Starting /dee2/code/volunteer_pipeline.sh SRR7180103 current disk space = 2818736766976 free memory = 1580971084 SRR7180103 SRAfilesize cb170afc6d96ecc36244b36b6b4cd977 SRR7180103.sra SRR7180103.sra file validated SRR7180103 is paired end SRR7180103 is conventional basespace SRR7180103 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7180103_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 27.14825 32.0 18.0 33.0 18.0 33.0 2 26.5635 28.0 18.0 31.0 18.0 33.0 3 29.69825 31.0 28.0 33.0 25.0 33.0 4 31.419 33.0 31.0 33.0 29.0 33.0 5 32.6045 33.0 33.0 33.0 32.0 34.0 6 36.57725 38.0 37.0 38.0 34.0 38.0 7 37.22525 38.0 38.0 38.0 36.0 38.0 8 37.33225 38.0 38.0 38.0 36.0 38.0 9 37.52025 38.0 38.0 38.0 37.0 38.0 10-14 37.64265 38.0 38.0 38.0 37.8 38.0 15-19 37.6443 38.0 38.0 38.0 38.0 38.0 20-24 37.62564999999999 38.0 38.0 38.0 38.0 38.0 25-29 37.655449999999995 38.0 38.0 38.0 38.0 38.0 30-34 37.612350000000006 38.0 38.0 38.0 38.0 38.0 35-39 37.54275 38.0 38.0 38.0 38.0 38.0 40-44 37.55825 38.0 38.0 38.0 38.0 38.0 45-49 37.5477 38.0 38.0 38.0 38.0 38.0 50-54 37.5053 38.0 38.0 38.0 37.8 38.0 55-59 37.45375 38.0 38.0 38.0 37.2 38.0 60-64 37.3746 38.0 38.0 38.0 37.0 38.0 65-69 37.3711 38.0 38.0 38.0 37.0 38.0 70-74 37.34015 38.0 38.0 38.0 37.0 38.0 75-79 37.2629 38.0 38.0 38.0 37.0 38.0 80-84 37.21660000000001 38.0 38.0 38.0 36.8 38.0 85-89 37.147499999999994 38.0 38.0 38.0 36.4 38.0 90-94 37.018100000000004 38.0 38.0 38.0 36.0 38.0 95-99 37.063849999999995 38.0 38.0 38.0 36.0 38.0 100-104 36.9024 38.0 38.0 38.0 36.0 38.0 105-109 36.742149999999995 38.0 38.0 38.0 34.8 38.0 110-114 36.693000000000005 38.0 38.0 38.0 34.8 38.0 115-119 36.5308 38.0 38.0 38.0 34.2 38.0 120-124 36.46795 38.0 38.0 38.0 34.0 38.0 125-129 36.37564999999999 38.0 38.0 38.0 34.0 38.0 130-134 36.12825 38.0 37.8 38.0 33.6 38.0 135-139 35.89985 38.0 37.2 38.0 33.0 38.0 140-144 35.61825 38.0 36.0 38.0 32.6 38.0 145-149 35.3212 38.0 36.0 38.0 31.4 38.0 150-151 32.217875 36.5 32.5 38.0 15.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 1.0 10 1.0 11 0.0 12 0.0 13 0.0 14 1.0 15 2.0 16 2.0 17 1.0 18 3.0 19 1.0 20 0.0 21 4.0 22 2.0 23 3.0 24 2.0 25 8.0 26 11.0 27 14.0 28 15.0 29 19.0 30 33.0 31 42.0 32 40.0 33 65.0 34 113.0 35 179.0 36 593.0 37 2845.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 31.115202524986852 13.992635455023672 12.940557601262492 41.95160441872699 2 19.499374217772214 18.548185231539424 35.96996245306634 25.982478097622025 3 19.875 22.75 24.95 32.425 4 21.575 30.599999999999998 23.45 24.375 5 21.775 32.9 23.9 21.425 6 18.4 34.375 27.1 20.125 7 14.149999999999999 24.45 42.225 19.175 8 16.225 25.15 32.175 26.450000000000003 9 17.05 25.174999999999997 33.95 23.825 10-14 18.515 30.209999999999997 27.71 23.565 15-19 19.365 28.665000000000003 28.24 23.73 20-24 19.665 29.28 27.615000000000002 23.44 25-29 18.865000000000002 29.299999999999997 27.845 23.990000000000002 30-34 19.09 29.815 27.99 23.105 35-39 19.495 29.395 27.665 23.445 40-44 20.080000000000002 29.34 27.384999999999998 23.195 45-49 19.78 28.425 28.09 23.705000000000002 50-54 19.34 28.810000000000002 27.615000000000002 24.235 55-59 19.49 29.645 27.060000000000002 23.805 60-64 19.66 28.365000000000002 28.225 23.75 65-69 19.415 29.435 27.04 24.11 70-74 19.365 28.845 27.76 24.03 75-79 19.55 28.82 27.665 23.965 80-84 19.62 27.82 28.599999999999998 23.96 85-89 20.36 28.53 27.439999999999998 23.669999999999998 90-94 20.1 28.54 27.595 23.765 95-99 19.45 28.64 27.675 24.235 100-104 19.994999999999997 28.749999999999996 27.735 23.52 105-109 20.075000000000003 28.4 27.639999999999997 23.885 110-114 20.005 28.77 27.99 23.235 115-119 20.41 28.749999999999996 27.52 23.32 120-124 20.119999999999997 28.705000000000002 27.36 23.815 125-129 20.82 28.050000000000004 27.18 23.95 130-134 20.34 28.68 27.16 23.82 135-139 20.585 29.01 26.740000000000002 23.665 140-144 20.575 28.515 26.939999999999998 23.97 145-149 20.95 28.285 27.155 23.61 150-151 21.38380546502883 27.387816495362244 26.84883429430935 24.37954374529957 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 1.0 20 1.5 21 2.5 22 3.5 23 2.0 24 4.0 25 6.5 26 8.5 27 12.0 28 14.0 29 18.0 30 29.5 31 36.0 32 42.0 33 58.5 34 71.0 35 86.5 36 100.5 37 122.5 38 148.5 39 177.0 40 206.5 41 210.5 42 217.5 43 246.5 44 264.5 45 260.0 46 253.5 47 233.0 48 220.5 49 194.0 50 153.5 51 129.0 52 98.0 53 76.5 54 60.5 55 46.0 56 40.5 57 37.0 58 25.5 59 17.0 60 14.5 61 9.5 62 8.0 63 6.5 64 3.5 65 2.5 66 1.5 67 2.0 68 4.5 69 4.0 70 2.5 71 1.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.95 2 0.125 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.27499999999999997 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.8 #Duplication Level Percentage of deduplicated Percentage of total 1 99.79959919839679 99.6 2 0.2004008016032064 0.4 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.1375 0.0 0.0 0.0 0.0 90-91 0.16249999999999998 0.0 0.0 0.0 0.0 92-93 0.1875 0.0 0.0 0.0 0.0 94-95 0.21250000000000002 0.0 0.0 0.0 0.0 96-97 0.2375 0.0 0.0 0.0 0.0 98-99 0.3375 0.0 0.0 0.0 0.0 100-101 0.44999999999999996 0.0 0.0 0.0 0.0 102-103 0.5875 0.0 0.0 0.0 0.0 104-105 0.75 0.0 0.0 0.0 0.0 106-107 0.8125 0.0 0.0 0.0 0.0 108-109 0.9 0.0 0.0 0.0 0.0 110-111 1.15 0.0 0.0 0.0 0.0 112-113 1.4625 0.0 0.0 0.0 0.0 114-115 1.775 0.0 0.0 0.0 0.0 116-117 2.075 0.0 0.0 0.0 0.0 118-119 2.2625 0.0 0.0 0.0 0.0 120-121 2.5125 0.0 0.0 0.0 0.0 122-123 2.75 0.0 0.0 0.0 0.0 124-125 3.1875 0.0 0.0 0.0 0.0 126-127 3.6 0.0 0.0 0.0 0.0 128-129 4.0625 0.0 0.0 0.0 0.0 130-131 4.475 0.0125 0.0 0.0 0.0 132-133 4.975 0.025 0.0 0.0 0.0 134-135 5.5875 0.025 0.0 0.0 0.0 136-137 6.225 0.025 0.0 0.0 0.0 138-139 6.7 0.025 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTCAAAG 10 0.006836113 144.9625 9 >>END_MODULE SRR7180103 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7180103_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.04325 33.0 33.0 34.0 33.0 34.0 2 33.204 34.0 33.0 34.0 33.0 34.0 3 33.27175 34.0 33.0 34.0 33.0 34.0 4 33.23375 34.0 33.0 34.0 33.0 34.0 5 33.19175 34.0 33.0 34.0 33.0 34.0 6 37.2535 38.0 38.0 38.0 37.0 38.0 7 37.318 38.0 38.0 38.0 37.0 38.0 8 37.3065 38.0 38.0 38.0 38.0 38.0 9 37.269 38.0 38.0 38.0 37.0 38.0 10-14 37.27875 38.0 38.0 38.0 37.8 38.0 15-19 37.208650000000006 38.0 38.0 38.0 37.6 38.0 20-24 37.172700000000006 38.0 38.0 38.0 37.2 38.0 25-29 37.18635 38.0 38.0 38.0 37.6 38.0 30-34 37.134 38.0 38.0 38.0 37.4 38.0 35-39 37.02205 38.0 38.0 38.0 37.0 38.0 40-44 36.9879 38.0 38.0 38.0 37.0 38.0 45-49 37.0967 38.0 38.0 38.0 37.0 38.0 50-54 37.1081 38.0 38.0 38.0 37.0 38.0 55-59 37.0301 38.0 38.0 38.0 37.0 38.0 60-64 37.04045 38.0 38.0 38.0 37.0 38.0 65-69 36.9185 38.0 38.0 38.0 36.8 38.0 70-74 36.9108 38.0 38.0 38.0 36.0 38.0 75-79 36.88865 38.0 38.0 38.0 36.2 38.0 80-84 36.87795 38.0 38.0 38.0 36.0 38.0 85-89 36.7131 38.0 38.0 38.0 35.8 38.0 90-94 36.639599999999994 38.0 38.0 38.0 35.2 38.0 95-99 36.614850000000004 38.0 38.0 38.0 35.4 38.0 100-104 36.42465 38.0 38.0 38.0 34.4 38.0 105-109 36.316050000000004 38.0 38.0 38.0 34.2 38.0 110-114 36.3041 38.0 38.0 38.0 34.2 38.0 115-119 36.03994999999999 38.0 38.0 38.0 33.8 38.0 120-124 35.90385 38.0 38.0 38.0 33.2 38.0 125-129 35.62885 38.0 37.2 38.0 32.4 38.0 130-134 35.41605 38.0 36.6 38.0 31.0 38.0 135-139 35.0253 38.0 36.0 38.0 28.8 38.0 140-144 34.7831 38.0 35.6 38.0 27.4 38.0 145-149 34.2269 38.0 34.8 38.0 26.2 38.0 150-151 30.627375 36.5 29.0 38.0 8.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 13.0 3 8.0 4 5.0 5 0.0 6 2.0 7 0.0 8 1.0 9 1.0 10 1.0 11 2.0 12 1.0 13 1.0 14 4.0 15 1.0 16 4.0 17 2.0 18 1.0 19 5.0 20 6.0 21 1.0 22 3.0 23 9.0 24 6.0 25 9.0 26 17.0 27 17.0 28 12.0 29 27.0 30 41.0 31 36.0 32 58.0 33 80.0 34 127.0 35 182.0 36 491.0 37 2826.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.53453453453454 16.366366366366368 18.743743743743742 30.355355355355357 2 22.875 23.625 36.8 16.7 3 21.675 26.25 31.95 20.125 4 24.8 33.074999999999996 22.95 19.175 5 23.525 35.0 24.9 16.575 6 19.8 37.325 24.525 18.35 7 18.67966991747937 19.379844961240313 41.98549637409352 19.954988747186796 8 23.317488116087066 23.01726294721041 27.62071553665249 26.044533400050035 9 22.775000000000002 25.95 28.825 22.45 10-14 23.674999999999997 28.725 26.26 21.34 15-19 23.54353152972946 28.514277141571238 27.62914437165575 20.313046957043557 20-24 23.87887887887888 28.173173173173172 27.562562562562565 20.385385385385383 25-29 23.572716346153847 28.240184294871796 27.754407051282055 20.432692307692307 30-34 23.13399167878089 29.064113489397965 27.68058549300717 20.121309338813976 35-39 23.69979919678715 29.036144578313255 26.78714859437751 20.47690763052209 40-44 23.509335474804256 28.538446095161614 27.46436458542461 20.487853844609518 45-49 23.77541821095863 28.558549534208154 28.0076129420014 19.658419312831814 50-54 23.703036670168594 27.94036720196108 27.91535344439442 20.441242683475913 55-59 23.509105463277965 28.352011206724036 27.896738042825696 20.242145287172303 60-64 23.77094273568392 27.786946736684172 28.032008002000502 20.41010252563141 65-69 23.680920230057513 28.342085521380344 28.02200550137534 19.954988747186796 70-74 23.641182059102956 28.23641182059103 27.69638481924096 20.426021301065052 75-79 23.685000000000002 28.449999999999996 28.13 19.735 80-84 24.08120406020301 27.886394319715986 27.92639631981599 20.10600530026501 85-89 23.995 27.6 28.24 20.165 90-94 23.39 28.42 27.985 20.205000000000002 95-99 24.42 27.500000000000004 28.060000000000002 20.02 100-104 23.885 28.53 27.92 19.665 105-109 24.34 27.71 28.28 19.67 110-114 24.37 27.765 28.134999999999998 19.73 115-119 24.165 28.055000000000003 28.244999999999997 19.535 120-124 24.23 28.215 27.85 19.705000000000002 125-129 24.34 28.499999999999996 27.845 19.314999999999998 130-134 24.645 27.884999999999998 28.025 19.445 135-139 25.305 28.375 27.305 19.015 140-144 25.245 28.125 27.450000000000003 19.18 145-149 25.290000000000003 28.16 27.029999999999998 19.52 150-151 25.731508225543138 26.874293607936707 28.619866884340073 18.774331282180082 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.5 11 1.0 12 1.0 13 1.0 14 0.5 15 0.0 16 1.0 17 1.5 18 0.5 19 1.0 20 1.5 21 2.0 22 2.5 23 3.5 24 4.0 25 5.5 26 6.0 27 6.0 28 12.0 29 14.5 30 14.0 31 17.0 32 23.5 33 34.0 34 46.0 35 64.0 36 86.0 37 112.5 38 128.0 39 157.0 40 187.0 41 222.0 42 265.5 43 279.5 44 297.5 45 300.5 46 272.0 47 247.0 48 215.5 49 192.5 50 169.0 51 135.0 52 108.5 53 87.5 54 62.0 55 40.5 56 43.0 57 34.0 58 23.5 59 16.5 60 11.5 61 9.5 62 9.5 63 9.5 64 4.5 65 2.5 66 2.0 67 1.0 68 0.5 69 0.5 70 0.0 71 0.5 72 0.5 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.1 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.025 8 0.075 9 0.0 10-14 0.0 15-19 0.015 20-24 0.1 25-29 0.16 30-34 0.255 35-39 0.4 40-44 0.38 45-49 0.16999999999999998 50-54 0.055 55-59 0.06 60-64 0.025 65-69 0.025 70-74 0.005 75-79 0.0 80-84 0.005 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.46249999999999997 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69909729187563 99.4 2 0.3009027081243731 0.6 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.16249999999999998 0.0 0.0 0.0 0.0 90-91 0.1875 0.0 0.0 0.0 0.0 92-93 0.21250000000000002 0.0 0.0 0.0 0.0 94-95 0.2375 0.0 0.0 0.0 0.0 96-97 0.2625 0.0 0.0 0.0 0.0 98-99 0.36250000000000004 0.0 0.0 0.0 0.0 100-101 0.475 0.0 0.0 0.0 0.0 102-103 0.6125 0.0 0.0 0.0 0.0 104-105 0.775 0.0 0.0 0.0 0.0 106-107 0.8375 0.0 0.0 0.0 0.0 108-109 0.925 0.0 0.0 0.0 0.0 110-111 1.2 0.0 0.0 0.0 0.0 112-113 1.5625 0.0 0.0 0.0 0.0 114-115 1.875 0.0 0.0 0.0 0.0 116-117 2.175 0.0 0.0 0.0 0.0 118-119 2.3625 0.0 0.0 0.0 0.0 120-121 2.625 0.0 0.0 0.0 0.0 122-123 2.85 0.0 0.0 0.0 0.0 124-125 3.2875 0.0 0.0 0.0 0.0 126-127 3.7 0.0 0.0 0.0 0.0 128-129 4.1375 0.0 0.0 0.0 0.0 130-131 4.574999999999999 0.0 0.0 0.0 0.0 132-133 5.0375 0.0 0.0 0.0 0.0 134-135 5.65 0.0 0.0 0.0 0.0 136-137 6.3125 0.0 0.0 0.0 0.0 138-139 6.8375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AACCGCA 10 0.006830828 145.0 5 TTCGATC 10 0.006830828 145.0 2 GAATTTG 10 0.006830828 145.0 2 TTTCGAT 10 0.006830828 145.0 1 >>END_MODULE Read 748746 spots for SRR7180103.sra Written 748746 spots for SRR7180103.sra Read 748746 spots for SRR7180103.sra Written 748746 spots for SRR7180103.sra Read 748751 spots for SRR7180103.sra Written 748751 spots for SRR7180103.sra Read 748746 spots for SRR7180103.sra Written 748746 spots for SRR7180103.sra Read 748746 spots for SRR7180103.sra Written 748746 spots for SRR7180103.sra Read 748746 spots for SRR7180103.sra Written 748746 spots for SRR7180103.sra Read 748746 spots for SRR7180103.sra Written 748746 spots for SRR7180103.sra Read 748746 spots for SRR7180103.sra Written 748746 spots for SRR7180103.sra Read 748746 spots for SRR7180103.sra Written 748746 spots for SRR7180103.sra Read 748746 spots for SRR7180103.sra Written 748746 spots for SRR7180103.sra Read 748746 spots for SRR7180103.sra Written 748746 spots for SRR7180103.sra Read 748746 spots for SRR7180103.sra Written 748746 spots for SRR7180103.sra Read 748746 spots for SRR7180103.sra Written 748746 spots for SRR7180103.sra Read 748746 spots for SRR7180103.sra Written 748746 spots for SRR7180103.sra Read 748746 spots for SRR7180103.sra Written 748746 spots for SRR7180103.sra Read 748746 spots for SRR7180103.sra Written 748746 spots for SRR7180103.sra Read 748746 spots for SRR7180103.sra Written 748746 spots for SRR7180103.sra Read 748746 spots for SRR7180103.sra Written 748746 spots for SRR7180103.sra Read 748746 spots for SRR7180103.sra Written 748746 spots for SRR7180103.sra Read 748746 spots for SRR7180103.sra Written 748746 spots for SRR7180103.sra SRR ids: ['SRR7180103.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_x60cchry SRR7180103.sra spots: 14974925 blocks: [[1, 748746], [748747, 1497492], [1497493, 2246238], [2246239, 2994984], [2994985, 3743730], [3743731, 4492476], [4492477, 5241222], [5241223, 5989968], [5989969, 6738714], [6738715, 7487460], [7487461, 8236206], [8236207, 8984952], [8984953, 9733698], [9733699, 10482444], [10482445, 11231190], [11231191, 11979936], [11979937, 12728682], [12728683, 13477428], [13477429, 14226174], [14226175, 14974925]] SRR7180103 file size 5052810 SRR7180103 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7180103 SRR7180103_1.fastq SRR7180103_2.fastq Input file: SRR7180103_1.fastq Paired file: SRR7180103_2.fastq trimmed: SRR7180103-trimmed-pair1.fastq, SRR7180103-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Apr 10 16:00:37 2025 >> started Thu Apr 10 16:00:53 2025 >> done (15.925s) 14974925 read pairs processed; of these: 33580 ( 0.22%) short read pairs filtered out after trimming by size control 24901 ( 0.17%) empty read pairs filtered out after trimming by size control 14916444 (99.61%) read pairs available; of these: 5542842 (37.16%) trimmed read pairs available after processing 9373602 (62.84%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 4 0.00% 20 3 0.00% 21 1 0.00% 22 3 0.00% 23 7 0.00% 24 7 0.00% 25 7 0.00% 26 7 0.00% 27 14 0.00% 28 6 0.00% 29 10 0.00% 30 3 0.00% 31 5 0.00% 32 5 0.00% 33 5 0.00% 34 5 0.00% 35 4 0.00% 36 3 0.00% 37 8 0.00% 38 7 0.00% 39 9 0.00% 40 6 0.00% 41 9 0.00% 42 5 0.00% 43 12 0.00% 44 8 0.00% 45 11 0.00% 46 13 0.00% 47 15 0.00% 48 23 0.00% 49 19 0.00% 50 21 0.00% 51 23 0.00% 52 26 0.00% 53 27 0.00% 54 33 0.00% 55 33 0.00% 56 46 0.00% 57 53 0.00% 58 52 0.00% 59 70 0.00% 60 96 0.00% 61 91 0.00% 62 90 0.00% 63 116 0.00% 64 100 0.00% 65 129 0.00% 66 156 0.00% 67 202 0.00% 68 167 0.00% 69 243 0.00% 70 281 0.00% 71 346 0.00% 72 344 0.00% 73 439 0.00% 74 509 0.00% 75 598 0.00% 76 802 0.01% 77 789 0.01% 78 808 0.01% 79 995 0.01% 80 1206 0.01% 81 1310 0.01% 82 1496 0.01% 83 1855 0.01% 84 3198 0.02% 85 4302 0.03% 86 4488 0.03% 87 4910 0.03% 88 5324 0.04% 89 5347 0.04% 90 5700 0.04% 91 5918 0.04% 92 6351 0.04% 93 6577 0.04% 94 7121 0.05% 95 7265 0.05% 96 7988 0.05% 97 8488 0.06% 98 9105 0.06% 99 9741 0.07% 100 10251 0.07% 101 10868 0.07% 102 11594 0.08% 103 12215 0.08% 104 13011 0.09% 105 14076 0.09% 106 15085 0.10% 107 15832 0.11% 108 16687 0.11% 109 17857 0.12% 110 18664 0.13% 111 20023 0.13% 112 20658 0.14% 113 21694 0.15% 114 22795 0.15% 115 24010 0.16% 116 25169 0.17% 117 26517 0.18% 118 27928 0.19% 119 29258 0.20% 120 30628 0.21% 121 32362 0.22% 122 33723 0.23% 123 34046 0.23% 124 35562 0.24% 125 36957 0.25% 126 38367 0.26% 127 39969 0.27% 128 41264 0.28% 129 43095 0.29% 130 44307 0.30% 131 46748 0.31% 132 48204 0.32% 133 50206 0.34% 134 52594 0.35% 135 55214 0.37% 136 57046 0.38% 137 59347 0.40% 138 61764 0.41% 139 65606 0.44% 140 69310 0.46% 141 73245 0.49% 142 78705 0.53% 143 85210 0.57% 144 93861 0.63% 145 106235 0.71% 146 124371 0.83% 147 157793 1.06% 148 228157 1.53% 149 443625 2.97% 150 2685508 18.00% 151 9373602 62.84% 14916444 reads passed initial QC criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=3.41 fanout-score-rank=26 prefix-density=0.27 prefix-fanout=2.9 sequence=CCACATTTGCAGCCA criterion=fanout-score sequence-density=0.02 sequence-density-rank=31 fanout-score=50.31 fanout-score-rank=1 prefix-density=0.13 prefix-fanout=6.2 sequence=ATGAACACAACGATAATATTAGGCAACAAGAGGGACTCATGAGTTACATAACTGGTAGACAACTAGCTAGGTTAAAGACTCCATGGACGAAGGAGTGCTCTTATTCCACCATCTGTTTATTTATTTATATACCAAACGGTGAGTTGTTCTATTCTTATTTTCACCACACTGGTATTAAT criterion=sequence-density sequence-density=0.40 sequence-density-rank=1 fanout-score=2.29 fanout-score-rank=30 prefix-density=0.41 prefix-fanout=2.3 sequence=ATGTACCCTGACTTAGGTTTCTCAGA criterion=fanout-score sequence-density=0.01 sequence-density-rank=29 fanout-score=58.90 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=7.0 sequence=TTTTCTTTGAGAGTGCATAGATTTGTGTTGATATAGAAAACAATGGCACTACATGGAAAGATTGAGACAACATTAGATCTCAAGTCCTCCGCAGAGAAGTTCTACAAAGTGTGGAGGAGCCAGTCCTTCCATGTTCCCAAACATGCTTCCAAGCATATCCAAGGAGTTGATGTACATGCAGGTGACTGGGAGACTGCGGGATCTATCAGGATTTGGCAGTACACAATCGGAGGAAAAGCCGGGGTCTTTAAAGAGGAGGTTTCCTTCGATGATGAGAACAAGATCATAACTCTTAATGGTTTGGAAGGAGATGTCATGAAAATTTACAAGGTCTATAAGCCCACCTGGCAGCTTACACCAAAAGGCTCGGGCTGCTTGGCAAAACTGACCATTGAATACGAAAAACTCCATCCTGAAGTCCCGGTTCCAGAGATTTATGTTGATCTTATGGTTCATATGACTAAAGACATCGACGAAGCCCTTAGCTCGGAGTAATAGAAGGGGTCATCGA SRR7180103 testing PE reads STAR mapping to Ensembl genome Started job on | Apr 10 16:01:41 Started mapping on | Apr 10 16:01:41 Finished on | Apr 10 16:04:07 Mapping speed, Million of reads per hour | 367.80 Number of input reads | 14916444 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 13687357 Uniquely mapped reads % | 91.76% Average mapped length | 293.69 Number of splices: Total | 12641240 Number of splices: Annotated (sjdb) | 12294010 Number of splices: GT/AG | 12396269 Number of splices: GC/AG | 168988 Number of splices: AT/AC | 10856 Number of splices: Non-canonical | 65127 Mismatch rate per base, % | 0.76% Deletion rate per base | 0.07% Deletion average length | 3.00 Insertion rate per base | 0.04% Insertion average length | 2.72 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 455647 % of reads mapped to multiple loci | 3.05% Number of reads mapped to too many loci | 101705 % of reads mapped to too many loci | 0.68% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.33% % of reads unmapped: other | 0.17% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 799918 799918 799918 N_multimapping 455647 455647 455647 N_noFeature 496605 13554244 547004 N_ambiguous 166127 635 83238 UnstrandedReadsAssigned:13024625 PositiveStrandReadsAssigned:132478 NegativeStrandReadsAssigned:13057115 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7180103 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7180103-trimmed-pair1.fastq SRR7180103-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,916,444 reads, 12,850,859 reads pseudoaligned [quant] estimated average fragment length: 227.272 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,135 rounds 52401 SRR7180103.ke.tsv 34699 SRR7180103.se.tsv 87100 total ==> SRR7180103.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1791.73 1460 58.5459 Potri.005G024800.1.v4.1 1035 808.728 1537 136.548 Potri.004G059700.1.v4.1 961 734.747 19 1.85794 Potri.007G009000.2.v4.1 1416 1189.73 0 0 Potri.003G141000.2.v4.1 2943 2716.73 798 21.1044 Potri.016G087400.1.v4.1 270 81.5846 1220.57 1074.91 Potri.015G069301.1.v4.1 564 340.105 0 0 Potri.010G195200.1.v4.1 1773 1546.73 264.824 12.3015 Potri.012G127500.1.v4.1 977 750.733 8697 832.337 ==> SRR7180103.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 31 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 313 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 413 SRR7180103 completed mapping pipeline successfully