Starting /dee2/code/volunteer_pipeline.sh SRR7180100 current disk space = 3057360809984 free memory = 1438262524 SRR7180100 SRAfilesize 5e90fd9fb6328bf404a8786e9bce8430 SRR7180100.sra SRR7180100.sra file validated SRR7180100 is paired end SRR7180100 is conventional basespace SRR7180100 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7180100_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.566 33.0 33.0 34.0 32.0 34.0 2 33.05025 34.0 33.0 34.0 32.0 34.0 3 33.16575 34.0 33.0 34.0 32.0 34.0 4 33.4555 34.0 33.0 34.0 33.0 34.0 5 33.41325 34.0 33.0 34.0 33.0 34.0 6 36.99875 38.0 37.0 38.0 35.0 38.0 7 37.46525 38.0 38.0 38.0 37.0 38.0 8 37.56825 38.0 38.0 38.0 37.0 38.0 9 37.7175 38.0 38.0 38.0 38.0 38.0 10-14 37.70555 38.0 38.0 38.0 38.0 38.0 15-19 37.7155 38.0 38.0 38.0 38.0 38.0 20-24 37.686699999999995 38.0 38.0 38.0 38.0 38.0 25-29 37.69199999999999 38.0 38.0 38.0 38.0 38.0 30-34 37.662 38.0 38.0 38.0 38.0 38.0 35-39 37.65195 38.0 38.0 38.0 38.0 38.0 40-44 37.60915 38.0 38.0 38.0 38.0 38.0 45-49 37.607150000000004 38.0 38.0 38.0 38.0 38.0 50-54 37.591899999999995 38.0 38.0 38.0 38.0 38.0 55-59 37.51245 38.0 38.0 38.0 38.0 38.0 60-64 37.4935 38.0 38.0 38.0 38.0 38.0 65-69 37.4966 38.0 38.0 38.0 37.8 38.0 70-74 37.42985 38.0 38.0 38.0 37.0 38.0 75-79 37.38875 38.0 38.0 38.0 37.0 38.0 80-84 37.33655 38.0 38.0 38.0 37.0 38.0 85-89 37.31805 38.0 38.0 38.0 37.0 38.0 90-94 37.261250000000004 38.0 38.0 38.0 37.0 38.0 95-99 37.18705 38.0 38.0 38.0 36.4 38.0 100-104 37.13705 38.0 38.0 38.0 36.0 38.0 105-109 36.9977 38.0 38.0 38.0 36.0 38.0 110-114 36.90455 38.0 38.0 38.0 35.4 38.0 115-119 36.7505 38.0 38.0 38.0 35.0 38.0 120-124 36.72115 38.0 38.0 38.0 35.0 38.0 125-129 36.581849999999996 38.0 38.0 38.0 34.8 38.0 130-134 36.3725 38.0 38.0 38.0 34.2 38.0 135-139 36.1486 38.0 38.0 38.0 33.8 38.0 140-144 35.98715 38.0 37.8 38.0 33.2 38.0 145-149 35.64399999999999 38.0 36.8 38.0 33.0 38.0 150-151 32.743750000000006 37.0 33.5 38.0 17.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 2.0 11 0.0 12 0.0 13 2.0 14 1.0 15 0.0 16 0.0 17 0.0 18 2.0 19 1.0 20 0.0 21 1.0 22 5.0 23 2.0 24 5.0 25 9.0 26 5.0 27 11.0 28 11.0 29 17.0 30 21.0 31 34.0 32 27.0 33 56.0 34 85.0 35 148.0 36 390.0 37 3165.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.263892546747435 13.457993152488806 13.668685804582564 38.609428496181195 2 21.15 16.6 37.85 24.4 3 20.075000000000003 21.224999999999998 25.95 32.75 4 21.7 30.225 23.1 24.975 5 22.85 29.975 25.424999999999997 21.75 6 19.35 32.9 26.200000000000003 21.55 7 14.774999999999999 23.525 42.25 19.45 8 18.25 25.474999999999998 30.8 25.474999999999998 9 18.825 23.925 32.925 24.325 10-14 19.82 28.73 27.425 24.025 15-19 20.395 27.93 28.07 23.605 20-24 20.215 27.865000000000002 28.360000000000003 23.56 25-29 20.29 28.475 27.705000000000002 23.53 30-34 20.674999999999997 27.665 27.810000000000002 23.849999999999998 35-39 21.185000000000002 27.800000000000004 27.474999999999998 23.54 40-44 20.71 27.834999999999997 27.860000000000003 23.595 45-49 20.32 27.084999999999997 28.645 23.95 50-54 20.745 27.794999999999998 27.79 23.669999999999998 55-59 21.115000000000002 27.76 27.625 23.5 60-64 20.44 27.855 27.565 24.14 65-69 20.669999999999998 27.92 27.915 23.494999999999997 70-74 20.435 27.61 27.35 24.605 75-79 20.595 27.950000000000003 27.200000000000003 24.255 80-84 20.615 27.474999999999998 27.655 24.255 85-89 20.385 27.665 28.299999999999997 23.65 90-94 20.294999999999998 27.400000000000002 27.915 24.39 95-99 20.745 27.295 28.605000000000004 23.355 100-104 21.02 26.985 27.894999999999996 24.099999999999998 105-109 21.025 27.665 27.395000000000003 23.915 110-114 21.5 27.63 27.27 23.599999999999998 115-119 21.055 27.74 27.505000000000003 23.7 120-124 20.485 28.22 27.33 23.965 125-129 21.38 26.979999999999997 27.560000000000002 24.08 130-134 21.335 27.985 26.77 23.91 135-139 21.2 27.52 27.38 23.9 140-144 21.365000000000002 28.185 26.669999999999998 23.78 145-149 21.355 28.07 26.625 23.95 150-151 21.25 27.6625 27.3 23.7875 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 3.0 1 2.5 2 1.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 0.5 22 1.0 23 1.5 24 2.0 25 3.0 26 2.5 27 2.5 28 6.5 29 8.5 30 13.0 31 17.0 32 23.0 33 34.0 34 42.0 35 54.5 36 79.0 37 111.0 38 141.5 39 161.5 40 194.0 41 231.0 42 236.5 43 237.5 44 270.5 45 283.0 46 261.5 47 259.0 48 226.0 49 185.5 50 162.0 51 137.5 52 126.0 53 107.0 54 79.5 55 61.0 56 49.0 57 36.5 58 30.5 59 23.0 60 14.5 61 14.0 62 16.0 63 13.0 64 9.5 65 5.5 66 4.0 67 4.0 68 4.0 69 3.0 70 1.5 71 1.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 5.075 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.425 #Duplication Level Percentage of deduplicated Percentage of total 1 99.47196379180286 98.9 2 0.4777470455116922 0.95 3 0.050289162685441285 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.1375 0.0 0.0 0.0 0.0 90-91 0.16249999999999998 0.0 0.0 0.0 0.0 92-93 0.225 0.0 0.0 0.0 0.0 94-95 0.2625 0.0 0.0 0.0 0.0 96-97 0.32499999999999996 0.0 0.0 0.0 0.0 98-99 0.4375 0.0 0.0 0.0 0.0 100-101 0.575 0.0 0.0 0.0 0.0 102-103 0.6375 0.0 0.0 0.0 0.0 104-105 0.7625 0.0 0.0 0.0 0.0 106-107 1.0 0.0 0.0 0.0 0.0 108-109 1.275 0.0 0.0 0.0 0.0 110-111 1.6 0.0 0.0 0.0 0.0 112-113 2.0 0.0 0.0 0.0 0.0 114-115 2.35 0.0 0.0 0.0 0.0 116-117 2.7375 0.0 0.0 0.0 0.0 118-119 3.125 0.0 0.0 0.0 0.0 120-121 3.45 0.0 0.0 0.0 0.0 122-123 3.8875 0.0 0.0 0.0 0.0 124-125 4.2625 0.0 0.0 0.0 0.0 126-127 4.725 0.0 0.0 0.0 0.0 128-129 5.225 0.0 0.0 0.0 0.0 130-131 5.95 0.0 0.0 0.0 0.0 132-133 6.625 0.0 0.0 0.0 0.0 134-135 7.125 0.0 0.0 0.0 0.0 136-137 7.637499999999999 0.0 0.0 0.0 0.0 138-139 8.175 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7180100 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7180100_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.20075 34.0 33.0 34.0 33.0 34.0 2 33.20275 34.0 33.0 34.0 33.0 34.0 3 33.282 34.0 33.0 34.0 33.0 34.0 4 33.23425 34.0 33.0 34.0 33.0 34.0 5 33.245 34.0 33.0 34.0 33.0 34.0 6 37.45775 38.0 38.0 38.0 38.0 38.0 7 37.4735 38.0 38.0 38.0 38.0 38.0 8 37.44925 38.0 38.0 38.0 38.0 38.0 9 37.39925 38.0 38.0 38.0 38.0 38.0 10-14 37.386250000000004 38.0 38.0 38.0 38.0 38.0 15-19 37.401650000000004 38.0 38.0 38.0 38.0 38.0 20-24 37.37230000000001 38.0 38.0 38.0 38.0 38.0 25-29 37.36805 38.0 38.0 38.0 38.0 38.0 30-34 37.38685 38.0 38.0 38.0 38.0 38.0 35-39 37.299 38.0 38.0 38.0 37.6 38.0 40-44 37.2842 38.0 38.0 38.0 37.2 38.0 45-49 37.2851 38.0 38.0 38.0 37.4 38.0 50-54 37.2573 38.0 38.0 38.0 37.0 38.0 55-59 37.2496 38.0 38.0 38.0 37.0 38.0 60-64 37.187200000000004 38.0 38.0 38.0 37.0 38.0 65-69 37.12955 38.0 38.0 38.0 36.8 38.0 70-74 37.06995 38.0 38.0 38.0 36.8 38.0 75-79 37.07275 38.0 38.0 38.0 36.6 38.0 80-84 36.94985 38.0 38.0 38.0 36.0 38.0 85-89 36.773700000000005 38.0 38.0 38.0 36.0 38.0 90-94 36.7142 38.0 38.0 38.0 35.4 38.0 95-99 36.65525 38.0 38.0 38.0 35.0 38.0 100-104 36.5854 38.0 38.0 38.0 34.8 38.0 105-109 36.294200000000004 38.0 38.0 38.0 34.0 38.0 110-114 36.2564 38.0 38.0 38.0 34.0 38.0 115-119 36.12365 38.0 38.0 38.0 33.8 38.0 120-124 35.9149 38.0 37.2 38.0 33.0 38.0 125-129 35.709199999999996 38.0 37.0 38.0 32.4 38.0 130-134 35.5186 38.0 36.4 38.0 31.8 38.0 135-139 35.14625 38.0 36.0 38.0 30.2 38.0 140-144 34.83995 38.0 36.0 38.0 28.2 38.0 145-149 34.4169 38.0 35.6 38.0 27.4 38.0 150-151 30.35025 35.5 28.5 38.0 11.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 2.0 4 1.0 5 1.0 6 1.0 7 1.0 8 0.0 9 1.0 10 3.0 11 4.0 12 1.0 13 0.0 14 1.0 15 4.0 16 2.0 17 1.0 18 5.0 19 3.0 20 7.0 21 4.0 22 7.0 23 7.0 24 8.0 25 9.0 26 13.0 27 15.0 28 21.0 29 23.0 30 33.0 31 38.0 32 51.0 33 70.0 34 112.0 35 198.0 36 537.0 37 2811.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.825 14.174999999999999 19.3 30.7 2 24.7 23.3 34.949999999999996 17.05 3 21.75 27.175 29.625 21.45 4 24.45 33.575 22.975 19.0 5 24.125 34.300000000000004 24.224999999999998 17.349999999999998 6 19.125 36.35 25.1 19.425 7 19.1 19.35 40.925 20.625 8 21.25 22.575 28.375 27.800000000000004 9 21.7 25.8 28.249999999999996 24.25 10-14 23.705000000000002 27.93 25.71 22.655 15-19 22.98 28.21 27.584999999999997 21.224999999999998 20-24 22.845 28.560000000000002 27.27 21.325 25-29 23.09 28.42 26.889999999999997 21.6 30-34 23.18 27.93 27.029999999999998 21.86 35-39 23.44 27.894999999999996 27.24 21.425 40-44 23.955000000000002 28.09 27.029999999999998 20.925 45-49 24.04 27.800000000000004 27.389999999999997 20.77 50-54 23.669999999999998 28.689999999999998 26.8 20.84 55-59 23.785 27.605 27.345000000000002 21.265 60-64 23.585 27.810000000000002 27.705000000000002 20.9 65-69 23.86 27.825 26.85 21.465 70-74 23.655 28.305000000000003 26.455000000000002 21.584999999999997 75-79 23.205000000000002 27.884999999999998 27.310000000000002 21.6 80-84 23.845 27.994999999999997 26.88 21.279999999999998 85-89 23.735 28.105000000000004 26.8 21.36 90-94 23.630000000000003 28.395 27.045 20.93 95-99 24.14 27.93 27.16 20.77 100-104 23.79 28.060000000000002 27.16 20.990000000000002 105-109 24.375 27.67 26.939999999999998 21.015 110-114 24.21 28.28 26.91 20.599999999999998 115-119 24.505 27.92 26.805 20.77 120-124 24.75 28.084999999999997 27.165 20.0 125-129 24.97 28.21 26.650000000000002 20.169999999999998 130-134 25.355 27.810000000000002 26.445 20.39 135-139 24.845 28.825 26.25 20.080000000000002 140-144 25.224999999999998 28.095 26.77 19.91 145-149 25.869999999999997 28.535 26.534999999999997 19.06 150-151 25.8625 28.675 26.0375 19.425 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 1.0 15 1.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.0 22 1.0 23 0.0 24 0.0 25 1.0 26 1.0 27 1.5 28 4.5 29 5.0 30 6.0 31 9.5 32 17.5 33 23.0 34 29.5 35 45.5 36 69.0 37 95.5 38 113.0 39 143.0 40 185.0 41 224.5 42 253.0 43 261.5 44 288.5 45 302.0 46 289.5 47 278.0 48 249.5 49 217.0 50 180.0 51 142.5 52 114.0 53 92.0 54 74.0 55 63.5 56 53.0 57 40.5 58 31.5 59 18.5 60 12.0 61 10.0 62 10.5 63 11.0 64 9.5 65 8.0 66 3.0 67 2.0 68 2.0 69 2.5 70 2.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.125 #Duplication Level Percentage of deduplicated Percentage of total 1 99.16771752837327 98.3 2 0.7818411097099622 1.55 3 0.05044136191677175 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.1375 0.0 0.0 0.0 0.0 90-91 0.16249999999999998 0.0 0.0 0.0 0.0 92-93 0.225 0.0 0.0 0.0 0.0 94-95 0.2625 0.0 0.0 0.0 0.0 96-97 0.32499999999999996 0.0 0.0 0.0 0.0 98-99 0.425 0.0 0.0 0.0 0.0 100-101 0.55 0.0 0.0 0.0 0.0 102-103 0.6125 0.0 0.0 0.0 0.0 104-105 0.7375 0.0 0.0 0.0 0.0 106-107 0.9750000000000001 0.0 0.0 0.0 0.0 108-109 1.2374999999999998 0.0 0.0 0.0 0.0 110-111 1.525 0.0 0.0 0.0 0.0 112-113 1.925 0.0 0.0 0.0 0.0 114-115 2.275 0.0 0.0 0.0 0.0 116-117 2.6625 0.0 0.0 0.0 0.0 118-119 3.05 0.0 0.0 0.0 0.0 120-121 3.375 0.0 0.0 0.0 0.0 122-123 3.7875 0.0 0.0 0.0 0.0 124-125 4.1375 0.0 0.0 0.0 0.0 126-127 4.6 0.0 0.0 0.0 0.0 128-129 5.112500000000001 0.0 0.0 0.0 0.0 130-131 5.825 0.0 0.0 0.0 0.0 132-133 6.5 0.0 0.0 0.0 0.0 134-135 6.975 0.0 0.0 0.0 0.0 136-137 7.512499999999999 0.0 0.0 0.0 0.0 138-139 8.0625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGGACTC 10 0.006830828 145.0 3 TGGAGCC 10 0.006830828 145.0 2 >>END_MODULE Read 730778 spots for SRR7180100.sra Written 730778 spots for SRR7180100.sra Read 730778 spots for SRR7180100.sra Written 730778 spots for SRR7180100.sra Read 730778 spots for SRR7180100.sra Written 730778 spots for SRR7180100.sra Read 730778 spots for SRR7180100.sra Written 730778 spots for SRR7180100.sra Read 730778 spots for SRR7180100.sra Written 730778 spots for SRR7180100.sra Read 730778 spots for SRR7180100.sra Written 730778 spots for SRR7180100.sra Read 730778 spots for SRR7180100.sra Written 730778 spots for SRR7180100.sra Read 730778 spots for SRR7180100.sra Written 730778 spots for SRR7180100.sra Read 730778 spots for SRR7180100.sra Written 730778 spots for SRR7180100.sra Read 730778 spots for SRR7180100.sra Written 730778 spots for SRR7180100.sra Read 730778 spots for SRR7180100.sra Written 730778 spots for SRR7180100.sra Read 730778 spots for SRR7180100.sra Written 730778 spots for SRR7180100.sra Read 730783 spots for SRR7180100.sra Written 730783 spots for SRR7180100.sra Read 730778 spots for SRR7180100.sra Written 730778 spots for SRR7180100.sra Read 730778 spots for SRR7180100.sra Written 730778 spots for SRR7180100.sra Read 730778 spots for SRR7180100.sra Written 730778 spots for SRR7180100.sra Read 730778 spots for SRR7180100.sra Written 730778 spots for SRR7180100.sra Read 730778 spots for SRR7180100.sra Written 730778 spots for SRR7180100.sra Read 730778 spots for SRR7180100.sra Written 730778 spots for SRR7180100.sra Read 730778 spots for SRR7180100.sra Written 730778 spots for SRR7180100.sra SRR ids: ['SRR7180100.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_igwz4m64 SRR7180100.sra spots: 14615565 blocks: [[1, 730778], [730779, 1461556], [1461557, 2192334], [2192335, 2923112], [2923113, 3653890], [3653891, 4384668], [4384669, 5115446], [5115447, 5846224], [5846225, 6577002], [6577003, 7307780], [7307781, 8038558], [8038559, 8769336], [8769337, 9500114], [9500115, 10230892], [10230893, 10961670], [10961671, 11692448], [11692449, 12423226], [12423227, 13154004], [13154005, 13884782], [13884783, 14615565]] SRR7180100 file size 4931035 SRR7180100 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7180100 SRR7180100_1.fastq SRR7180100_2.fastq Input file: SRR7180100_1.fastq Paired file: SRR7180100_2.fastq trimmed: SRR7180100-trimmed-pair1.fastq, SRR7180100-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 18:50:08 2025 >> started Mon Feb 10 18:50:25 2025 >> done (16.952s) 14615565 read pairs processed; of these: 24558 ( 0.17%) short read pairs filtered out after trimming by size control 15496 ( 0.11%) empty read pairs filtered out after trimming by size control 14575511 (99.73%) read pairs available; of these: 5521375 (37.88%) trimmed read pairs available after processing 9054136 (62.12%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 5 0.00% 20 3 0.00% 21 1 0.00% 22 4 0.00% 23 7 0.00% 24 11 0.00% 25 5 0.00% 26 3 0.00% 27 4 0.00% 28 9 0.00% 29 4 0.00% 30 11 0.00% 31 5 0.00% 32 5 0.00% 33 4 0.00% 34 10 0.00% 35 4 0.00% 36 5 0.00% 37 7 0.00% 38 9 0.00% 39 6 0.00% 40 14 0.00% 41 8 0.00% 42 10 0.00% 43 16 0.00% 44 11 0.00% 45 15 0.00% 46 13 0.00% 47 23 0.00% 48 24 0.00% 49 28 0.00% 50 31 0.00% 51 28 0.00% 52 53 0.00% 53 57 0.00% 54 59 0.00% 55 54 0.00% 56 59 0.00% 57 56 0.00% 58 78 0.00% 59 80 0.00% 60 108 0.00% 61 123 0.00% 62 135 0.00% 63 161 0.00% 64 152 0.00% 65 190 0.00% 66 173 0.00% 67 274 0.00% 68 263 0.00% 69 314 0.00% 70 404 0.00% 71 445 0.00% 72 497 0.00% 73 645 0.00% 74 677 0.00% 75 866 0.01% 76 925 0.01% 77 1116 0.01% 78 1241 0.01% 79 1366 0.01% 80 1493 0.01% 81 1742 0.01% 82 2018 0.01% 83 2421 0.02% 84 3521 0.02% 85 4616 0.03% 86 5004 0.03% 87 5513 0.04% 88 5986 0.04% 89 6329 0.04% 90 6634 0.05% 91 7082 0.05% 92 7351 0.05% 93 7768 0.05% 94 8307 0.06% 95 9099 0.06% 96 9722 0.07% 97 10634 0.07% 98 11132 0.08% 99 12170 0.08% 100 12980 0.09% 101 13360 0.09% 102 14058 0.10% 103 14853 0.10% 104 15881 0.11% 105 16883 0.12% 106 18069 0.12% 107 19358 0.13% 108 20448 0.14% 109 21362 0.15% 110 22721 0.16% 111 23685 0.16% 112 25080 0.17% 113 25755 0.18% 114 27129 0.19% 115 28514 0.20% 116 29300 0.20% 117 30928 0.21% 118 32464 0.22% 119 34251 0.23% 120 36091 0.25% 121 37434 0.26% 122 38025 0.26% 123 38903 0.27% 124 40559 0.28% 125 41434 0.28% 126 43116 0.30% 127 45342 0.31% 128 46945 0.32% 129 48213 0.33% 130 49807 0.34% 131 51875 0.36% 132 53918 0.37% 133 56082 0.38% 134 57835 0.40% 135 59898 0.41% 136 61573 0.42% 137 64630 0.44% 138 67323 0.46% 139 69788 0.48% 140 73384 0.50% 141 77202 0.53% 142 82091 0.56% 143 87272 0.60% 144 95782 0.66% 145 107058 0.73% 146 122563 0.84% 147 150951 1.04% 148 210537 1.44% 149 392432 2.69% 150 2526775 17.34% 151 9054136 62.12% 14575511 reads passed initial QC criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=4.13 fanout-score-rank=16 prefix-density=0.30 prefix-fanout=3.4 sequence=CCACATTTGCAGCCACTGCC criterion=fanout-score sequence-density=0.02 sequence-density-rank=37 fanout-score=31.14 fanout-score-rank=1 prefix-density=0.13 prefix-fanout=4.3 sequence=AACTCCAGCAGGTTGATAGAAAGTACTTTACAGGGCGAGCACAGTTCATGGTCTTCACTCTTCAAGGTAAAGTATAAGCTCCACACTTGTAGCCCACAGGACGATCAGCAATGTTGCATCGTTTGGGAATGGTCATTGCAATTTCTGGCTTGATTCCAGAGCTCTTAGCAGTGTTGGAAAGCATAACAGCACAAAGGCACGCTGGGTTCTGTCCAATTTTCTTCACCCGAGCGCAGCACTGGCTCGAAACTGAAGAATTCTCATCCTGTGCTGCTGATGCACAAGGAGCCATCTTGAAAGCCTCCATGTCAGGAGTGGTGTTTTTCCCACATTCACCAGCCCCGTCAACTTGATTGA criterion=sequence-density sequence-density=0.34 sequence-density-rank=1 fanout-score=2.19 fanout-score-rank=34 prefix-density=0.35 prefix-fanout=2.1 sequence=GGCAGTGGCTGCAAATGTGGCATGTACCCTGACTTAGGTTTCTCAGA criterion=fanout-score sequence-density=0.08 sequence-density-rank=24 fanout-score=103.68 fanout-score-rank=1 prefix-density=0.42 prefix-fanout=18.9 sequence=TGAGAAGAAGGAT SRR7180100 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 18:51:20 Started mapping on | Feb 10 18:51:20 Finished on | Feb 10 18:54:13 Mapping speed, Million of reads per hour | 303.31 Number of input reads | 14575511 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 12997298 Uniquely mapped reads % | 89.17% Average mapped length | 293.83 Number of splices: Total | 12842951 Number of splices: Annotated (sjdb) | 12604524 Number of splices: GT/AG | 12631224 Number of splices: GC/AG | 166140 Number of splices: AT/AC | 10215 Number of splices: Non-canonical | 35372 Mismatch rate per base, % | 0.32% Deletion rate per base | 0.03% Deletion average length | 2.68 Insertion rate per base | 0.02% Insertion average length | 2.75 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 356721 % of reads mapped to multiple loci | 2.45% Number of reads mapped to too many loci | 52501 % of reads mapped to too many loci | 0.36% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 7.86% % of reads unmapped: other | 0.16% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1242911 1242911 1242911 N_multimapping 356721 356721 356721 N_noFeature 301120 12869395 366797 N_ambiguous 129243 744 66496 UnstrandedReadsAssigned:12566935 PositiveStrandReadsAssigned:127159 NegativeStrandReadsAssigned:12564005 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7180100 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7180100-trimmed-pair1.fastq SRR7180100-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,575,511 reads, 12,553,477 reads pseudoaligned [quant] estimated average fragment length: 219.453 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,153 rounds 52401 SRR7180100.ke.tsv 34699 SRR7180100.se.tsv 87100 total ==> SRR7180100.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1799.55 1033 43.5422 Potri.005G024800.1.v4.1 1035 816.547 159 14.7703 Potri.004G059700.1.v4.1 961 742.547 16 1.63444 Potri.007G009000.2.v4.1 1416 1197.55 0 0 Potri.003G141000.2.v4.1 2943 2724.55 453.208 12.6176 Potri.016G087400.1.v4.1 270 84.9162 1049 937.039 Potri.015G069301.1.v4.1 564 347.079 0 0 Potri.010G195200.1.v4.1 1773 1554.55 388 18.9322 Potri.012G127500.1.v4.1 977 758.547 5544 554.388 ==> SRR7180100.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 7 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 310 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 514 SRR7180100 completed mapping pipeline successfully