Starting /dee2/code/volunteer_pipeline.sh SRR7180101 current disk space = 3057233555456 free memory = 887898324 SRR7180101 SRAfilesize 84542656690ab65c8467ca46ea7b84c6 SRR7180101.sra SRR7180101.sra file validated SRR7180101 is paired end SRR7180101 is conventional basespace SRR7180101 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7180101_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 27.71075 32.0 18.0 33.0 18.0 33.0 2 29.927 32.0 27.0 33.0 18.0 34.0 3 31.1845 33.0 31.0 33.0 28.0 33.0 4 31.1525 32.0 32.0 33.0 28.0 33.0 5 32.1655 33.0 32.0 33.0 31.0 33.0 6 36.41275 38.0 37.0 38.0 34.0 38.0 7 37.138 38.0 38.0 38.0 36.0 38.0 8 37.494 38.0 38.0 38.0 37.0 38.0 9 37.5205 38.0 38.0 38.0 37.0 38.0 10-14 37.57280000000001 38.0 38.0 38.0 37.8 38.0 15-19 37.61725 38.0 38.0 38.0 38.0 38.0 20-24 37.555600000000005 38.0 38.0 38.0 38.0 38.0 25-29 37.551550000000006 38.0 38.0 38.0 38.0 38.0 30-34 37.542899999999996 38.0 38.0 38.0 38.0 38.0 35-39 37.474000000000004 38.0 38.0 38.0 38.0 38.0 40-44 37.45215 38.0 38.0 38.0 37.6 38.0 45-49 37.47985 38.0 38.0 38.0 37.6 38.0 50-54 37.412850000000006 38.0 38.0 38.0 37.2 38.0 55-59 37.299749999999996 38.0 38.0 38.0 37.0 38.0 60-64 37.291399999999996 38.0 38.0 38.0 37.0 38.0 65-69 36.8837 38.0 38.0 38.0 36.2 38.0 70-74 36.8452 38.0 38.0 38.0 36.0 38.0 75-79 37.007450000000006 38.0 38.0 38.0 36.0 38.0 80-84 37.0234 38.0 38.0 38.0 36.0 38.0 85-89 36.96085 38.0 38.0 38.0 36.0 38.0 90-94 36.79645000000001 38.0 38.0 38.0 35.0 38.0 95-99 36.705600000000004 38.0 38.0 38.0 34.6 38.0 100-104 36.44445 38.0 38.0 38.0 34.0 38.0 105-109 36.4387 38.0 37.8 38.0 33.8 38.0 110-114 36.11045 38.0 37.4 38.0 33.0 38.0 115-119 36.03724999999999 38.0 37.0 38.0 33.0 38.0 120-124 35.77605 38.0 37.0 38.0 31.4 38.0 125-129 35.52745 38.0 36.0 38.0 30.6 38.0 130-134 35.25124999999999 38.0 35.8 38.0 29.2 38.0 135-139 34.8534 38.0 35.0 38.0 27.8 38.0 140-144 34.48365 38.0 34.6 38.0 26.8 38.0 145-149 33.23475 38.0 34.0 38.0 17.8 38.0 150-151 28.715625000000003 35.5 27.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 3.0 11 0.0 12 1.0 13 0.0 14 0.0 15 1.0 16 1.0 17 1.0 18 4.0 19 4.0 20 2.0 21 2.0 22 3.0 23 5.0 24 4.0 25 16.0 26 14.0 27 14.0 28 19.0 29 36.0 30 30.0 31 68.0 32 61.0 33 94.0 34 180.0 35 314.0 36 849.0 37 2274.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.33333333333333 17.756073127973952 10.693713999499122 38.216879539193584 2 19.1 24.25 33.7 22.95 3 19.55 28.625 26.400000000000002 25.424999999999997 4 23.525 32.05 23.799999999999997 20.625 5 21.625 36.15 23.825 18.4 6 17.9 37.675 23.7 20.724999999999998 7 13.425 22.25 44.925 19.400000000000002 8 17.075000000000003 22.325 30.975 29.625 9 18.099999999999998 23.025000000000002 31.85 27.025 10-14 20.47 28.645 26.68 24.205 15-19 20.119999999999997 28.435 27.525 23.919999999999998 20-24 20.030015007503753 28.044022011005502 28.53926963481741 23.386693346673336 25-29 19.46 28.42 28.499999999999996 23.62 30-34 19.67 28.449999999999996 28.155 23.724999999999998 35-39 19.685 28.305000000000003 27.575 24.435000000000002 40-44 20.39 27.99 27.88 23.74 45-49 19.625 28.144999999999996 28.465 23.765 50-54 19.905 28.199999999999996 28.235 23.66 55-59 20.23 28.46 27.725 23.585 60-64 19.705838211016058 28.315573565461005 28.115463504927714 23.863124718595227 65-69 20.44374810472051 27.73678358435257 27.822702921257452 23.996765389669463 70-74 20.89973774460359 27.708291305224936 27.894896106516036 23.497074843655437 75-79 20.560000000000002 27.279999999999998 28.355000000000004 23.805 80-84 19.855 26.950000000000003 29.28 23.915 85-89 20.39 28.044999999999998 27.61 23.955000000000002 90-94 20.005 28.455000000000002 27.97 23.57 95-99 20.080000000000002 27.775 28.299999999999997 23.845 100-104 20.036010803240973 28.333500050015004 28.223467040112034 23.407022106631988 105-109 20.525 28.01 28.125 23.34 110-114 20.551303216769224 28.43563960178098 27.675221371754468 23.33783580969533 115-119 20.66 28.389999999999997 27.775 23.175 120-124 20.724999999999998 28.215 27.185 23.875 125-129 20.595 28.055000000000003 27.91 23.44 130-134 20.785 28.189999999999998 27.605 23.419999999999998 135-139 21.12 27.96 27.16 23.76 140-144 21.310000000000002 27.725 27.02 23.945 145-149 21.315 27.644999999999996 26.965 24.075 150-151 21.0625 27.075 27.275 24.587500000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 1.0 17 0.5 18 0.0 19 0.0 20 0.5 21 1.5 22 2.5 23 3.5 24 3.0 25 4.5 26 5.0 27 3.0 28 7.5 29 16.0 30 21.0 31 19.5 32 28.0 33 41.0 34 58.0 35 67.5 36 84.5 37 113.0 38 133.0 39 161.0 40 179.5 41 211.5 42 249.5 43 255.5 44 275.0 45 291.5 46 279.5 47 275.0 48 241.5 49 192.5 50 170.5 51 161.5 52 127.0 53 86.0 54 65.5 55 46.5 56 34.0 57 20.5 58 13.0 59 16.0 60 11.5 61 5.5 62 4.5 63 2.5 64 1.5 65 2.0 66 2.5 67 1.5 68 1.0 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.17500000000000002 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.05 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.055 65-69 1.0699999999999998 70-74 0.86 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.03 105-109 0.0 110-114 0.055 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69909729187563 99.4 2 0.3009027081243731 0.6 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.037500000000000006 0.0 0.0 0.0 0.0 80-81 0.0625 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1875 0.0 0.0 0.0 0.0 88-89 0.21250000000000002 0.0 0.0 0.0 0.0 90-91 0.275 0.0 0.0 0.0 0.0 92-93 0.325 0.0 0.0 0.0 0.0 94-95 0.3875 0.0 0.0 0.0 0.0 96-97 0.4125 0.0 0.0 0.0 0.0 98-99 0.475 0.0 0.0 0.0 0.0 100-101 0.5125 0.0 0.0 0.0 0.0 102-103 0.6 0.0 0.0 0.0 0.0 104-105 0.65 0.0 0.0 0.0 0.0 106-107 0.7375 0.0 0.0 0.0 0.0 108-109 0.925 0.0 0.0 0.0 0.0 110-111 1.1375 0.0 0.0 0.0 0.0 112-113 1.3125 0.0 0.0 0.0 0.0 114-115 1.5125 0.0 0.0 0.0 0.0 116-117 1.7375 0.0 0.0 0.0 0.0 118-119 1.9874999999999998 0.0 0.0 0.0 0.0 120-121 2.1875 0.0 0.0 0.0 0.0 122-123 2.5 0.0 0.0 0.0 0.0 124-125 2.8 0.0 0.0 0.0 0.0 126-127 3.1375 0.0 0.0 0.0 0.0 128-129 3.4000000000000004 0.0 0.0 0.0 0.0 130-131 3.875 0.0 0.0 0.0 0.0 132-133 4.275 0.0 0.0 0.0 0.0 134-135 4.9125 0.0 0.0 0.0 0.0 136-137 5.15 0.0 0.0 0.0 0.0 138-139 5.5375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7180101 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7180101_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.84525 34.0 33.0 34.0 32.0 34.0 2 32.8865 34.0 33.0 34.0 32.0 34.0 3 32.913 34.0 33.0 34.0 33.0 34.0 4 32.912 34.0 33.0 34.0 33.0 34.0 5 32.8905 34.0 33.0 34.0 33.0 34.0 6 37.03575 38.0 38.0 38.0 38.0 38.0 7 37.01575 38.0 38.0 38.0 38.0 38.0 8 37.0345 38.0 38.0 38.0 38.0 38.0 9 36.9375 38.0 38.0 38.0 37.0 38.0 10-14 36.92545 38.0 38.0 38.0 37.0 38.0 15-19 37.2026 38.0 38.0 38.0 37.2 38.0 20-24 37.1876 38.0 38.0 38.0 37.2 38.0 25-29 37.258799999999994 38.0 38.0 38.0 37.6 38.0 30-34 37.2449 38.0 38.0 38.0 38.0 38.0 35-39 37.208549999999995 38.0 38.0 38.0 37.2 38.0 40-44 37.0841 38.0 38.0 38.0 37.0 38.0 45-49 37.1359 38.0 38.0 38.0 37.0 38.0 50-54 37.10435 38.0 38.0 38.0 37.0 38.0 55-59 37.088 38.0 38.0 38.0 37.0 38.0 60-64 36.95465 38.0 38.0 38.0 36.6 38.0 65-69 36.836650000000006 38.0 38.0 38.0 35.8 38.0 70-74 36.9522 38.0 38.0 38.0 36.0 38.0 75-79 36.86995 38.0 38.0 38.0 36.0 38.0 80-84 36.77205 38.0 38.0 38.0 36.0 38.0 85-89 36.6682 38.0 38.0 38.0 35.2 38.0 90-94 36.644000000000005 38.0 38.0 38.0 35.2 38.0 95-99 36.42415 38.0 38.0 38.0 34.2 38.0 100-104 36.29345 38.0 38.0 38.0 33.8 38.0 105-109 36.2275 38.0 38.0 38.0 34.0 38.0 110-114 36.034299999999995 38.0 38.0 38.0 33.4 38.0 115-119 35.847699999999996 38.0 37.4 38.0 32.8 38.0 120-124 35.63505 38.0 36.8 38.0 31.6 38.0 125-129 35.4563 38.0 36.4 38.0 31.0 38.0 130-134 35.17605 38.0 36.0 38.0 29.6 38.0 135-139 34.613749999999996 38.0 35.4 38.0 26.8 38.0 140-144 34.27095 38.0 34.0 38.0 26.0 38.0 145-149 33.377250000000004 38.0 33.0 38.0 20.6 38.0 150-151 28.270125 35.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 8.0 3 2.0 4 0.0 5 3.0 6 4.0 7 0.0 8 1.0 9 3.0 10 1.0 11 1.0 12 0.0 13 4.0 14 4.0 15 4.0 16 2.0 17 4.0 18 1.0 19 2.0 20 5.0 21 3.0 22 6.0 23 10.0 24 15.0 25 12.0 26 12.0 27 23.0 28 29.0 29 33.0 30 34.0 31 45.0 32 75.0 33 90.0 34 151.0 35 227.0 36 613.0 37 2573.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.92978024753726 15.96362717858045 15.332154584491034 26.77443798939126 2 25.25864244259399 23.088569265707797 33.3585667423669 18.294221549331315 3 20.711402623612514 27.0686175580222 31.231079717457117 20.98890010090817 4 24.52687358062074 34.5697703759778 21.524097905627052 19.379258137774414 5 24.829674489023468 36.765076961897556 21.59979813272773 16.80545041635125 6 18.74527588813303 37.66691861929957 22.474174855127234 21.11363063744016 7 18.734241048915784 17.170953101361576 41.704488149268784 22.390317700453856 8 20.71662881655312 23.31566994700984 27.580116073681555 28.387585162755492 9 21.634615384615387 25.55668016194332 28.41599190283401 24.392712550607285 10-14 23.707070707070706 27.979797979797983 26.32323232323232 21.98989898989899 15-19 23.27698309492848 27.97339201760528 27.448234470341106 21.301390417125138 20-24 23.380000000000003 28.305000000000003 27.305 21.01 25-29 22.845 28.88 26.75 21.525 30-34 23.150000000000002 28.005000000000003 27.68 21.165 35-39 23.01 28.53 27.375 21.085 40-44 23.11 28.299999999999997 27.295 21.295 45-49 23.04 28.415000000000003 27.99 20.555 50-54 23.080000000000002 28.655 27.77 20.495 55-59 22.975 28.249999999999996 28.055000000000003 20.72 60-64 23.064999999999998 27.894999999999996 28.32 20.72 65-69 23.59 28.515 26.985 20.91 70-74 23.64 27.939999999999998 27.905 20.515 75-79 23.94239423942394 27.93279327932793 27.647764776477647 20.477047704770477 80-84 23.5623842650518 28.051649066613283 27.726340023021873 20.659626645313047 85-89 23.923373180613215 27.609663382183765 27.734707147501624 20.732256289701397 90-94 23.505000000000003 28.08 27.750000000000004 20.665 95-99 23.794999999999998 27.839999999999996 27.584999999999997 20.78 100-104 23.16 28.335 28.005000000000003 20.5 105-109 23.96 28.060000000000002 27.07 20.91 110-114 23.150000000000002 28.255000000000003 27.76 20.835 115-119 23.815 28.744999999999997 27.175 20.265 120-124 24.065 27.744999999999997 27.439999999999998 20.75 125-129 23.57 28.205000000000002 27.605 20.62 130-134 24.38 28.410000000000004 27.32 19.89 135-139 24.765 28.225 27.155 19.855 140-144 24.990000000000002 27.72 27.85 19.439999999999998 145-149 25.105 27.485 27.384999999999998 20.025000000000002 150-151 25.775 27.975 26.5 19.75 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 0.5 24 1.0 25 2.5 26 2.0 27 3.0 28 3.0 29 2.5 30 7.5 31 13.5 32 24.0 33 36.0 34 41.5 35 50.0 36 67.0 37 102.0 38 132.0 39 158.0 40 198.5 41 232.0 42 263.0 43 278.0 44 293.5 45 304.5 46 290.5 47 258.5 48 225.0 49 209.0 50 183.0 51 143.5 52 119.0 53 97.0 54 69.5 55 50.0 56 37.5 57 28.0 58 19.0 59 15.5 60 10.5 61 6.5 62 4.0 63 2.0 64 2.0 65 3.0 66 2.5 67 1.5 68 2.0 69 1.5 70 1.5 71 1.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.0250000000000001 2 0.9249999999999999 3 0.8999999999999999 4 0.9249999999999999 5 0.9249999999999999 6 0.775 7 0.8500000000000001 8 0.9249999999999999 9 1.2 10-14 1.0 15-19 0.03 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.01 80-84 0.095 85-89 0.034999999999999996 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.6735308890005 99.225 2 0.25113008538422904 0.5 3 0.05022601707684581 0.15 4 0.0 0.0 5 0.025113008538422906 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCTTGAGCAAATTCAGTTTCTAAGCAAAAGCTTTCCAGGCCCCTTTATCC 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.037500000000000006 0.0 0.0 0.0 0.0 80-81 0.0625 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1875 0.0 0.0 0.0 0.0 88-89 0.21250000000000002 0.0 0.0 0.0 0.0 90-91 0.275 0.0 0.0 0.0 0.0 92-93 0.325 0.0 0.0 0.0 0.0 94-95 0.3875 0.0 0.0 0.0 0.0 96-97 0.4125 0.0 0.0 0.0 0.0 98-99 0.44999999999999996 0.0 0.0 0.0 0.0 100-101 0.4875 0.0 0.0 0.0 0.0 102-103 0.575 0.0 0.0 0.0 0.0 104-105 0.625 0.0 0.0 0.0 0.0 106-107 0.7125 0.0 0.0 0.0 0.0 108-109 0.8999999999999999 0.0 0.0 0.0 0.0 110-111 1.1375 0.0 0.0 0.0 0.0 112-113 1.3 0.0 0.0 0.0 0.0 114-115 1.4875 0.0 0.0 0.0 0.0 116-117 1.6875 0.0 0.0 0.0 0.0 118-119 1.9625 0.0 0.0 0.0 0.0 120-121 2.1875 0.0 0.0 0.0 0.0 122-123 2.5 0.0 0.0 0.0 0.0 124-125 2.8 0.0 0.0 0.0 0.0 126-127 3.1625 0.0 0.0 0.0 0.0 128-129 3.425 0.0 0.0 0.0 0.0 130-131 3.9 0.0 0.0 0.0 0.0 132-133 4.3125 0.0 0.0 0.0 0.0 134-135 4.925000000000001 0.0 0.0 0.0 0.0 136-137 5.175000000000001 0.0 0.0 0.0 0.0 138-139 5.550000000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAAGAGG 10 0.006590799 146.72151 9 >>END_MODULE Read 768503 spots for SRR7180101.sra Written 768503 spots for SRR7180101.sra Read 768503 spots for SRR7180101.sra Written 768503 spots for SRR7180101.sra Read 768503 spots for SRR7180101.sra Written 768503 spots for SRR7180101.sra Read 768503 spots for SRR7180101.sra Written 768503 spots for SRR7180101.sra Read 768503 spots for SRR7180101.sra Written 768503 spots for SRR7180101.sra Read 768503 spots for SRR7180101.sra Written 768503 spots for SRR7180101.sra Read 768503 spots for SRR7180101.sra Written 768503 spots for SRR7180101.sra Read 768503 spots for SRR7180101.sra Written 768503 spots for SRR7180101.sra Read 768503 spots for SRR7180101.sra Written 768503 spots for SRR7180101.sra Read 768505 spots for SRR7180101.sra Written 768505 spots for SRR7180101.sra Read 768503 spots for SRR7180101.sra Written 768503 spots for SRR7180101.sra Read 768503 spots for SRR7180101.sra Written 768503 spots for SRR7180101.sra Read 768503 spots for SRR7180101.sra Written 768503 spots for SRR7180101.sra Read 768503 spots for SRR7180101.sra Written 768503 spots for SRR7180101.sra Read 768503 spots for SRR7180101.sra Written 768503 spots for SRR7180101.sra Read 768503 spots for SRR7180101.sra Written 768503 spots for SRR7180101.sra Read 768503 spots for SRR7180101.sra Written 768503 spots for SRR7180101.sra Read 768503 spots for SRR7180101.sra Written 768503 spots for SRR7180101.sra Read 768503 spots for SRR7180101.sra Written 768503 spots for SRR7180101.sra Read 768503 spots for SRR7180101.sra Written 768503 spots for SRR7180101.sra SRR ids: ['SRR7180101.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_fxwx66z7 SRR7180101.sra spots: 15370062 blocks: [[1, 768503], [768504, 1537006], [1537007, 2305509], [2305510, 3074012], [3074013, 3842515], [3842516, 4611018], [4611019, 5379521], [5379522, 6148024], [6148025, 6916527], [6916528, 7685030], [7685031, 8453533], [8453534, 9222036], [9222037, 9990539], [9990540, 10759042], [10759043, 11527545], [11527546, 12296048], [12296049, 13064551], [13064552, 13833054], [13833055, 14601557], [14601558, 15370062]] SRR7180101 file size 5186709 SRR7180101 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7180101 SRR7180101_1.fastq SRR7180101_2.fastq Input file: SRR7180101_1.fastq Paired file: SRR7180101_2.fastq trimmed: SRR7180101-trimmed-pair1.fastq, SRR7180101-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 19:00:27 2025 >> started Mon Feb 10 19:00:44 2025 >> done (16.851s) 15370062 read pairs processed; of these: 13839 ( 0.09%) short read pairs filtered out after trimming by size control 10913 ( 0.07%) empty read pairs filtered out after trimming by size control 15345310 (99.84%) read pairs available; of these: 7676037 (50.02%) trimmed read pairs available after processing 7669273 (49.98%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 1 0.00% 20 6 0.00% 21 3 0.00% 22 2 0.00% 23 5 0.00% 24 3 0.00% 25 6 0.00% 26 1 0.00% 27 1 0.00% 28 7 0.00% 29 4 0.00% 30 2 0.00% 31 3 0.00% 32 2 0.00% 33 5 0.00% 34 3 0.00% 35 3 0.00% 36 3 0.00% 37 1 0.00% 38 4 0.00% 39 6 0.00% 40 6 0.00% 41 6 0.00% 42 6 0.00% 43 6 0.00% 44 8 0.00% 45 11 0.00% 46 9 0.00% 47 19 0.00% 48 8 0.00% 49 18 0.00% 50 23 0.00% 51 22 0.00% 52 23 0.00% 53 34 0.00% 54 21 0.00% 55 32 0.00% 56 39 0.00% 57 38 0.00% 58 59 0.00% 59 60 0.00% 60 57 0.00% 61 76 0.00% 62 70 0.00% 63 96 0.00% 64 134 0.00% 65 124 0.00% 66 142 0.00% 67 165 0.00% 68 214 0.00% 69 272 0.00% 70 272 0.00% 71 319 0.00% 72 367 0.00% 73 443 0.00% 74 489 0.00% 75 602 0.00% 76 657 0.00% 77 732 0.00% 78 857 0.01% 79 963 0.01% 80 1110 0.01% 81 1295 0.01% 82 1458 0.01% 83 1645 0.01% 84 2667 0.02% 85 3176 0.02% 86 3496 0.02% 87 3749 0.02% 88 3968 0.03% 89 4113 0.03% 90 4310 0.03% 91 4737 0.03% 92 4996 0.03% 93 5405 0.04% 94 5922 0.04% 95 6426 0.04% 96 6799 0.04% 97 7441 0.05% 98 7676 0.05% 99 8370 0.05% 100 8862 0.06% 101 9534 0.06% 102 10201 0.07% 103 11121 0.07% 104 11940 0.08% 105 12745 0.08% 106 13297 0.09% 107 14208 0.09% 108 15207 0.10% 109 15624 0.10% 110 16657 0.11% 111 17561 0.11% 112 18512 0.12% 113 19068 0.12% 114 20648 0.13% 115 21710 0.14% 116 22819 0.15% 117 23854 0.16% 118 24882 0.16% 119 25762 0.17% 120 26793 0.17% 121 28408 0.19% 122 29683 0.19% 123 31295 0.20% 124 33043 0.22% 125 34423 0.22% 126 35753 0.23% 127 37706 0.25% 128 39616 0.26% 129 41332 0.27% 130 43305 0.28% 131 45371 0.30% 132 48071 0.31% 133 50839 0.33% 134 53524 0.35% 135 56393 0.37% 136 59540 0.39% 137 63750 0.42% 138 67593 0.44% 139 73641 0.48% 140 80073 0.52% 141 87691 0.57% 142 97467 0.64% 143 110068 0.72% 144 128255 0.84% 145 153197 1.00% 146 197028 1.28% 147 296212 1.93% 148 460319 3.00% 149 809683 5.28% 150 3925422 25.58% 151 7669273 49.98% 15345310 reads passed initial QC criterion=sequence-density sequence-density=0.50 sequence-density-rank=1 fanout-score=3.52 fanout-score-rank=18 prefix-density=0.54 prefix-fanout=3.2 sequence=CCACATTTGCAGCCA criterion=fanout-score sequence-density=0.04 sequence-density-rank=32 fanout-score=29.39 fanout-score-rank=1 prefix-density=0.18 prefix-fanout=5.9 sequence=TTGTCAATGGTATCAGAGCTCTCCACCTCCAAGGTGATGGTCTT criterion=sequence-density sequence-density=0.67 sequence-density-rank=1 fanout-score=2.15 fanout-score-rank=29 prefix-density=0.68 prefix-fanout=2.1 sequence=GGCAGTGGCTGCAA criterion=fanout-score sequence-density=0.11 sequence-density-rank=23 fanout-score=31.89 fanout-score-rank=1 prefix-density=0.34 prefix-fanout=10.2 sequence=GAGGTTGAGTACAGGTGCTTTGTTGG SRR7180101 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 19:01:52 Started mapping on | Feb 10 19:01:52 Finished on | Feb 10 19:04:18 Mapping speed, Million of reads per hour | 378.38 Number of input reads | 15345310 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 14094632 Uniquely mapped reads % | 91.85% Average mapped length | 294.70 Number of splices: Total | 14390281 Number of splices: Annotated (sjdb) | 14126591 Number of splices: GT/AG | 14161283 Number of splices: GC/AG | 182809 Number of splices: AT/AC | 10782 Number of splices: Non-canonical | 35407 Mismatch rate per base, % | 0.42% Deletion rate per base | 0.03% Deletion average length | 2.55 Insertion rate per base | 0.02% Insertion average length | 2.60 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 361181 % of reads mapped to multiple loci | 2.35% Number of reads mapped to too many loci | 31550 % of reads mapped to too many loci | 0.21% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.52% % of reads unmapped: other | 0.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 902885 902885 902885 N_multimapping 361181 361181 361181 N_noFeature 329824 13961115 388893 N_ambiguous 143702 657 68914 UnstrandedReadsAssigned:13621106 PositiveStrandReadsAssigned:132860 NegativeStrandReadsAssigned:13636825 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7180101 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7180101-trimmed-pair1.fastq SRR7180101-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,345,310 reads, 13,552,161 reads pseudoaligned [quant] estimated average fragment length: 236.831 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 987 rounds 52401 SRR7180101.ke.tsv 34699 SRR7180101.se.tsv 87100 total ==> SRR7180101.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1782.17 1054 40.6007 Potri.005G024800.1.v4.1 1035 799.169 109 9.36331 Potri.004G059700.1.v4.1 961 725.19 24 2.27196 Potri.007G009000.2.v4.1 1416 1180.17 0 0 Potri.003G141000.2.v4.1 2943 2707.17 514.168 13.0386 Potri.016G087400.1.v4.1 270 79.5232 1252 1080.82 Potri.015G069301.1.v4.1 564 331.238 0 0 Potri.010G195200.1.v4.1 1773 1537.17 498 22.2407 Potri.012G127500.1.v4.1 977 741.179 5526 511.834 ==> SRR7180101.se.tsv <== Potri.001G166300.v4.1 3 Potri.001G448400.v4.1 38 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 443 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 421 SRR7180101 completed mapping pipeline successfully