Starting /dee2/code/volunteer_pipeline.sh SRR7180099 current disk space = 3056696942592 free memory = 1511989376 SRR7180099 SRAfilesize ca1f64dd57ccb66b1abb312b4aae1b2f SRR7180099.sra SRR7180099.sra file validated SRR7180099 is paired end SRR7180099 is conventional basespace SRR7180099 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7180099_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 19.1175 18.0 18.0 18.0 18.0 30.0 2 22.85275 25.0 18.0 27.0 18.0 30.0 3 24.4995 25.0 18.0 29.0 18.0 31.0 4 28.35275 29.0 27.0 31.0 25.0 33.0 5 29.162 31.0 29.0 33.0 25.0 33.0 6 35.82075 37.0 36.0 38.0 33.0 38.0 7 37.3645 38.0 38.0 38.0 37.0 38.0 8 37.49475 38.0 38.0 38.0 37.0 38.0 9 37.55025 38.0 38.0 38.0 37.0 38.0 10-14 37.65625 38.0 38.0 38.0 38.0 38.0 15-19 37.679 38.0 38.0 38.0 38.0 38.0 20-24 37.6477 38.0 38.0 38.0 38.0 38.0 25-29 37.579950000000004 38.0 38.0 38.0 38.0 38.0 30-34 37.54345 38.0 38.0 38.0 38.0 38.0 35-39 37.498149999999995 38.0 38.0 38.0 38.0 38.0 40-44 37.45875 38.0 38.0 38.0 38.0 38.0 45-49 37.42960000000001 38.0 38.0 38.0 38.0 38.0 50-54 37.431 38.0 38.0 38.0 38.0 38.0 55-59 37.34065 38.0 38.0 38.0 37.6 38.0 60-64 37.34365 38.0 38.0 38.0 37.6 38.0 65-69 37.28594999999999 38.0 38.0 38.0 37.0 38.0 70-74 37.239000000000004 38.0 38.0 38.0 37.0 38.0 75-79 37.19179999999999 38.0 38.0 38.0 37.0 38.0 80-84 37.13935 38.0 38.0 38.0 37.0 38.0 85-89 37.082899999999995 38.0 38.0 38.0 36.8 38.0 90-94 36.999050000000004 38.0 38.0 38.0 36.2 38.0 95-99 36.9401 38.0 38.0 38.0 36.0 38.0 100-104 36.85215 38.0 38.0 38.0 36.0 38.0 105-109 36.73460000000001 38.0 38.0 38.0 35.4 38.0 110-114 36.64795 38.0 38.0 38.0 35.2 38.0 115-119 36.55815 38.0 38.0 38.0 35.0 38.0 120-124 36.471000000000004 38.0 38.0 38.0 35.0 38.0 125-129 36.386649999999996 38.0 38.0 38.0 34.4 38.0 130-134 36.1622 38.0 38.0 38.0 34.0 38.0 135-139 35.8938 38.0 37.6 38.0 33.2 38.0 140-144 35.8474 38.0 38.0 38.0 33.2 38.0 145-149 35.41135 38.0 36.6 38.0 32.2 38.0 150-151 32.77775 37.0 33.5 38.0 16.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 4.0 8 6.0 9 3.0 10 1.0 11 1.0 12 3.0 13 2.0 14 3.0 15 1.0 16 1.0 17 2.0 18 3.0 19 4.0 20 1.0 21 1.0 22 4.0 23 0.0 24 5.0 25 8.0 26 7.0 27 12.0 28 15.0 29 17.0 30 26.0 31 30.0 32 44.0 33 69.0 34 101.0 35 166.0 36 667.0 37 2793.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 29.759414225941423 9.178870292887028 23.430962343096233 37.63075313807531 2 19.925 20.349999999999998 38.725 21.0 3 18.8 25.174999999999997 27.224999999999998 28.799999999999997 4 22.55 32.7 23.025000000000002 21.725 5 21.275 35.699999999999996 25.775 17.25 6 17.2 36.125 26.775 19.900000000000002 7 13.075000000000001 23.9 42.675000000000004 20.349999999999998 8 17.05 25.5 31.75 25.7 9 17.349999999999998 24.525 33.575 24.55 10-14 18.93 31.014999999999997 26.979999999999997 23.075000000000003 15-19 19.035 30.285 27.994999999999997 22.685 20-24 18.485 30.220000000000002 28.565 22.73 25-29 19.439999999999998 29.459999999999997 28.439999999999998 22.66 30-34 19.435 30.680000000000003 27.33 22.555 35-39 18.96 30.0 27.625 23.415 40-44 19.29 30.035 27.855 22.82 45-49 19.445 30.305 27.015 23.235 50-54 19.39 29.509999999999998 27.91 23.189999999999998 55-59 19.09 30.415 27.215 23.28 60-64 19.625 29.195 27.51 23.669999999999998 65-69 18.855 29.765000000000004 27.825 23.555 70-74 19.919999999999998 29.054999999999996 27.060000000000002 23.965 75-79 18.995 29.244999999999997 27.779999999999998 23.98 80-84 20.064999999999998 29.020000000000003 27.485 23.43 85-89 19.46 29.049999999999997 27.655 23.835 90-94 19.605 29.080000000000002 27.425 23.89 95-99 19.435 29.28 27.555000000000003 23.73 100-104 20.544999999999998 28.65 27.255000000000003 23.549999999999997 105-109 19.220000000000002 29.18 27.595 24.005000000000003 110-114 20.13 28.875 27.215 23.78 115-119 20.674999999999997 29.189999999999998 26.69 23.445 120-124 20.119999999999997 29.145 27.105 23.630000000000003 125-129 19.665 29.110000000000003 26.715 24.51 130-134 20.96 28.255000000000003 26.57 24.215 135-139 20.75 29.49 25.83 23.93 140-144 20.380000000000003 29.175 26.450000000000003 23.995 145-149 20.09 28.895 26.450000000000003 24.565 150-151 21.099999999999998 28.6625 26.224999999999998 24.0125 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 5.0 1 3.5 2 2.0 3 2.0 4 1.0 5 0.0 6 1.0 7 1.0 8 1.0 9 2.0 10 1.0 11 2.0 12 2.5 13 0.5 14 0.0 15 0.5 16 1.5 17 2.0 18 2.5 19 3.0 20 3.5 21 2.5 22 2.5 23 5.5 24 6.5 25 6.5 26 8.0 27 15.0 28 24.5 29 28.0 30 33.5 31 50.5 32 59.5 33 75.5 34 97.0 35 110.5 36 128.5 37 141.5 38 157.5 39 177.5 40 187.0 41 186.5 42 200.5 43 226.5 44 222.5 45 226.5 46 239.5 47 217.5 48 195.0 49 169.0 50 150.5 51 135.5 52 106.5 53 95.5 54 80.5 55 51.0 56 38.0 57 28.0 58 14.0 59 12.5 60 12.0 61 9.5 62 9.0 63 5.5 64 3.0 65 3.0 66 3.0 67 1.0 68 0.0 69 1.0 70 1.5 71 1.0 72 1.5 73 1.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.3999999999999995 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.225 #Duplication Level Percentage of deduplicated Percentage of total 1 99.37011841773746 98.6 2 0.5542957923910304 1.0999999999999999 3 0.05039052658100278 0.15 4 0.0 0.0 5 0.0 0.0 6 0.02519526329050139 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 6 0.15 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.037500000000000006 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.07500000000000001 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.225 0.0 0.0 0.0 0.0 90-91 0.3125 0.0 0.0 0.0 0.0 92-93 0.42500000000000004 0.0 0.0 0.0 0.0 94-95 0.4875 0.0 0.0 0.0 0.0 96-97 0.6000000000000001 0.0 0.0 0.0 0.0 98-99 0.8625 0.0 0.0 0.0 0.0 100-101 1.0499999999999998 0.0 0.0 0.0 0.0 102-103 1.3125 0.0 0.0 0.0 0.0 104-105 1.5750000000000002 0.0 0.0 0.0 0.0 106-107 1.8125 0.0 0.0 0.0 0.0 108-109 2.0 0.0 0.0 0.0 0.0 110-111 2.2625 0.0 0.0 0.0 0.0 112-113 2.6 0.0 0.0 0.0 0.0 114-115 3.175 0.0 0.0 0.0 0.0 116-117 3.5 0.0 0.0 0.0 0.0 118-119 3.8125 0.0 0.0 0.0 0.0 120-121 4.275 0.0 0.0 0.0 0.0 122-123 4.85 0.0 0.0 0.0 0.0 124-125 5.35 0.0 0.0 0.0 0.0 126-127 5.975 0.0 0.0 0.0 0.0 128-129 6.699999999999999 0.0 0.0 0.0 0.0 130-131 7.4375 0.0 0.0 0.0 0.0 132-133 8.0875 0.0 0.0 0.0 0.0 134-135 8.850000000000001 0.0 0.0 0.0 0.0 136-137 9.475 0.0 0.0 0.0 0.0 138-139 10.15 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7180099 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7180099_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.0465 33.0 33.0 34.0 32.0 34.0 2 33.13825 34.0 33.0 34.0 33.0 34.0 3 33.17775 34.0 33.0 34.0 33.0 34.0 4 33.1415 34.0 33.0 34.0 33.0 34.0 5 33.10725 34.0 33.0 34.0 33.0 34.0 6 37.2905 38.0 38.0 38.0 37.0 38.0 7 37.29 38.0 38.0 38.0 38.0 38.0 8 37.19875 38.0 38.0 38.0 37.0 38.0 9 37.3065 38.0 38.0 38.0 37.0 38.0 10-14 37.288650000000004 38.0 38.0 38.0 38.0 38.0 15-19 37.23465 38.0 38.0 38.0 37.2 38.0 20-24 37.2141 38.0 38.0 38.0 37.0 38.0 25-29 37.1882 38.0 38.0 38.0 37.2 38.0 30-34 37.13345 38.0 38.0 38.0 37.0 38.0 35-39 37.07535 38.0 38.0 38.0 37.0 38.0 40-44 37.01935 38.0 38.0 38.0 37.0 38.0 45-49 37.06575 38.0 38.0 38.0 37.0 38.0 50-54 37.05975 38.0 38.0 38.0 37.0 38.0 55-59 37.01715 38.0 38.0 38.0 36.8 38.0 60-64 36.9697 38.0 38.0 38.0 36.6 38.0 65-69 36.89295 38.0 38.0 38.0 36.0 38.0 70-74 36.92295 38.0 38.0 38.0 36.0 38.0 75-79 36.886300000000006 38.0 38.0 38.0 36.2 38.0 80-84 36.873149999999995 38.0 38.0 38.0 36.0 38.0 85-89 36.71915 38.0 38.0 38.0 35.8 38.0 90-94 36.64965 38.0 38.0 38.0 35.2 38.0 95-99 36.572700000000005 38.0 38.0 38.0 35.0 38.0 100-104 36.359449999999995 38.0 38.0 38.0 34.0 38.0 105-109 36.18485 38.0 38.0 38.0 34.0 38.0 110-114 36.1265 38.0 38.0 38.0 33.8 38.0 115-119 36.0929 38.0 37.8 38.0 33.8 38.0 120-124 35.77405 38.0 37.0 38.0 33.0 38.0 125-129 35.642849999999996 38.0 36.6 38.0 32.2 38.0 130-134 35.3557 38.0 36.0 38.0 30.6 38.0 135-139 35.22555 38.0 36.0 38.0 31.0 38.0 140-144 34.583800000000004 38.0 35.0 38.0 27.4 38.0 145-149 34.0839 38.0 35.0 38.0 25.0 38.0 150-151 30.283625 36.5 29.0 38.0 8.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 10.0 3 4.0 4 3.0 5 3.0 6 3.0 7 1.0 8 0.0 9 3.0 10 2.0 11 1.0 12 0.0 13 3.0 14 2.0 15 4.0 16 4.0 17 4.0 18 0.0 19 0.0 20 5.0 21 6.0 22 4.0 23 4.0 24 7.0 25 9.0 26 11.0 27 17.0 28 23.0 29 24.0 30 32.0 31 35.0 32 60.0 33 74.0 34 117.0 35 238.0 36 641.0 37 2646.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.9 14.75 19.525000000000002 30.825000000000003 2 24.175 22.6 36.525 16.7 3 23.425 26.075 28.7 21.8 4 24.8 34.275 21.6 19.325 5 25.2 34.25 23.25 17.299999999999997 6 18.90945472736368 37.693846923461734 24.562281140570285 18.8344172086043 7 19.875 17.375 41.075 21.675 8 22.25 23.425 29.45 24.875 9 23.45 24.85 28.475 23.225 10-14 24.747474747474747 28.02280228022802 25.677567756775677 21.55215521552155 15-19 24.412323697109134 27.63829148744623 27.448234470341106 20.50115034510353 20-24 24.33920704845815 28.354024829795755 27.212655186223465 20.094112935522627 25-29 23.898992935517814 28.067538453830355 27.5865524324866 20.44691617816524 30-34 23.92121485490904 27.94567232997544 27.725154112163587 20.407958702951937 35-39 24.022262334536705 27.737665463297233 27.291415964701166 20.948656237464903 40-44 23.661251504211794 27.070798235058163 28.24909747292419 21.018852787805855 45-49 24.072126220886553 27.38292011019284 28.15426997245179 20.39068369646882 50-54 23.884856070087608 28.00500625782228 28.030037546933666 20.080100125156445 55-59 24.08269509936427 27.952144966711717 28.06727736897432 19.897882564949693 60-64 24.59451341609932 27.723267921505805 27.89347216659992 19.788746495794953 65-69 23.78497422293408 28.349767255618396 27.85925221482557 20.006006306621956 70-74 23.58712519397307 27.276367822996445 28.03724282925364 21.099264153776844 75-79 24.10289775286522 27.62624493268605 27.746359041089036 20.524498273359693 80-84 23.632177003554087 27.681834109225612 28.65795665014767 20.028032237072637 85-89 23.99779790801261 27.746359041089036 27.941544467243883 20.314298583654473 90-94 24.060827372317544 27.622430093542093 28.097643939772897 20.219098594367466 95-99 24.251212560628034 27.841392069603483 28.34141707085354 19.565978298914946 100-104 24.324864972994597 27.365473094618924 28.010602120424082 20.29905981196239 105-109 24.48867330099515 27.529129369405407 27.954193128969347 20.028004200630097 110-114 23.825 27.785 28.525 19.865 115-119 24.287428742874287 27.947794779477945 28.84788478847885 18.916891689168917 120-124 24.44477791116447 28.15126050420168 28.106242496998803 19.297719087635056 125-129 24.818577648766325 27.631249687202843 28.36694860117111 19.183224062859715 130-134 24.502051846661995 28.360524472024824 28.19037133420078 18.9470523471124 135-139 24.62231115557779 28.469234617308654 28.499249624812407 18.409204602301152 140-144 25.246360862388073 28.032614676604474 28.01260567255265 18.708418788454807 145-149 25.327729410587413 28.169718803162212 27.679375562894027 18.82317622335635 150-151 25.400801603206414 26.87875751503006 29.045591182364728 18.6748496993988 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 1.0 11 1.0 12 0.5 13 0.5 14 0.5 15 1.0 16 1.0 17 0.5 18 1.0 19 1.0 20 1.0 21 1.5 22 1.5 23 2.0 24 2.5 25 1.5 26 3.0 27 4.0 28 4.5 29 7.5 30 12.0 31 20.0 32 33.0 33 36.0 34 41.0 35 56.0 36 79.0 37 100.5 38 116.5 39 156.5 40 195.5 41 222.5 42 247.0 43 251.0 44 257.0 45 273.0 46 276.0 47 251.5 48 232.5 49 217.5 50 180.0 51 148.5 52 125.0 53 99.0 54 78.0 55 61.0 56 48.0 57 39.5 58 28.5 59 22.0 60 18.0 61 10.0 62 7.5 63 8.0 64 5.0 65 3.5 66 2.0 67 1.0 68 1.0 69 1.5 70 0.5 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.05 7 0.0 8 0.0 9 0.0 10-14 0.01 15-19 0.03 20-24 0.12 25-29 0.20500000000000002 30-34 0.23500000000000001 35-39 0.27999999999999997 40-44 0.27999999999999997 45-49 0.17500000000000002 50-54 0.125 55-59 0.11499999999999999 60-64 0.12 65-69 0.105 70-74 0.11499999999999999 75-79 0.095 80-84 0.11499999999999999 85-89 0.095 90-94 0.045 95-99 0.005 100-104 0.02 105-109 0.015 110-114 0.0 115-119 0.01 120-124 0.04 125-129 0.095 130-134 0.09 135-139 0.05 140-144 0.045 145-149 0.06999999999999999 150-151 0.2 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.575 #Duplication Level Percentage of deduplicated Percentage of total 1 98.85873700228252 97.45 2 0.9637331980725337 1.9 3 0.10144559979710879 0.3 4 0.050722799898554397 0.2 5 0.0 0.0 6 0.025361399949277198 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGCTGAAAGCCCTAACTTAATGGACGGGAGGTATCCCAATAGGAGGTTT 6 0.15 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.037500000000000006 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.07500000000000001 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.225 0.0 0.0 0.0 0.0 90-91 0.3125 0.0 0.0 0.0 0.0 92-93 0.42500000000000004 0.0 0.0 0.0 0.0 94-95 0.4875 0.0 0.0 0.0 0.0 96-97 0.6000000000000001 0.0 0.0 0.0 0.0 98-99 0.8625 0.0 0.0 0.0 0.0 100-101 1.0499999999999998 0.0 0.0 0.0 0.0 102-103 1.3125 0.0 0.0 0.0 0.0 104-105 1.5625 0.0 0.0 0.0 0.0 106-107 1.7875 0.0 0.0 0.0 0.0 108-109 2.05 0.0 0.0 0.0 0.0 110-111 2.3375 0.0 0.0 0.0 0.0 112-113 2.65 0.0 0.0 0.0 0.0 114-115 3.225 0.0 0.0 0.0 0.0 116-117 3.55 0.0 0.0 0.0 0.0 118-119 3.8875 0.0 0.0 0.0 0.0 120-121 4.325 0.0 0.0 0.0 0.0 122-123 4.9 0.0 0.0 0.0 0.0 124-125 5.4 0.0 0.0 0.0 0.0 126-127 6.025 0.0 0.0 0.0 0.0 128-129 6.762499999999999 0.0 0.0 0.0 0.0 130-131 7.512499999999999 0.0 0.0 0.0 0.0 132-133 8.175 0.0 0.0 0.0 0.0 134-135 8.95 0.0 0.0 0.0 0.0 136-137 9.5875 0.0 0.0 0.0 0.0 138-139 10.287500000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CACAACC 10 0.006830828 145.0 7 GCTCTCT 10 0.006830828 145.0 145 >>END_MODULE Read 625286 spots for SRR7180099.sra Written 625286 spots for SRR7180099.sra Read 625286 spots for SRR7180099.sra Written 625286 spots for SRR7180099.sra Read 625286 spots for SRR7180099.sra Written 625286 spots for SRR7180099.sra Read 625286 spots for SRR7180099.sra Written 625286 spots for SRR7180099.sra Read 625286 spots for SRR7180099.sra Written 625286 spots for SRR7180099.sra Read 625286 spots for SRR7180099.sra Written 625286 spots for SRR7180099.sra Read 625286 spots for SRR7180099.sra Written 625286 spots for SRR7180099.sra Read 625286 spots for SRR7180099.sra Written 625286 spots for SRR7180099.sra Read 625286 spots for SRR7180099.sra Written 625286 spots for SRR7180099.sra Read 625286 spots for SRR7180099.sra Written 625286 spots for SRR7180099.sra Read 625286 spots for SRR7180099.sra Written 625286 spots for SRR7180099.sra Read 625286 spots for SRR7180099.sra Written 625286 spots for SRR7180099.sra Read 625286 spots for SRR7180099.sra Written 625286 spots for SRR7180099.sra Read 625286 spots for SRR7180099.sra Written 625286 spots for SRR7180099.sra Read 625286 spots for SRR7180099.sra Written 625286 spots for SRR7180099.sra Read 625286 spots for SRR7180099.sra Written 625286 spots for SRR7180099.sra Read 625286 spots for SRR7180099.sra Written 625286 spots for SRR7180099.sra Read 625286 spots for SRR7180099.sra Written 625286 spots for SRR7180099.sra Read 625292 spots for SRR7180099.sra Written 625292 spots for SRR7180099.sra Read 625286 spots for SRR7180099.sra Written 625286 spots for SRR7180099.sra SRR ids: ['SRR7180099.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_66qbnpwv SRR7180099.sra spots: 12505726 blocks: [[1, 625286], [625287, 1250572], [1250573, 1875858], [1875859, 2501144], [2501145, 3126430], [3126431, 3751716], [3751717, 4377002], [4377003, 5002288], [5002289, 5627574], [5627575, 6252860], [6252861, 6878146], [6878147, 7503432], [7503433, 8128718], [8128719, 8754004], [8754005, 9379290], [9379291, 10004576], [10004577, 10629862], [10629863, 11255148], [11255149, 11880434], [11880435, 12505726]] SRR7180099 file size 4216079 SRR7180099 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7180099 SRR7180099_1.fastq SRR7180099_2.fastq Input file: SRR7180099_1.fastq Paired file: SRR7180099_2.fastq trimmed: SRR7180099-trimmed-pair1.fastq, SRR7180099-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 19:31:46 2025 >> started Mon Feb 10 19:31:59 2025 >> done (13.373s) 12505726 read pairs processed; of these: 24244 ( 0.19%) short read pairs filtered out after trimming by size control 18103 ( 0.14%) empty read pairs filtered out after trimming by size control 12463379 (99.66%) read pairs available; of these: 5155586 (41.37%) trimmed read pairs available after processing 7307793 (58.63%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 1 0.00% 20 3 0.00% 21 6 0.00% 22 10 0.00% 23 6 0.00% 24 11 0.00% 25 12 0.00% 26 13 0.00% 27 20 0.00% 28 16 0.00% 29 8 0.00% 30 11 0.00% 31 10 0.00% 32 15 0.00% 33 12 0.00% 34 7 0.00% 35 12 0.00% 36 20 0.00% 37 11 0.00% 38 13 0.00% 39 15 0.00% 40 32 0.00% 41 31 0.00% 42 26 0.00% 43 21 0.00% 44 26 0.00% 45 51 0.00% 46 43 0.00% 47 70 0.00% 48 56 0.00% 49 57 0.00% 50 57 0.00% 51 122 0.00% 52 52 0.00% 53 70 0.00% 54 84 0.00% 55 135 0.00% 56 85 0.00% 57 103 0.00% 58 122 0.00% 59 120 0.00% 60 158 0.00% 61 181 0.00% 62 193 0.00% 63 184 0.00% 64 229 0.00% 65 294 0.00% 66 326 0.00% 67 374 0.00% 68 405 0.00% 69 490 0.00% 70 567 0.00% 71 615 0.00% 72 699 0.01% 73 806 0.01% 74 899 0.01% 75 1118 0.01% 76 1332 0.01% 77 1554 0.01% 78 1669 0.01% 79 1848 0.01% 80 2073 0.02% 81 2304 0.02% 82 2820 0.02% 83 3233 0.03% 84 4664 0.04% 85 5975 0.05% 86 6724 0.05% 87 8341 0.07% 88 8975 0.07% 89 9198 0.07% 90 9533 0.08% 91 9821 0.08% 92 10492 0.08% 93 10670 0.09% 94 10869 0.09% 95 11673 0.09% 96 12268 0.10% 97 13105 0.11% 98 13890 0.11% 99 14723 0.12% 100 15722 0.13% 101 16344 0.13% 102 17321 0.14% 103 18226 0.15% 104 19084 0.15% 105 20236 0.16% 106 21785 0.17% 107 23258 0.19% 108 23766 0.19% 109 25510 0.20% 110 26601 0.21% 111 27773 0.22% 112 28960 0.23% 113 30813 0.25% 114 31988 0.26% 115 33675 0.27% 116 34914 0.28% 117 35739 0.29% 118 37198 0.30% 119 38069 0.31% 120 39494 0.32% 121 41643 0.33% 122 42524 0.34% 123 43254 0.35% 124 43838 0.35% 125 45065 0.36% 126 46754 0.38% 127 48457 0.39% 128 49229 0.39% 129 50572 0.41% 130 52460 0.42% 131 54079 0.43% 132 55875 0.45% 133 57027 0.46% 134 58482 0.47% 135 60168 0.48% 136 61867 0.50% 137 64239 0.52% 138 66971 0.54% 139 69354 0.56% 140 72359 0.58% 141 75209 0.60% 142 79671 0.64% 143 83997 0.67% 144 90803 0.73% 145 100206 0.80% 146 113611 0.91% 147 137532 1.10% 148 187738 1.51% 149 341349 2.74% 150 2107886 16.91% 151 7307793 58.63% 12463379 reads passed initial QC criterion=sequence-density sequence-density=0.47 sequence-density-rank=1 fanout-score=2.94 fanout-score-rank=23 prefix-density=0.50 prefix-fanout=2.8 sequence=CCACATTTGCAGCCACTGCCACACTTGCA criterion=fanout-score sequence-density=0.03 sequence-density-rank=28 fanout-score=98.57 fanout-score-rank=1 prefix-density=0.26 prefix-fanout=12.8 sequence=TTGAAGAAAAACATTACGATTATTACATTACATGCGCAATTGGGATAAAAAGGCCCTTGAAGAAATACACGTCACTGTTATAGCACGCGCTTACTTATAGGTACAAATGCACAAAAGGCCAACACGGAGAAAATGGAACAAACTGGGCTTGATTTTCATCTTTAATACATCATCAAATGGCCAAAAGTAAAGCATCACAATCATCACTTCTTGAAAGGAATGGCTCT criterion=sequence-density sequence-density=0.87 sequence-density-rank=1 fanout-score=2.55 fanout-score-rank=26 prefix-density=0.88 prefix-fanout=2.5 sequence=ATGTACCCTGACTTAGGTTTCTCAGA criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=17.78 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=3.6 sequence=CTGGACATTAATTAGGGCTGAAAGCCCTAACTTAATGGACGGGAGGTATCCCAATAGGAGGTTTCCTCCTATGGTTTTCAAAACAATCACCATCATGCTATTAATGATATTAAAATCCCAACTATACCAAAGAATATCCCAATTATCCATAAAACTGTAACTAAGTGAGGCTCTCTCATTGGTTTATACTTCAATATAAGCCTTGGTAGGGATAGATAGCCACCTATATAGTATAGCTTCCCATCTTCTTTGAGAGTTGTTGGTTTATGCTCATCCCTACTCATAACCCCAGCACTTAGATATTTTAAAGAGGCATCTATCACATAAGGCATCATTATAACTAAAAATGGGATATATTCCTTATAAACTACTGCTAAGACAGCTAAGAAAGCTCCAATTGGTAGAGTTCCAACATCTCCTGGAAAAACCTTTGCTGGATATTTGTTAAATATCAATAGCCCTAAATAGGATGCAGAGAATATCAAAGCGGAAAA SRR7180099 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 19:32:49 Started mapping on | Feb 10 19:32:49 Finished on | Feb 10 19:35:29 Mapping speed, Million of reads per hour | 280.43 Number of input reads | 12463379 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 11116219 Uniquely mapped reads % | 89.19% Average mapped length | 291.26 Number of splices: Total | 8774174 Number of splices: Annotated (sjdb) | 8549824 Number of splices: GT/AG | 8616882 Number of splices: GC/AG | 114519 Number of splices: AT/AC | 7721 Number of splices: Non-canonical | 35052 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.05% Deletion average length | 2.80 Insertion rate per base | 0.03% Insertion average length | 2.54 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 291320 % of reads mapped to multiple loci | 2.34% Number of reads mapped to too many loci | 38054 % of reads mapped to too many loci | 0.31% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 8.10% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1082956 1082956 1082956 N_multimapping 291320 291320 291320 N_noFeature 361842 10973490 411695 N_ambiguous 146538 1036 53170 UnstrandedReadsAssigned:10607839 PositiveStrandReadsAssigned:141693 NegativeStrandReadsAssigned:10651354 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7180099 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7180099-trimmed-pair1.fastq SRR7180099-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,463,379 reads, 10,591,700 reads pseudoaligned [quant] estimated average fragment length: 210.234 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,163 rounds 52401 SRR7180099.ke.tsv 34699 SRR7180099.se.tsv 87100 total ==> SRR7180099.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1808.77 995 40.813 Potri.005G024800.1.v4.1 1035 825.766 982 88.2293 Potri.004G059700.1.v4.1 961 751.775 15 1.48034 Potri.007G009000.2.v4.1 1416 1206.77 0 0 Potri.003G141000.2.v4.1 2943 2733.77 704 19.106 Potri.016G087400.1.v4.1 270 89.1288 1031 858.22 Potri.015G069301.1.v4.1 564 356.194 0 0 Potri.010G195200.1.v4.1 1773 1563.77 499.939 23.7194 Potri.012G127500.1.v4.1 977 767.775 5275 509.738 ==> SRR7180099.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 48 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 583 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 167 SRR7180099 completed mapping pipeline successfully