Starting /dee2/code/volunteer_pipeline.sh SRR7180102 current disk space = 3056883093504 free memory = 1192990424 SRR7180102 SRAfilesize 2484ea9414141d0ded23a7de1627947c SRR7180102.sra SRR7180102.sra file validated SRR7180102 is paired end SRR7180102 is conventional basespace SRR7180102 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7180102_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.266 33.0 33.0 34.0 32.0 34.0 2 32.8265 33.0 33.0 34.0 32.0 34.0 3 32.25075 33.0 33.0 33.0 31.0 34.0 4 32.51325 33.0 33.0 33.0 31.0 34.0 5 32.908 33.0 33.0 34.0 31.0 34.0 6 36.33825 38.0 36.0 38.0 33.0 38.0 7 37.3355 38.0 38.0 38.0 36.0 38.0 8 37.5855 38.0 38.0 38.0 37.0 38.0 9 37.643 38.0 38.0 38.0 38.0 38.0 10-14 37.6779 38.0 38.0 38.0 38.0 38.0 15-19 37.68645 38.0 38.0 38.0 38.0 38.0 20-24 37.6476 38.0 38.0 38.0 38.0 38.0 25-29 37.619600000000005 38.0 38.0 38.0 38.0 38.0 30-34 37.657799999999995 38.0 38.0 38.0 38.0 38.0 35-39 37.600199999999994 38.0 38.0 38.0 38.0 38.0 40-44 37.5863 38.0 38.0 38.0 38.0 38.0 45-49 37.54445 38.0 38.0 38.0 38.0 38.0 50-54 37.52735 38.0 38.0 38.0 38.0 38.0 55-59 37.487049999999996 38.0 38.0 38.0 37.8 38.0 60-64 37.440999999999995 38.0 38.0 38.0 37.2 38.0 65-69 37.4047 38.0 38.0 38.0 37.0 38.0 70-74 37.359550000000006 38.0 38.0 38.0 37.0 38.0 75-79 37.3393 38.0 38.0 38.0 37.0 38.0 80-84 37.2719 38.0 38.0 38.0 37.0 38.0 85-89 37.2801 38.0 38.0 38.0 37.0 38.0 90-94 37.19815 38.0 38.0 38.0 36.6 38.0 95-99 37.15495 38.0 38.0 38.0 36.4 38.0 100-104 37.07639999999999 38.0 38.0 38.0 36.0 38.0 105-109 36.94965 38.0 38.0 38.0 35.8 38.0 110-114 36.880449999999996 38.0 38.0 38.0 35.2 38.0 115-119 36.8217 38.0 38.0 38.0 35.2 38.0 120-124 36.72945 38.0 38.0 38.0 34.8 38.0 125-129 36.6041 38.0 38.0 38.0 34.6 38.0 130-134 36.33085 38.0 38.0 38.0 33.8 38.0 135-139 36.17594999999999 38.0 38.0 38.0 33.8 38.0 140-144 36.0098 38.0 37.8 38.0 33.0 38.0 145-149 35.65755 38.0 36.0 38.0 32.8 38.0 150-151 32.67175 37.0 33.5 38.0 17.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 2.0 8 0.0 9 1.0 10 0.0 11 0.0 12 0.0 13 1.0 14 1.0 15 0.0 16 1.0 17 1.0 18 3.0 19 1.0 20 2.0 21 2.0 22 5.0 23 1.0 24 4.0 25 5.0 26 6.0 27 13.0 28 10.0 29 18.0 30 14.0 31 23.0 32 35.0 33 52.0 34 96.0 35 167.0 36 477.0 37 3059.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.2185089974293 17.09511568123393 10.488431876606684 37.19794344473007 2 19.35 18.5 32.375 29.775000000000002 3 19.1 24.8 25.525 30.575000000000003 4 23.474999999999998 31.125000000000004 21.475 23.925 5 22.475 33.2 24.275 20.05 6 18.224999999999998 33.95 26.375 21.45 7 14.000000000000002 25.3 42.525 18.175 8 16.975 24.275 31.974999999999998 26.775 9 18.099999999999998 24.075 32.574999999999996 25.25 10-14 19.68 29.42 27.279999999999998 23.62 15-19 19.52 28.63 28.46 23.39 20-24 19.85 28.77 28.075 23.305 25-29 19.91 28.82 28.23 23.04 30-34 19.615 28.884999999999998 27.765 23.735 35-39 19.88 28.775000000000002 27.925 23.419999999999998 40-44 20.025000000000002 28.375 27.705000000000002 23.895 45-49 20.474999999999998 29.035 27.04 23.45 50-54 20.05 28.884999999999998 27.83 23.235 55-59 19.955000000000002 28.634999999999998 27.985 23.425 60-64 19.63 28.015 28.115000000000002 24.240000000000002 65-69 20.29 27.505000000000003 28.255000000000003 23.95 70-74 19.689999999999998 28.305000000000003 28.139999999999997 23.865 75-79 19.48 28.444999999999997 28.134999999999998 23.94 80-84 20.36 27.785 27.544999999999998 24.310000000000002 85-89 20.665 27.975 27.62 23.74 90-94 20.57 27.91 27.915 23.605 95-99 19.905 27.525 29.160000000000004 23.41 100-104 20.455000000000002 28.355000000000004 27.12 24.07 105-109 20.125 27.92 27.985 23.97 110-114 20.265 28.044999999999998 27.975 23.715 115-119 20.605 28.904999999999998 27.175 23.315 120-124 20.34 27.76 28.125 23.775 125-129 20.45 27.925 27.47 24.154999999999998 130-134 20.555 28.67 27.065 23.71 135-139 21.099999999999998 26.935 27.855 24.11 140-144 21.07 27.950000000000003 27.500000000000004 23.48 145-149 21.05 27.735 27.439999999999998 23.775 150-151 21.0625 27.875 27.1 23.962500000000002 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 3.0 1 1.5 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 1.5 21 2.0 22 0.5 23 0.0 24 1.5 25 5.5 26 7.0 27 11.5 28 14.0 29 16.0 30 25.5 31 33.0 32 40.0 33 52.5 34 61.5 35 71.0 36 91.0 37 114.0 38 133.5 39 153.0 40 191.5 41 230.5 42 231.0 43 228.5 44 265.0 45 265.5 46 256.5 47 258.0 48 228.0 49 192.0 50 173.0 51 143.0 52 111.5 53 100.5 54 71.5 55 47.0 56 33.5 57 26.5 58 24.5 59 19.5 60 14.0 61 13.0 62 8.0 63 5.5 64 5.0 65 3.0 66 4.5 67 4.0 68 2.0 69 1.5 70 1.0 71 0.0 72 0.5 73 1.0 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.75 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54796584630839 99.1 2 0.45203415369161226 0.8999999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.037500000000000006 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.0625 0.0 0.0 0.0 0.0 92-93 0.1125 0.0 0.0 0.0 0.0 94-95 0.16249999999999998 0.0 0.0 0.0 0.0 96-97 0.275 0.0 0.0 0.0 0.0 98-99 0.32499999999999996 0.0 0.0 0.0 0.0 100-101 0.475 0.0 0.0 0.0 0.0 102-103 0.575 0.0 0.0 0.0 0.0 104-105 0.7375 0.0 0.0 0.0 0.0 106-107 0.8875 0.0 0.0 0.0 0.0 108-109 1.0375 0.0 0.0 0.0 0.0 110-111 1.225 0.0 0.0 0.0 0.0 112-113 1.4 0.0 0.0 0.0 0.0 114-115 1.5375 0.0 0.0 0.0 0.0 116-117 1.75 0.0 0.0 0.0 0.0 118-119 2.0 0.0 0.0 0.0 0.0 120-121 2.2249999999999996 0.0 0.0 0.0 0.0 122-123 2.55 0.0 0.0 0.0 0.0 124-125 2.9124999999999996 0.0 0.0 0.0 0.0 126-127 3.3625 0.0 0.0 0.0 0.0 128-129 3.7249999999999996 0.0 0.0 0.0 0.0 130-131 4.175 0.0 0.0 0.0 0.0 132-133 4.7375 0.0 0.0 0.0 0.0 134-135 5.2625 0.0 0.0 0.0 0.0 136-137 5.5875 0.0 0.0 0.0 0.0 138-139 6.0875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCCACGA 10 0.0063298983 148.6923 1 CCACGAG 10 0.0068343505 144.975 2 >>END_MODULE SRR7180102 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7180102_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.10725 33.0 33.0 34.0 33.0 34.0 2 33.12925 34.0 33.0 34.0 33.0 34.0 3 33.11925 34.0 33.0 34.0 33.0 34.0 4 33.09325 34.0 33.0 34.0 33.0 34.0 5 33.08375 34.0 33.0 34.0 33.0 34.0 6 37.20175 38.0 38.0 38.0 37.0 38.0 7 37.1775 38.0 38.0 38.0 37.0 38.0 8 37.12425 38.0 38.0 38.0 37.0 38.0 9 37.18 38.0 38.0 38.0 37.0 38.0 10-14 37.166000000000004 38.0 38.0 38.0 37.2 38.0 15-19 37.110549999999996 38.0 38.0 38.0 37.2 38.0 20-24 37.087450000000004 38.0 38.0 38.0 37.0 38.0 25-29 37.0267 38.0 38.0 38.0 37.0 38.0 30-34 36.9756 38.0 38.0 38.0 37.0 38.0 35-39 36.90104999999999 38.0 38.0 38.0 37.0 38.0 40-44 36.854200000000006 38.0 38.0 38.0 36.6 38.0 45-49 36.9222 38.0 38.0 38.0 37.0 38.0 50-54 36.8952 38.0 38.0 38.0 37.0 38.0 55-59 36.866949999999996 38.0 38.0 38.0 36.4 38.0 60-64 36.792899999999996 38.0 38.0 38.0 36.0 38.0 65-69 36.6952 38.0 38.0 38.0 36.0 38.0 70-74 36.644800000000004 38.0 38.0 38.0 35.8 38.0 75-79 36.659749999999995 38.0 38.0 38.0 36.0 38.0 80-84 36.5708 38.0 38.0 38.0 35.8 38.0 85-89 36.497 38.0 38.0 38.0 35.2 38.0 90-94 36.41844999999999 38.0 38.0 38.0 35.0 38.0 95-99 36.296800000000005 38.0 38.0 38.0 34.6 38.0 100-104 36.11495 38.0 38.0 38.0 34.0 38.0 105-109 35.91985 38.0 38.0 38.0 33.6 38.0 110-114 35.794799999999995 38.0 37.6 38.0 33.0 38.0 115-119 35.732000000000006 38.0 37.2 38.0 32.6 38.0 120-124 35.4643 38.0 37.0 38.0 31.2 38.0 125-129 35.325450000000004 38.0 36.6 38.0 31.2 38.0 130-134 35.02545 38.0 36.0 38.0 28.4 38.0 135-139 34.77455 38.0 36.0 38.0 27.8 38.0 140-144 34.14985 38.0 35.0 38.0 23.8 38.0 145-149 33.71465 38.0 35.0 38.0 22.2 38.0 150-151 30.112875000000003 36.5 29.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 12.0 3 8.0 4 5.0 5 1.0 6 2.0 7 3.0 8 2.0 9 4.0 10 3.0 11 4.0 12 2.0 13 4.0 14 5.0 15 2.0 16 5.0 17 6.0 18 6.0 19 8.0 20 4.0 21 3.0 22 7.0 23 2.0 24 6.0 25 12.0 26 20.0 27 22.0 28 20.0 29 27.0 30 36.0 31 48.0 32 53.0 33 62.0 34 124.0 35 228.0 36 586.0 37 2658.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.425 16.575 16.05 25.95 2 23.849999999999998 25.224999999999998 33.175 17.75 3 21.975 26.75 30.049999999999997 21.224999999999998 4 24.375 34.025 22.6 19.0 5 23.799999999999997 36.3 23.125 16.775000000000002 6 19.575 36.75 24.675 19.0 7 19.025 18.8 39.45 22.725 8 20.95 24.224999999999998 27.125 27.700000000000003 9 21.6 27.450000000000003 27.675 23.275000000000002 10-14 23.655 29.189999999999998 25.615 21.54 15-19 23.825 28.275 27.139999999999997 20.76 20-24 23.38818586505277 28.424948732056222 27.309558345420896 20.877307057470116 25-29 23.48788303625075 28.364710594832765 26.532145003004203 21.61526136591228 30-34 22.414224893563738 29.070874029551714 27.81367392937641 20.70122714750814 35-39 23.982762076568452 28.061735818801363 26.889156143515734 21.06634596111445 40-44 23.704780038079967 28.078965828239305 27.80839763503357 20.40785649864716 45-49 23.46729392923277 27.876482658525596 27.536159351383816 21.120064060857814 50-54 23.245811452863215 28.762190547636905 27.04176044011003 20.950237559389848 55-59 24.441110277569393 27.836959239809957 26.82170542635659 20.900225056264066 60-64 23.725931482870717 27.62690672668167 27.536884221055264 21.11027756939235 65-69 23.529705941188237 27.850570114022805 27.665533106621325 20.954190838167634 70-74 23.675918979744935 28.3520880220055 26.646661665416353 21.32533133283321 75-79 24.05740574057406 27.86278627862786 27.632763276327633 20.447044704470446 80-84 23.700925231307828 28.1470367591898 27.22680670167542 20.92523130782696 85-89 24.158623793569035 27.974196129419415 27.219082862429367 20.648097214582187 90-94 23.46 29.09 26.950000000000003 20.5 95-99 23.919999999999998 28.28 27.560000000000002 20.24 100-104 24.065 28.42 27.134999999999998 20.380000000000003 105-109 24.075 27.689999999999998 27.58 20.655 110-114 23.645 27.955000000000002 28.04 20.36 115-119 24.759999999999998 27.715 27.68 19.845 120-124 24.135 27.800000000000004 28.03 20.035 125-129 23.927392739273927 28.15781578157816 28.0978097809781 19.816981698169815 130-134 24.697469746974697 28.182818281828183 26.807680768076807 20.312031203120313 135-139 24.285 27.775 27.655 20.285 140-144 25.080000000000002 27.250000000000004 27.72 19.950000000000003 145-149 25.026251312565627 27.91139556977849 27.101355067753385 19.960998049902496 150-151 24.543178973717147 28.52315394242804 27.897371714643306 19.036295369211516 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.5 19 0.5 20 0.0 21 0.5 22 1.5 23 2.0 24 1.5 25 0.5 26 0.5 27 4.5 28 8.0 29 8.5 30 9.5 31 13.5 32 17.5 33 28.5 34 47.0 35 49.0 36 60.0 37 101.0 38 132.0 39 159.5 40 191.5 41 219.0 42 261.5 43 279.0 44 268.0 45 289.5 46 303.5 47 265.0 48 227.5 49 202.5 50 167.5 51 139.0 52 118.0 53 98.0 54 80.0 55 58.5 56 41.0 57 29.5 58 23.0 59 20.5 60 13.0 61 11.5 62 13.0 63 7.5 64 3.5 65 5.5 66 6.0 67 4.0 68 2.5 69 1.0 70 1.0 71 0.5 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.034999999999999996 25-29 0.13999999999999999 30-34 0.17500000000000002 35-39 0.22 40-44 0.21 45-49 0.095 50-54 0.025 55-59 0.025 60-64 0.025 65-69 0.02 70-74 0.025 75-79 0.01 80-84 0.025 85-89 0.015 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.01 130-134 0.01 135-139 0.0 140-144 0.0 145-149 0.005 150-151 0.125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.4 #Duplication Level Percentage of deduplicated Percentage of total 1 99.47183098591549 98.875 2 0.5030181086519114 1.0 3 0.0 0.0 4 0.0 0.0 5 0.025150905432595575 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCTTGAGCAAATTCAGTTTCTAAGCAAAAGCTTTCCAGGCCCCTTTATCC 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.037500000000000006 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.0625 0.0 0.0 0.0 0.0 92-93 0.1125 0.0 0.0 0.0 0.0 94-95 0.16249999999999998 0.0 0.0 0.0 0.0 96-97 0.275 0.0 0.0 0.0 0.0 98-99 0.3375 0.0 0.0 0.0 0.0 100-101 0.5125 0.0 0.0 0.0 0.0 102-103 0.625 0.0 0.0 0.0 0.0 104-105 0.7875 0.0 0.0 0.0 0.0 106-107 0.9375 0.0 0.0 0.0 0.0 108-109 1.0875 0.0 0.0 0.0 0.0 110-111 1.275 0.0 0.0 0.0 0.0 112-113 1.4500000000000002 0.0 0.0 0.0 0.0 114-115 1.6 0.0 0.0 0.0 0.0 116-117 1.8 0.0 0.0 0.0 0.0 118-119 2.075 0.0 0.0 0.0 0.0 120-121 2.3 0.0 0.0 0.0 0.0 122-123 2.675 0.0 0.0 0.0 0.0 124-125 3.0374999999999996 0.0 0.0 0.0 0.0 126-127 3.525 0.0 0.0 0.0 0.0 128-129 3.9000000000000004 0.0 0.0 0.0 0.0 130-131 4.375 0.0 0.0 0.0 0.0 132-133 4.925 0.0 0.0 0.0 0.0 134-135 5.4625 0.0 0.0 0.0 0.0 136-137 5.7875 0.0 0.0 0.0 0.0 138-139 6.237500000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AATCTTG 10 0.006830828 145.0 145 ACAGGGG 10 0.006830828 145.0 2 >>END_MODULE Read 646337 spots for SRR7180102.sra Written 646337 spots for SRR7180102.sra Read 646337 spots for SRR7180102.sra Written 646337 spots for SRR7180102.sra Read 646337 spots for SRR7180102.sra Written 646337 spots for SRR7180102.sra Read 646337 spots for SRR7180102.sra Written 646337 spots for SRR7180102.sra Read 646337 spots for SRR7180102.sra Written 646337 spots for SRR7180102.sra Read 646337 spots for SRR7180102.sra Written 646337 spots for SRR7180102.sra Read 646337 spots for SRR7180102.sra Written 646337 spots for SRR7180102.sra Read 646337 spots for SRR7180102.sra Written 646337 spots for SRR7180102.sra Read 646337 spots for SRR7180102.sra Written 646337 spots for SRR7180102.sra Read 646337 spots for SRR7180102.sra Written 646337 spots for SRR7180102.sra Read 646337 spots for SRR7180102.sra Written 646337 spots for SRR7180102.sra Read 646337 spots for SRR7180102.sra Written 646337 spots for SRR7180102.sra Read 646337 spots for SRR7180102.sra Written 646337 spots for SRR7180102.sra Read 646337 spots for SRR7180102.sra Written 646337 spots for SRR7180102.sra Read 646337 spots for SRR7180102.sra Written 646337 spots for SRR7180102.sra Read 646337 spots for SRR7180102.sra Written 646337 spots for SRR7180102.sra Read 646337 spots for SRR7180102.sra Written 646337 spots for SRR7180102.sra Read 646337 spots for SRR7180102.sra Written 646337 spots for SRR7180102.sra Read 646346 spots for SRR7180102.sra Written 646346 spots for SRR7180102.sra Read 646337 spots for SRR7180102.sra Written 646337 spots for SRR7180102.sra SRR ids: ['SRR7180102.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_lvj1urr3 SRR7180102.sra spots: 12926749 blocks: [[1, 646337], [646338, 1292674], [1292675, 1939011], [1939012, 2585348], [2585349, 3231685], [3231686, 3878022], [3878023, 4524359], [4524360, 5170696], [5170697, 5817033], [5817034, 6463370], [6463371, 7109707], [7109708, 7756044], [7756045, 8402381], [8402382, 9048718], [9048719, 9695055], [9695056, 10341392], [10341393, 10987729], [10987730, 11634066], [11634067, 12280403], [12280404, 12926749]] SRR7180102 file size 4358750 SRR7180102 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7180102 SRR7180102_1.fastq SRR7180102_2.fastq Input file: SRR7180102_1.fastq Paired file: SRR7180102_2.fastq trimmed: SRR7180102-trimmed-pair1.fastq, SRR7180102-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 19:22:34 2025 >> started Mon Feb 10 19:22:47 2025 >> done (13.204s) 12926749 read pairs processed; of these: 37593 ( 0.29%) short read pairs filtered out after trimming by size control 21311 ( 0.16%) empty read pairs filtered out after trimming by size control 12867845 (99.54%) read pairs available; of these: 4929474 (38.31%) trimmed read pairs available after processing 7938371 (61.69%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 3 0.00% 20 4 0.00% 21 3 0.00% 22 2 0.00% 23 4 0.00% 24 6 0.00% 25 12 0.00% 26 7 0.00% 27 7 0.00% 28 9 0.00% 29 7 0.00% 30 12 0.00% 31 9 0.00% 32 6 0.00% 33 8 0.00% 34 10 0.00% 35 13 0.00% 36 15 0.00% 37 21 0.00% 38 9 0.00% 39 14 0.00% 40 28 0.00% 41 32 0.00% 42 13 0.00% 43 19 0.00% 44 15 0.00% 45 51 0.00% 46 41 0.00% 47 60 0.00% 48 37 0.00% 49 49 0.00% 50 54 0.00% 51 98 0.00% 52 30 0.00% 53 35 0.00% 54 62 0.00% 55 109 0.00% 56 51 0.00% 57 51 0.00% 58 62 0.00% 59 68 0.00% 60 91 0.00% 61 97 0.00% 62 114 0.00% 63 108 0.00% 64 133 0.00% 65 153 0.00% 66 196 0.00% 67 226 0.00% 68 235 0.00% 69 270 0.00% 70 318 0.00% 71 319 0.00% 72 423 0.00% 73 490 0.00% 74 535 0.00% 75 656 0.01% 76 881 0.01% 77 830 0.01% 78 969 0.01% 79 1092 0.01% 80 1178 0.01% 81 1419 0.01% 82 1614 0.01% 83 1913 0.01% 84 3674 0.03% 85 4976 0.04% 86 5206 0.04% 87 5666 0.04% 88 5854 0.05% 89 6268 0.05% 90 6451 0.05% 91 6693 0.05% 92 7021 0.05% 93 7115 0.06% 94 7273 0.06% 95 7922 0.06% 96 8365 0.07% 97 8963 0.07% 98 9258 0.07% 99 9863 0.08% 100 10418 0.08% 101 11026 0.09% 102 11470 0.09% 103 12211 0.09% 104 12969 0.10% 105 13919 0.11% 106 14682 0.11% 107 15913 0.12% 108 16400 0.13% 109 17294 0.13% 110 18380 0.14% 111 19019 0.15% 112 20009 0.16% 113 20891 0.16% 114 22326 0.17% 115 23066 0.18% 116 24282 0.19% 117 25319 0.20% 118 26449 0.21% 119 27254 0.21% 120 28314 0.22% 121 30550 0.24% 122 31391 0.24% 123 31800 0.25% 124 32862 0.26% 125 33683 0.26% 126 35285 0.27% 127 35794 0.28% 128 36999 0.29% 129 38530 0.30% 130 40185 0.31% 131 42025 0.33% 132 43889 0.34% 133 45571 0.35% 134 47282 0.37% 135 48863 0.38% 136 51041 0.40% 137 53401 0.41% 138 55581 0.43% 139 58278 0.45% 140 61159 0.48% 141 65218 0.51% 142 70233 0.55% 143 75374 0.59% 144 83585 0.65% 145 94610 0.74% 146 110432 0.86% 147 139757 1.09% 148 197469 1.53% 149 375969 2.92% 150 2345070 18.22% 151 7938371 61.69% 12867845 reads passed initial QC criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=2.54 fanout-score-rank=34 prefix-density=0.20 prefix-fanout=2.5 sequence=GTGGACTCCTTCTGGAT criterion=fanout-score sequence-density=0.01 sequence-density-rank=38 fanout-score=137.21 fanout-score-rank=1 prefix-density=0.15 prefix-fanout=12.1 sequence=CAACAACTTCCCTATCTTTAATCCTCTCACTCCACAAATTCATAAGCTTCACCATTTTACTTCACCAATTCCTTAGAGATGTAATAGCCCATAACAATAGGAAATATCAGAAATCCAATAAGAATCAGCAATTCAGGAAGAAATATGACAAGGAGTAGTAGTGTGGATGTTGTTGTTAGACACTTCTTTTTGTCTTTAAATATAAGGCGTGGTAGAATTACTGGCACTCCAATGATTCCATATAACGGCCATAATGGAGCTATAGAATACAACACCAACGTCGCAAAAAACCAGCAAAAATTCTTAACAT criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=4.50 fanout-score-rank=25 prefix-density=0.31 prefix-fanout=3.5 sequence=TGCAAGTGCGGCAGTGGCTG criterion=fanout-score sequence-density=0.02 sequence-density-rank=35 fanout-score=27.89 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=2.7 sequence=TCTTTGAGAGTGCATAGATTTGTGTTGATATAGAAAACAATGGCACTACATGGAAAGATTGAGACAACATTAGAACTCAAGTCCTCCGCAGAGAAGTTCTACAAAGTGTGGAGGAGCCAGTCCTTCCATGTTCCCAAACATGCTTCCAAGCATATCCAAGGAGTTGATATACATGCAGGTGACTGGGAGACTGCGGGCTCTATCAGGATTTGGCAGTACACAATCGGAGGGAAAGCCGGGGTCTTTAAAGAGGAGGTTTCC SRR7180102 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 19:23:36 Started mapping on | Feb 10 19:23:36 Finished on | Feb 10 19:26:04 Mapping speed, Million of reads per hour | 313.00 Number of input reads | 12867845 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 11373417 Uniquely mapped reads % | 88.39% Average mapped length | 293.97 Number of splices: Total | 10815540 Number of splices: Annotated (sjdb) | 10608015 Number of splices: GT/AG | 10634929 Number of splices: GC/AG | 140726 Number of splices: AT/AC | 9149 Number of splices: Non-canonical | 30736 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.50 Insertion rate per base | 0.02% Insertion average length | 2.55 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 316896 % of reads mapped to multiple loci | 2.46% Number of reads mapped to too many loci | 41123 % of reads mapped to too many loci | 0.32% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 8.74% % of reads unmapped: other | 0.09% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1209148 1209148 1209148 N_multimapping 316896 316896 316896 N_noFeature 284131 11258265 340519 N_ambiguous 118764 1294 59026 UnstrandedReadsAssigned:10970522 PositiveStrandReadsAssigned:113858 NegativeStrandReadsAssigned:10973872 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7180102 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7180102-trimmed-pair1.fastq SRR7180102-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,867,845 reads, 10,969,138 reads pseudoaligned [quant] estimated average fragment length: 229.237 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,093 rounds 52401 SRR7180102.ke.tsv 34699 SRR7180102.se.tsv 87100 total ==> SRR7180102.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1789.76 928 45.0273 Potri.005G024800.1.v4.1 1035 806.763 97 10.4412 Potri.004G059700.1.v4.1 961 732.763 41 4.85897 Potri.007G009000.2.v4.1 1416 1187.76 0 0 Potri.003G141000.2.v4.1 2943 2714.76 356 11.3879 Potri.016G087400.1.v4.1 270 82.2915 698.493 737.107 Potri.015G069301.1.v4.1 564 338.33 0 0 Potri.010G195200.1.v4.1 1773 1544.76 352 19.7881 Potri.012G127500.1.v4.1 977 748.763 3305 383.311 ==> SRR7180102.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 11 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 259 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 442 SRR7180102 completed mapping pipeline successfully