144 36.222500000000004 38.0 38.0 38.0 34.0 38.0 145-149 35.7759 38.0 36.8 38.0 33.0 38.0 150-151 33.051875 37.0 34.5 38.0 17.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 1.0 14 1.0 15 0.0 16 0.0 17 0.0 18 1.0 19 2.0 20 0.0 21 3.0 22 3.0 23 6.0 24 5.0 25 4.0 26 6.0 27 15.0 28 13.0 29 12.0 30 16.0 31 39.0 32 29.0 33 47.0 34 83.0 35 157.0 36 388.0 37 3168.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.672147995889002 17.882836587872557 10.91983556012333 43.52517985611511 2 16.125 24.825 31.775 27.275 3 17.974999999999998 27.875 23.625 30.525000000000002 4 20.9 34.9 19.2 25.0 5 21.05 37.25 22.650000000000002 19.05 6 17.05 35.699999999999996 25.75 21.5 7 13.725000000000001 22.95 44.15 19.175 8 17.25 24.05 31.175000000000004 27.525 9 16.400000000000002 25.224999999999998 31.8 26.575 10-14 19.25 30.06 26.740000000000002 23.95 15-19 19.025 29.12 27.91 23.945 20-24 19.61 29.595 27.115000000000002 23.68 25-29 19.009999999999998 29.459999999999997 27.575 23.955000000000002 30-34 19.105 29.975 27.250000000000004 23.669999999999998 35-39 19.55 28.925 27.235 24.29 40-44 19.24 29.880000000000003 27.095000000000002 23.785 45-49 19.36 28.655 27.72 24.265 50-54 19.715 28.310000000000002 27.450000000000003 24.525 55-59 19.335 29.25 27.925 23.49 60-64 19.509999999999998 28.215 27.97 24.305 65-69 19.77 28.939999999999998 27.24 24.05 70-74 19.85 28.215 27.894999999999996 24.04 75-79 19.72 28.005000000000003 28.065 24.21 80-84 19.61 28.305000000000003 28.04 24.044999999999998 85-89 19.615 28.249999999999996 27.66 24.474999999999998 90-94 19.900000000000002 28.09 27.474999999999998 24.535 95-99 19.965 28.315 27.565 24.154999999999998 100-104 19.42 28.43 27.325 24.825 105-109 20.195 27.985 27.834999999999997 23.985 110-114 19.830000000000002 29.04 27.279999999999998 23.849999999999998 115-119 20.315 28.275 26.650000000000002 24.759999999999998 120-124 19.875 28.435 27.200000000000003 24.490000000000002 125-129 20.96 27.91 27.26 23.87 130-134 20.385 28.63 26.465 24.52 135-139 20.95 28.42 26.484999999999996 24.145 140-144 21.305 28.415000000000003 26.435 23.845 145-149 20.695 28.09 27.034999999999997 24.18 150-151 20.674999999999997 27.925 26.5625 24.837500000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 1.0 22 1.0 23 3.0 24 4.5 25 5.0 26 8.0 27 11.0 28 15.0 29 15.5 30 20.5 31 29.0 32 41.0 33 50.5 34 54.0 35 70.5 36 96.0 37 119.0 38 141.5 39 169.5 40 190.5 41 219.5 42 237.0 43 258.0 44 279.5 45 277.0 46 266.0 47 248.5 48 219.5 49 183.5 50 161.0 51 138.5 52 114.0 53 81.0 54 55.0 55 44.5 56 38.5 57 35.5 58 27.5 59 19.0 60 15.5 61 11.5 62 8.0 63 6.0 64 2.5 65 0.5 66 1.5 67 1.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.5 73 0.5 74 0.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.7 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.5 #Duplication Level Percentage of deduplicated Percentage of total 1 99.49748743718592 99.0 2 0.5025125628140703 1.0 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.07500000000000001 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1875 0.0 0.0 0.0 0.0 82-83 0.25 0.0 0.0 0.0 0.0 84-85 0.2625 0.0 0.0 0.0 0.0 86-87 0.32499999999999996 0.0 0.0 0.0 0.0 88-89 0.3625 0.0 0.0 0.0 0.0 90-91 0.475 0.0 0.0 0.0 0.0 92-93 0.575 0.0 0.0 0.0 0.0 94-95 0.6625000000000001 0.0 0.0 0.0 0.0 96-97 0.725 0.0 0.0 0.0 0.0 98-99 0.8125 0.0 0.0 0.0 0.0 100-101 1.0125 0.0 0.0 0.0 0.0 102-103 1.2 0.0 0.0 0.0 0.0 104-105 1.5875 0.0 0.0 0.0 0.0 106-107 1.975 0.0 0.0 0.0 0.0 108-109 2.3125 0.0 0.0 0.0 0.0 110-111 2.675 0.0 0.0 0.0 0.0 112-113 3.0125 0.0 0.0 0.0 0.0 114-115 3.5125 0.0 0.0 0.0 0.0 116-117 3.9 0.0 0.0 0.0 0.0 118-119 4.35 0.0 0.0 0.0 0.0 120-121 5.0375 0.0 0.0 0.0 0.0 122-123 5.7375 0.0 0.0 0.0 0.0 124-125 6.3875 0.0 0.0 0.0 0.0 126-127 7.3625 0.0 0.0 0.0 0.0 128-129 8.2 0.0 0.0 0.0 0.0 130-131 8.8875 0.0 0.0 0.0 0.0 132-133 9.712499999999999 0.0 0.0 0.0 0.0 134-135 10.7 0.0 0.0 0.0 0.0 136-137 11.6625 0.0 0.0 0.0 0.0 138-139 12.475000000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAGAATG 10 0.0068343505 144.975 2 TGGTGGA 10 0.0068343505 144.975 7 >>END_MODULE SRR7180098 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7180098_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.06025 33.0 33.0 34.0 32.0 34.0 2 33.176 34.0 33.0 34.0 33.0 34.0 3 33.202 34.0 33.0 34.0 33.0 34.0 4 33.19975 34.0 33.0 34.0 33.0 34.0 5 33.2095 34.0 33.0 34.0 33.0 34.0 6 37.28925 38.0 38.0 38.0 38.0 38.0 7 37.271 38.0 38.0 38.0 37.0 38.0 8 37.2735 38.0 38.0 38.0 37.0 38.0 9 37.3095 38.0 38.0 38.0 38.0 38.0 10-14 37.27355 38.0 38.0 38.0 37.6 38.0 15-19 37.216 38.0 38.0 38.0 37.2 38.0 20-24 37.211850000000005 38.0 38.0 38.0 37.0 38.0 25-29 37.10145 38.0 38.0 38.0 37.0 38.0 30-34 37.0413 38.0 38.0 38.0 37.0 38.0 35-39 36.95035 38.0 38.0 38.0 37.0 38.0 40-44 36.940549999999995 38.0 38.0 38.0 36.8 38.0 45-49 37.009049999999995 38.0 38.0 38.0 36.8 38.0 50-54 37.0354 38.0 38.0 38.0 37.0 38.0 55-59 37.0181 38.0 38.0 38.0 36.8 38.0 60-64 36.943349999999995 38.0 38.0 38.0 36.2 38.0 65-69 36.837450000000004 38.0 38.0 38.0 36.0 38.0 70-74 36.8403 38.0 38.0 38.0 36.0 38.0 75-79 36.80745 38.0 38.0 38.0 36.0 38.0 80-84 36.75025 38.0 38.0 38.0 36.0 38.0 85-89 36.64015 38.0 38.0 38.0 35.4 38.0 90-94 36.5596 38.0 38.0 38.0 35.0 38.0 95-99 36.4961 38.0 38.0 38.0 35.0 38.0 100-104 36.26475 38.0 38.0 38.0 34.0 38.0 105-109 36.1185 38.0 38.0 38.0 34.0 38.0 110-114 35.978500000000004 38.0 38.0 38.0 33.4 38.0 115-119 35.8893 38.0 37.6 38.0 33.2 38.0 120-124 35.6711 38.0 37.0 38.0 32.0 38.0 125-129 35.39245 38.0 36.6 38.0 30.6 38.0 130-134 35.09705 38.0 36.0 38.0 29.4 38.0 135-139 34.8327 38.0 36.0 38.0 28.0 38.0 140-144 34.24105 38.0 35.0 38.0 24.4 38.0 145-149 33.6755 38.0 35.0 38.0 20.8 38.0 150-151 29.80075 36.0 28.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 6.0 4 4.0 5 2.0 6 1.0 7 1.0 8 2.0 9 2.0 10 5.0 11 2.0 12 1.0 13 2.0 14 3.0 15 2.0 16 1.0 17 7.0 18 4.0 19 5.0 20 6.0 21 2.0 22 6.0 23 9.0 24 10.0 25 10.0 26 15.0 27 14.0 28 31.0 29 26.0 30 42.0 31 65.0 32 54.0 33 79.0 34 142.0 35 198.0 36 579.0 37 2657.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.575 16.325 19.1 28.999999999999996 2 23.65 21.425 37.4 17.525 3 22.400000000000002 24.825 31.724999999999998 21.05 4 25.424999999999997 33.324999999999996 21.825 19.425 5 25.424999999999997 36.25 22.475 15.85 6 19.139354515886914 37.3530147610708 23.992994746059544 19.514635976982735 7 19.35967983991996 16.633316658329164 42.996498249124556 21.010505252626313 8 21.885942971485743 23.761880940470235 28.264132066033014 26.088044022011005 9 23.674999999999997 24.55 28.499999999999996 23.275000000000002 10-14 23.69921953171903 27.736641985191113 26.37582549529718 22.188312987792674 15-19 23.426398478935255 27.624337035925144 28.419893925748024 20.529370559391573 20-24 24.286286687368527 28.19793649203646 27.47170189321847 20.04407492737654 25-29 23.412160465933624 28.844705527940956 27.278204548877845 20.464929457247578 30-34 23.75426964034559 28.390596745027125 27.838055053244926 20.01707856138236 35-39 23.938282153088405 28.200231190631754 27.773031110217623 20.08845554606222 40-44 24.49369315040957 28.177295341474444 27.368209457761694 19.96080205035429 45-49 24.927274551108436 28.172334236132006 27.058882535861166 19.841508676898385 50-54 23.92708698482648 27.38745054834994 27.93830437177625 20.747158095047325 55-59 24.386825508058866 28.05085594153569 27.53528881769947 20.027029732705977 60-64 24.804765718862633 27.728273928714458 27.513015618742493 19.953944733680416 65-69 24.74969963956748 27.918502202643168 27.6231477773328 19.708650380456547 70-74 23.713713713713712 28.293293293293292 28.02802802802803 19.964964964964967 75-79 24.333116460637605 28.141734647915516 27.22586457134278 20.2992843201041 80-84 23.643643643643646 28.03803803803804 27.922922922922922 20.395395395395397 85-89 24.34813072418798 28.051649066613283 27.67629247785396 19.92392773134478 90-94 24.412088461923346 28.09466626638647 27.56929850895627 19.923946762733912 95-99 24.344737895158065 28.031212484994 27.991196478591434 19.632853141256504 100-104 24.46590283684395 27.873117526392154 27.85310451793666 19.807875118827237 105-109 24.108437953283648 28.309908467963783 27.934777172010207 19.646876406742358 110-114 24.383657548632296 27.86918037705656 27.76916537480622 19.977996699504928 115-119 24.653628770069524 27.684689641374483 28.09983494222978 19.561846646326213 120-124 24.448336252189144 27.30047535651739 28.45634225669252 19.794846134600952 125-129 25.294029327861466 28.121715629848353 27.01566488163756 19.568590160652622 130-134 25.823405746320955 28.100911002102315 26.939633596956654 19.136049654620084 135-139 25.93074459567654 27.391913530824656 27.31685348278623 19.36048839071257 140-144 26.244683512634477 27.20040030022517 27.805854390793094 18.74906179634726 145-149 26.518562994095866 27.744421094766338 27.399179425597918 18.337836485539878 150-151 27.374231589511982 26.99786726884958 27.47459540835529 18.15330573328315 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.5 5 1.0 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 1.0 14 1.0 15 0.5 16 0.5 17 0.5 18 0.0 19 0.0 20 0.0 21 0.5 22 2.5 23 3.0 24 2.5 25 3.5 26 5.5 27 5.0 28 5.5 29 10.0 30 14.0 31 19.0 32 23.0 33 26.5 34 38.0 35 48.5 36 61.5 37 100.0 38 131.0 39 163.0 40 188.5 41 212.5 42 266.5 43 288.0 44 275.5 45 276.5 46 284.5 47 268.5 48 237.5 49 213.0 50 184.5 51 140.0 52 111.0 53 98.0 54 70.0 55 48.0 56 38.0 57 34.5 58 31.5 59 21.0 60 14.0 61 9.0 62 7.5 63 5.5 64 1.5 65 1.5 66 1.5 67 1.0 68 0.5 69 0.0 70 0.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.075 7 0.05 8 0.05 9 0.0 10-14 0.06 15-19 0.06999999999999999 20-24 0.16999999999999998 25-29 0.415 30-34 0.45999999999999996 35-39 0.515 40-44 0.505 45-49 0.31 50-54 0.155 55-59 0.11 60-64 0.12 65-69 0.12 70-74 0.1 75-79 0.095 80-84 0.1 85-89 0.095 90-94 0.06999999999999999 95-99 0.04 100-104 0.065 105-109 0.034999999999999996 110-114 0.015 115-119 0.034999999999999996 120-124 0.075 125-129 0.095 130-134 0.11 135-139 0.08 140-144 0.075 145-149 0.06999999999999999 150-151 0.36250000000000004 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.35000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.3709109209864 98.725 2 0.6039255158530448 1.2 3 0.025163563160543533 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.1625 0.0 0.0 0.0 0.0 82-83 0.225 0.0 0.0 0.0 0.0 84-85 0.2375 0.0 0.0 0.0 0.0 86-87 0.30000000000000004 0.0 0.0 0.0 0.0 88-89 0.3375 0.0 0.0 0.0 0.0 90-91 0.44999999999999996 0.0 0.0 0.0 0.0 92-93 0.55 0.0 0.0 0.0 0.0 94-95 0.6375 0.0 0.0 0.0 0.0 96-97 0.7 0.0 0.0 0.0 0.0 98-99 0.775 0.0 0.0 0.0 0.0 100-101 0.9625 0.0 0.0 0.0 0.0 102-103 1.15 0.0 0.0 0.0 0.0 104-105 1.5375 0.0 0.0 0.0 0.0 106-107 1.95 0.0 0.0 0.0 0.0 108-109 2.2875 0.0 0.0 0.0 0.0 110-111 2.675 0.0 0.0 0.0 0.0 112-113 3.0125 0.0 0.0 0.0 0.0 114-115 3.5 0.0 0.0 0.0 0.0 116-117 3.9 0.0 0.0 0.0 0.0 118-119 4.375 0.0 0.0 0.0 0.0 120-121 5.075 0.0 0.0 0.0 0.0 122-123 5.7625 0.0 0.0 0.0 0.0 124-125 6.4125 0.0 0.0 0.0 0.0 126-127 7.4 0.0 0.0 0.0 0.0 128-129 8.25 0.0 0.0 0.0 0.0 130-131 8.9375 0.0 0.0 0.0 0.0 132-133 9.7 0.0 0.0 0.0 0.0 134-135 10.6875 0.0 0.0 0.0 0.0 136-137 11.649999999999999 0.0 0.0 0.0 0.0 138-139 12.4875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GATCTTG 10 0.006830828 145.0 9 >>END_MODULE Read 712209 spots for SRR7180098.sra Written 712209 spots for SRR7180098.sra Read 712209 spots for SRR7180098.sra Written 712209 spots for SRR7180098.sra Read 712209 spots for SRR7180098.sra Written 712209 spots for SRR7180098.sra Read 712209 spots for SRR7180098.sra Written 712209 spots for SRR7180098.sra Read 712209 spots for SRR7180098.sra Written 712209 spots for SRR7180098.sra Read 712209 spots for SRR7180098.sra Written 712209 spots for SRR7180098.sra Read 712209 spots for SRR7180098.sra Written 712209 spots for SRR7180098.sra Read 712209 spots for SRR7180098.sra Written 712209 spots for SRR7180098.sra Read 712209 spots for SRR7180098.sra Written 712209 spots for SRR7180098.sra Read 712209 spots for SRR7180098.sra Written 712209 spots for SRR7180098.sra Read 712209 spots for SRR7180098.sra Written 712209 spots for SRR7180098.sra Read 712209 spots for SRR7180098.sra Written 712209 spots for SRR7180098.sra Read 712214 spots for SRR7180098.sra Written 712214 spots for SRR7180098.sra Read 712209 spots for SRR7180098.sra Written 712209 spots for SRR7180098.sra Read 712209 spots for SRR7180098.sra Written 712209 spots for SRR7180098.sra Read 712209 spots for SRR7180098.sra Written 712209 spots for SRR7180098.sra Read 712209 spots for SRR7180098.sra Written 712209 spots for SRR7180098.sra Read 712209 spots for SRR7180098.sra Written 712209 spots for SRR7180098.sra Read 712209 spots for SRR7180098.sra Written 712209 spots for SRR7180098.sra Read 712209 spots for SRR7180098.sra Written 712209 spots for SRR7180098.sra SRR ids: ['SRR7180098.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_tk96n5pn SRR7180098.sra spots: 14244185 blocks: [[1, 712209], [712210, 1424418], [1424419, 2136627], [2136628, 2848836], [2848837, 3561045], [3561046, 4273254], [4273255, 4985463], [4985464, 5697672], [5697673, 6409881], [6409882, 7122090], [7122091, 7834299], [7834300, 8546508], [8546509, 9258717], [9258718, 9970926], [9970927, 10683135], [10683136, 11395344], [11395345, 12107553], [12107554, 12819762], [12819763, 13531971], [13531972, 14244185]] SRR7180098 file size 4805186 SRR7180098 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7180098 SRR7180098_1.fastq SRR7180098_2.fastq Input file: SRR7180098_1.fastq Paired file: SRR7180098_2.fastq trimmed: SRR7180098-trimmed-pair1.fastq, SRR7180098-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 18:51:20 2025 >> started Mon Feb 10 18:51:35 2025 >> done (15.521s) 14244185 read pairs processed; of these: 29221 ( 0.21%) short read pairs filtered out after trimming by size control 20442 ( 0.14%) empty read pairs filtered out after trimming by size control 14194522 (99.65%) read pairs available; of these: 6021324 (42.42%) trimmed read pairs available after processing 8173198 (57.58%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 3 0.00% 20 2 0.00% 21 1 0.00% 22 5 0.00% 23 0 0.00% 24 3 0.00% 25 9 0.00% 26 6 0.00% 27 9 0.00% 28 9 0.00% 29 4 0.00% 30 9 0.00% 31 5 0.00% 32 5 0.00% 33 9 0.00% 34 3 0.00% 35 11 0.00% 36 20 0.00% 37 21 0.00% 38 11 0.00% 39 6 0.00% 40 30 0.00% 41 29 0.00% 42 18 0.00% 43 10 0.00% 44 16 0.00% 45 43 0.00% 46 37 0.00% 47 69 0.00% 48 44 0.00% 49 62 0.00% 50 60 0.00% 51 107 0.00% 52 30 0.00% 53 56 0.00% 54 62 0.00% 55 120 0.00% 56 68 0.00% 57 66 0.00% 58 83 0.00% 59 116 0.00% 60 118 0.00% 61 134 0.00% 62 185 0.00% 63 216 0.00% 64 230 0.00% 65 266 0.00% 66 314 0.00% 67 350 0.00% 68 388 0.00% 69 437 0.00% 70 548 0.00% 71 678 0.00% 72 832 0.01% 73 951 0.01% 74 1125 0.01% 75 1359 0.01% 76 1568 0.01% 77 1803 0.01% 78 1985 0.01% 79 2258 0.02% 80 2664 0.02% 81 3034 0.02% 82 3472 0.02% 83 4056 0.03% 84 5746 0.04% 85 7118 0.05% 86 7858 0.06% 87 8362 0.06% 88 8919 0.06% 89 9760 0.07% 90 10716 0.08% 91 10994 0.08% 92 12151 0.09% 93 13026 0.09% 94 13965 0.10% 95 15046 0.11% 96 16040 0.11% 97 17174 0.12% 98 18269 0.13% 99 19437 0.14% 100 20607 0.15% 101 22111 0.16% 102 23153 0.16% 103 24581 0.17% 104 26027 0.18% 105 27789 0.20% 106 29224 0.21% 107 30963 0.22% 108 32046 0.23% 109 33691 0.24% 110 35106 0.25% 111 36390 0.26% 112 38596 0.27% 113 39257 0.28% 114 40727 0.29% 115 42422 0.30% 116 43956 0.31% 117 46129 0.32% 118 47413 0.33% 119 49176 0.35% 120 50187 0.35% 121 53150 0.37% 122 53865 0.38% 123 55119 0.39% 124 56844 0.40% 125 57651 0.41% 126 59636 0.42% 127 61144 0.43% 128 62630 0.44% 129 63994 0.45% 130 66089 0.47% 131 67790 0.48% 132 69481 0.49% 133 71633 0.50% 134 73042 0.51% 135 74808 0.53% 136 76377 0.54% 137 77902 0.55% 138 80993 0.57% 139 84248 0.59% 140 86327 0.61% 141 90110 0.63% 142 95908 0.68% 143 100869 0.71% 144 107279 0.76% 145 117351 0.83% 146 131995 0.93% 147 157927 1.11% 148 210645 1.48% 149 374969 2.64% 150 2317167 16.32% 151 8173198 57.58% 14194522 reads passed initial QC criterion=sequence-density sequence-density=0.50 sequence-density-rank=1 fanout-score=3.45 fanout-score-rank=22 prefix-density=0.75 prefix-fanout=2.3 sequence=CACTTGCAGCCATTCTCAGCACCAGAGTTCATCTCAGACCTCTC criterion=fanout-score sequence-density=0.02 sequence-density-rank=33 fanout-score=151.24 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=12.0 sequence=AAGAAAAAAGATACACACGGCCATACATAATACACGGACCTCAATTCACCAGATTTTCAAAGCAGCACATAATATTTATTATAAATCAAGTCGTCAGCTATGTTCTTAGCTTCTTACTTACTCTGCACGCTGTTCTTCAACCATCTCCAAGGGGAAATGAGGAGACCCCCAAGGGCAAAAGATAACCCTATAGTTGGTCCCGCCAGGGCATGTAAATGTGCTCGAAGGGTCATCCTGGGGATAGCTGTAAGAAGTAGGGCACCTATCCTTAAAAAACCTTGAGAAATAGGTAGGGCCACAGCTCCCCTGCCCATTAGTGCAGCAATATTCGTTAGTTTTAAACACAGTGCATGGGTTATTACACCCACCAGGAGCCCTCAATTCATTAGGACATTGCCCATTAATATCTGCTGTGCAGAGAAGCGCCTGACACTTCCCTGAGCCACCGCTTGATGTTGGACTAAATTCCATAGGGATATTAAATCCATCAACAAGGGATATATCATAAAAA criterion=sequence-density sequence-density=0.56 sequence-density-rank=1 fanout-score=3.03 fanout-score-rank=25 prefix-density=0.57 prefix-fanout=3.0 sequence=ATGTACCCTGACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=82.78 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=7.3 sequence=AGGATCTGTTTAATTTGAGACAGAAAACATGAAATCCTCCTACACTTTCTTCATTCTTTTCTCACTCTTTTCGTTTGCTAACGTGATCGGTGCTAGAAAAGACACTGGAGAGTATTGGAGAGCTGTCATGAAAGATCAGCCCATGCCAGAAGCAATACATGGCC SRR7180098 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 18:52:23 Started mapping on | Feb 10 18:52:23 Finished on | Feb 10 18:53:54 Mapping speed, Million of reads per hour | 561.54 Number of input reads | 14194522 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 13463448 Uniquely mapped reads % | 94.85% Average mapped length | 290.31 Number of splices: Total | 12740802 Number of splices: Annotated (sjdb) | 12461439 Number of splices: GT/AG | 12542818 Number of splices: GC/AG | 148929 Number of splices: AT/AC | 13180 Number of splices: Non-canonical | 35875 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.04% Deletion average length | 3.03 Insertion rate per base | 0.02% Insertion average length | 2.61 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 343715 % of reads mapped to multiple loci | 2.42% Number of reads mapped to too many loci | 107601 % of reads mapped to too many loci | 0.76% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.86% % of reads unmapped: other | 0.11% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 411568 411568 411568 N_multimapping 343715 343715 343715 N_noFeature 384651 13308779 441978 N_ambiguous 162129 954 64140 UnstrandedReadsAssigned:12916668 PositiveStrandReadsAssigned:153715 NegativeStrandReadsAssigned:12957330 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7180098 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7180098-trimmed-pair1.fastq SRR7180098-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,194,522 reads, 12,872,722 reads pseudoaligned [quant] estimated average fragment length: 208.672 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,088 rounds 52401 SRR7180098.ke.tsv 34699 SRR7180098.se.tsv 87100 total ==> SRR7180098.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1810.33 1247 41.8553 Potri.005G024800.1.v4.1 1035 827.328 4507 331.018 Potri.004G059700.1.v4.1 961 753.332 14 1.12923 Potri.007G009000.2.v4.1 1416 1208.33 0 0 Potri.003G141000.2.v4.1 2943 2735.33 832.343 18.4899 Potri.016G087400.1.v4.1 270 92.3034 1230 809.708 Potri.015G069301.1.v4.1 564 357.784 0 0 Potri.010G195200.1.v4.1 1773 1565.33 480 18.6327 Potri.012G127500.1.v4.1 977 769.332 3259 257.402 ==> SRR7180098.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 0 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 881 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 84 SRR7180098 completed mapping pipeline successfully